Literature DB >> 27991526

Putative WRKYs associated with regulation of fruit ripening revealed by detailed expression analysis of the WRKY gene family in pepper.

Yuan Cheng1, Golam Jalal Ahammed2, Jiahong Yu1, Zhuping Yao1, Meiying Ruan1, Qingjing Ye1, Zhimiao Li1, Rongqing Wang1, Kun Feng1, Guozhi Zhou1, Yuejian Yang1, Weiping Diao3, Hongjian Wan1.   

Abstract

WRKY transcription factors play important roles in plant development and stress responses. Here, global expression patterns of pepper CaWRKYs in various tissues as well as response to environmental stresses and plant hormones were systematically analyzed, with an emphasis on fruit ripening. The results showed that most CaWRKYs were expressed in at least two of the tissues tested. Group I, a subfamily of the entire CaWRKY gene family, had a higher expression level in vegetative tissues, whereas groups IIa and III showed relatively lower expression levels. Comparative analysis showed that the constitutively highly expressed WRKY genes were conserved in tomato and pepper, suggesting potential functional similarities. Among the identified 61 CaWRKYs, almost 60% were expressed during pepper fruit maturation, and the group I genes were in higher proportion during the ripening process, indicating an as-yet unknown function of group I in the fruit maturation process. Further analysis suggested that many CaWRKYs expressed during fruit ripening were also regulated by abiotic stresses or plant hormones, indicating that these CaWRKYs play roles in the stress-related signaling pathways during fruit ripening. This study provides new insights to the current research on CaWRKY and contributes to our knowledge about the global regulatory network in pepper fruit ripening.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27991526      PMCID: PMC5171846          DOI: 10.1038/srep39000

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Complex and concerted biological processes such as plant growth and development are regulated by various internal and external environmental signals. Transcription factors play an important part in these signaling pathways12. As one of the largest transcription factor families in higher plants, WRKY have been shown to be involved in a multitude of biological processes, including stress response and physiological progress. The common feature of WRKY proteins is the highly conserved N-terminal WRKY domain, which includes an almost conservative peptide (WRKYGQK) and a zinc-finger structure (Cx4–5Cx22–23HxH or Cx7Cx23HxC)3. The WRKY domain consists of a four-stranded β-sheet and a zinc-binding pocket. It is now known to be the critical structure for DNA binding4, which helps to activate or repress the transcription of downstream target regions and regulates the relevant physiological processes. Since its first identification in sweet potato56, WRKY has been characterized in various plant species and shown to be involved in many biological processes, including biotic and abiotic stress responses789 and plant–pathogen interactions910. In tomato, the effector-triggered immunity against Pseudomonas syringae pv. tomato strain DC3000 (PstDC3000) depends on the expression of SlPR1 and SlPR1a1 induced by SlWRKY3911. SlWRKY12 positively regulates resistance to Botrytis cinerea8. In pepper, CaWRKY40 was proved to be involved in the modulation of both high temperature tolerance and Ralstonia solanacearum resistance, and this regulation seems to depend on the transcriptional activation of CaWRKY069, which is a classical feedback regulation mode of WRKY proteins. In addition, WRKY proteins also play an important role in plant growth and development, such as plant hormone signaling712, secondary signal metabolism1314, trichome and seed development1516, germination17 and leaf senescence1819. As a highly conserved protein family reflected by both conservative WRKY-domain and specific W-box (TTGACC/T) recognition, the diverse regulating function of WRKY is partly due to its interaction with other proteins that forms a complex signal transduction pathway20. In Arabidopsis, AtWRKY25 and AtWRKY33 interact with AtMKS1 (substrate of AtMPK4) to form a complex, which is subsequently involved in the plant defense response2122. Known to regulate endosperm growth and seed size, AtIKU1 also interacts with AtWRKY1023. Recent studies showed that a newly identified VQ-motif protein family is one of the most important WRKY interacting proteins, some WRKY and VQ proteins sometimes work together to regulate biological processes20. At present, the majority of identified WRKYs are from model plants, such as Arabidopsis and rice2425. Klee and Giovannoni26 classified fleshy fruits into two physiological types—climacteric (tomato and banana) and non-climacteric (pepper and strawberry). Thus, pepper and tomato present suitable models for highlighting the different types of fruit ripening processes. In the past, little focus was placed on the fruit maturing process of pepper, a non-climacteric fruit, as compared to the climacteric fruit tomato. As a critical stage for pepper yield and quality (size, weight, color, nutrient), fruit ripening can also be affected by many internal and external factors such as hormone signals and biotic or abiotic stresses112728. Transcription factors are also important for fruit ripening2930. Recently, different types of transcription factors, including WRKY, MYB, and AP2/EREBP, have been induced during the ripening of pepper fruits31. Several CaWRKYs have also been reported to be involved in stress responses in pepper91032. However, there are a very few studies on the potential roles of CaWRKY proteins in fruit maturation. The recent elucidation of the whole pepper genome sequence3334 (http://peppersequence.genomics.cn/;http://pgd.pepper.snu.ac.kr) will be an asset in deciphering expression patterns and potential functions of all CaWRKY transcription factors during the process of pepper fruit maturation. Although a comprehensive study of CaWRKYs in pepper was recently performed35, little focus was placed on comprehensive expression profiles of the entire WRKY gene family in tissues and their response to abiotic stresses. The global analysis of the CaWRKY gene expression pattern will facilitate the functional studies of pepper CaWRKYs. We identified 61 CaWRKYs and analyzed the expression profiles of all the members in various tissues using RNA-seq and quantitative real-time PCR (qPCR), with emphasis on fruit maturation. Furthermore, comprehensive analysis of the expression patterns of the whole CaWRKY gene family under different stress conditions (high salinity, drought, and heat) and in the presence of phytohormones (salicylic acid [SA], jasmonic acid [JA], abscisic acid [ABA] and brassinolide [BR]) revealed the critical and complex regulating roles of CaWRKYs in pepper fruit maturation at the transcriptional level.

