Literature DB >> 27995153

Data on eNOS T786 and G894T polymorphisms and peripheral blood eNOS mRNA levels in Sickle Cell Disease.

Iakovos Armenis1, Vassiliki Kalotychou1, Revekka Tzanetea2, Panagoula Kollia3, Zoi Kontogeorgiou4, Dimitra Anastasopoulou4, Marina Mantzourani1, Michael Samarkos1, Konstantinos Pantos5, Kostas Konstantopoulos6, Ioannis Rombos7.   

Abstract

In this article, we present data on endothelial Nitric Oxide Synthase (eNOS) gene T786C and G894T polymorphisms in Greek steady-state Sickle Cell Disease patients in comparison to healthy controls. Moreover, eNOS mRNA levels were determined in peripheral blood samples from 18 patients and 9 controls. This article complements our recently published article named "Prognostic value of eNOS T786C and G894T polymorphisms in Sickle Cell Disease" (I. Armenis, V. Kalotychou, R. Tzanetea, Z. Kontogeorgiou, D. Anastasopoulou, M. Mantzourani, M. Samarkos, K. Pantos, K. Konstantopoulos, I. Rombos, 2016) [1].

Entities:  

Year:  2016        PMID: 27995153      PMCID: PMC5154968          DOI: 10.1016/j.dib.2016.11.082

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications Table Value of the data Genotype and allele distribution of eNOS T786C and G894T polymorphisms were studied for the first time in Greek Sickle Cell Disease patients. This is the first study to find higher prevalence of the C allele in comparison to T for the -786 position in Sickle Cell Disease. Peripheral blood eNOS mRNA levels, as an index of eNOS expression, were studied and analyzed according to the presence or absence of Sickle Cell Disease and eNOS promoter T786C polymorphism.

Data

Genotype and allele distribution for polymorphisms T786C and G894T in patients and controls are presented in Table 1, Table 2 respectively. No statistically significant differences were obtained [1]. eNOS mRNA levels normalized to GAPDH are presented in Fig. 1 (Sickle Cell Disease patients relative to controls) and Fig. 2 (patients of eNOS 786TC and CC genotypes relative to patients of TT genotype).
Table 1

Genotype and allele frequencies for eNOS T786C polymorphism in Sickle Cell Disease patients and controls.

Frequencies
P
Sickle Cell Disease patients(n=79)Controls(n=48)
Genotypes
TT vs TC+CC21.5% vs 78.5%10.4% vs 89.6%0.173
CC vs TT+TC46.8% vs 53.2%47.9% vs 52.1%0.906









Alleles
T vs C37.3% vs 62.7%31.3% vs 68.70.324
Table 2

Genotype and allele frequencies for eNOS G894T polymorphism in Sickle Cell Disease patients and controls.

Frequencies
P
Sickle Cell Disease patients(n=79)Controls(n=48)
Genotypes
GG vs GT+TT50.6% vs 49.4%39.6% vs 60.4%0.226
TT vs GG+GT19.0% vs 81.0%12.5% vs 87.5%0.340









Alleles
G vs T65.8% vs 34.2%63.6% vs 36.4%0.712
Fig. 1

eNOS mRNA levels in Sickle Cell Disease patients (n=18) and healthy controls (n=9), relative to GAPDH mRNA. Sickle Cell Disease patients: 1.06±0.84, Controls: 1.30±0.92, P=0.105.

Fig. 2

eNOS mRNA levels relative to GAPDH in Sickle Cell Disease patients, according to their eNOS T786C genotype: TT: 1.22±0.89, TC: 2.45±1.88, CC: 2.10±1.87, P=0.454.

Experimental design, materials and methods

Study population

Seventy nine consecutive Greek SCD patients (mean age: 48.8±11.5 years, 25–76 years, 25 male, 54 female) and forty eight Greek healthy controls were enrolled. The study was approved by the Hospital Ethics Committee in accordance to Helsinki Declaration. All patients were at steady state at the time of sample collection (no painful crises or other acute complications during the last three months) and they had not been transfused for the last three months.

DNA extraction and eNOS genotyping

Genomic DNA was isolated from peripheral blood using the PureLink Genomic DNA extraction kit (Invitrogen). Nucleotide substitutions T786C and G894T were detected using Sanger sequencing and PCR-RFLPs techniques respectively. The PCR primers used were as follows: for T786C: 5′ATGCTCCCACCAGGGCATCA3′ (forward), 5′GTCCTTGAGTCTGACATTAGGG3′ (reverse) covering a fragment of 237 bp. and for G894T: 5′CATGAGGCTCAGCCCCAGAAC3′ (forward), 5′AGTCAATCCCTTTGGTGCTCAC3′ (reverse) covering a fragment of 206 bp. PCR conditions for T786C were: 92 °C for 15 s, 62 °C for 30 s, and 72 °C for 30 s repeated for 34 cycles. For G894T, we applied the previous conditions decreasing the annealing temperature to 58 °C. Presence of 786C polymorphism was determined by Sanger sequencing of the PCR product using the above mentioned PCR primers, as shown in Image 1. The 894T polymorphism was detected by PCR-RFLPs, digesting with the appropriate restriction enzyme, MboI, revealing two fragments of 119 base pairs and 87 base pairs, as shown in Image 2.
Image 1

Sanger sequencing results from 3 samples of 786CC, TT and TC genotype respectively.

Image 2

Agarose gel electrophoresis. Three samples were digested with MboI restriction enzyme, after PCR amplification for eNOS G894T polymorphism.

RNA extraction and quantitative real-time PCR

Eighteen SCD patients (5 male and 13 female) underwent eNOS expression study. Total RNA was isolated from peripheral blood of the above patients and 9 controls (4 male and 5 female), none of them smoking or receiving drugs apart from folate supplementation and acetylsalicylic acid. The RNeasy Mini Kit and Qiashredder homogenizer (Qiagen) after selective lysis of erythrocytes were applied. One microgram of total RNA was reverse-transcribed using the iScript™ cDNA SynthesisKit (Bio-Rad). Fifty nanograms of cDNA were used for eNOS quantification on a CFX-96 real-time PCR (Bio-Rad CFX96TouchTM) using hydrolysis probes for eNOS gene and for GAPDH as a reference gene (Applied Biosystems). Amplification was performed with the appropriate cycling parameters, 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Measurements were performed in duplicate using the iTaq™ Universal Probes supermix (Biorad). Relative gene expression data were analyzed using the Livak 2−ΔΔCt method.

Statistical analysis

Frequencies of genotypes and clinical characteristics were compared using Pearson׳s chi-square test and Fischer-exact test, where applicable. The general, dominant and recessive genetic models, as well as allele frequencies were used to compare patients and normal controls. Quantitative data were expressed as mean±S.D. and were compared with Analysis of Variance (ANOVA) or Mann–Whitney U test, whether applicable. Levene׳s F test was applied to estimate equality of variances and Kolmogorov–Smirnof test to assess deviation from normal distribution. A P-value lower than 0.05 was considered as statistically significant.
Subject areaGenetics, Hematology
More specific subject areaeNOS T786C, G894T polymorphisms, eNOS mRNA levels
Type of dataTable, image, figure
How data was acquiredVenous blood from 79 patients and 48 controls
Data formatAnalyzed
Experimental factorsVenous blood was collected from steady-state Sickle Cell Disease patients and healthy controls
Experimental featuresDNA extraction, RNA extraction, PCR, RFLPs, Sanger sequencing, qRT-PCR
Data source locationGreek non-consanguineous Sickle Cell Disease patients
Data accessibilityData is with this article
  1 in total

1.  Prognostic value of T786C and G894T eNOS polymorphisms in sickle cell disease.

Authors:  Iakovos Armenis; Vassiliki Kalotychou; Revekka Tzanetea; Panagoula Kollia; Zoi Kontogeorgiou; Dimitra Anastasopoulou; Marina Mantzourani; Michael Samarkos; Konstantinos Pantos; Kostas Konstantopoulos; Ioannis Rombos
Journal:  Nitric Oxide       Date:  2016-11-18       Impact factor: 4.427

  1 in total
  3 in total

1.  Berberine ameliorates mesenteric vascular dysfunction by modulating perivascular adipose tissue in diet-induced obese in rats.

Authors:  Man Wang; Xufang Geng; Kaipeng Li; Yawen Wang; Xiaofeng Duan; Congcong Hou; Lili Zhao; Huimin Zhou; Ding Zhao
Journal:  BMC Complement Med Ther       Date:  2022-07-25

2.  An Analysis of Racial and Ethnic Backgrounds Within the CASiRe International Cohort of Sickle Cell Disease Patients: Implications for Disease Phenotype and Clinical Research.

Authors:  Andrew D Campbell; Raffaella Colombatti; Biree Andemariam; Crawford Strunk; Immacolata Tartaglione; Connie M Piccone; Deepa Manwani; Eugenia Vicky Asare; Donna Boruchov; Fatimah Farooq; Rebekah Urbonya; Gifty Dankwah Boatemaa; Silverio Perrotta; Laura Sainati; Angela Rivers; Sudha Rao; William Zempsky; Fredericka Sey; Catherine Segbefia; Baba Inusa; Charles Antwi-Boasiako
Journal:  J Racial Ethn Health Disparities       Date:  2020-05-16

3.  Simulated datasets for population dynamics of sickle cell anaemia.

Authors:  S O Edeki; O O Akanbi
Journal:  Data Brief       Date:  2017-12-13
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.