Results

Classification and expression profile analysis of pepper CaWRKY genes

A total of 61 potential CaWRKYs were identified in the pepper genome (Supplemental Table S1). Based on the number and structure of WRKY domains, 55 of the CaWRKY proteins were classified into three main groups: group I, group II (IIa, IIb, IIc, IId, and IIe), and group III (Supplemental Figure S1; Supplemental Table S2). Two of the CaWRKYs (CaWRKY01 and CaWRKY12) were excluded from phylogenetic analysis as their WRKY domains were incomplete (Supplemental Table S3). The remaining four CaWRKYs (CaWRKY17, CaWRKY19, CaWRKY46, and CaWRKY52) showed evolutionary uniqueness (Supplemental Figure S1) and were not assigned to any group. Thus, all these genes were defined as None-group (NG) in the study. As shown in Fig. 1A, the group II (including IIa, IIb, IIc, IId, and IIe) members had a higher proportion of proteins (54.1%) than did the other groups (I, III and NG). Of the five subgroups within group II, group IIc had the highest proportion of proteins (19.7%), whereas group IIa had the lowest (6.6%).
Figure 1

Subfamily constitution of pepper CaWRKYs.

(A) Group constitution of the identified pepper CaWRKYs. (B) CaWRKY genes expressed in the investigated plant tissues. A signal intensity level of over 5.0 is considered to be expressed in the given tissue. 50 of the 61 CaWRKYs are expressed in at least one tested tissue. Percentages of CaWRKY groups are demonstrated in the figure.

Using the RNA-seq data of different pepper tissues (root, stem, leaf, bud, flower, and fruit) published previously33, we found that 50 CaWRKY genes were expressed in at least one tissue (reads per kilobase exon model per million mapped reads [RPKM] ≥5.0 was defined as expressed) (Supplemental Table S4). The highest expression level (RPKM = 487.77) was detected for CaWRKY28 in leaf. As shown in Fig. 1B, the group II members comprised up to 60% and the group I members 24% of all the 50 expressed CaWRKYs. Comparative analysis found that the percentage of WRKYs expressed in group I and group II was higher than that in the remaining two groups (Fig. 1A,B), indicating their higher activity. Among the remaining non-expressed CaWRKY genes, 7 out of 11 were derived from group III (CaWRKY05, CaWRKY29, CaWRKY32 and CaWRKY49) and NG (CaWRKY17, CaWRKY19 and CaWRKY46) (Supplemental Tables S2 and S4). Meanwhile, all members of group IId and group IIe CaWRKYs were expressed in at least one of the tissues examined (Supplemental Tables S2 and S4).

CaWRKY gene expression in different tissues

To compare in detail the CaWRKY expression in different tissues, the RNA-seq data of the 61 CaWRKY genes were selected for further analysis33. CaWRKY genes with RPKM value ≥5.0 were defined as expressed genes in the specific tissue. The genes expressed only in one tissue were considered to be specifically expressed CaWRKYs, and those with the highest expression in specific tissue were regarded as preferentially expressed. According to Table 1, the number of both expressed and preferentially expressed CaWRKYs in vegetative tissue (root, stem, and leaf) was higher than that in reproductive tissue (bud, flower, and fruit). Only one or two specifically expressed CaWRKY genes were identified in each tested tissue. As shown in Fig. 2A and supplemental Table S4, the expression of some CaWRKY genes was tissue specific, such as that of CaWRKY09 (RPKM = 11.21) and CaWRKY26 (RPKM = 20.26) that were only expressed in the root, CaWRKY04 (RPKM = 20.71) that was expressed in the stem, CaWRKY40 (RPKM = 8.82) and CaWRKY56 (RPKM = 17.18) that were expressed in the leaf, CaWRKY01 (RPKM = 31.42) that was expressed in the fully ripened fruit, and CaWRKY25 (RPKM = 480.15) that was expressed in floral parts. However, most CaWRKYs were expressed in two or more tissues. Furthermore, compared to reproductive organs (flower and fruit), the number of preferentially expressed CaWRKYs was higher in vegetative parts.
Table 1

The number of expressed, preferentially expressed, and specifically expressed CaWRKY genes in different tissues.

TypeRootStemLeafBudFlowerFruit-Dev5Fruit-Dev6Fruit-Dev7Fruit-Dev8
Expressed CaWRKYs403740233420212123
Preferentially expressed CaWRKYs15717140211
Specifically expressed CaWRKYs212000001
Figure 2

Cluster analysis of tissue-specific expression profiles of pepper (A) and tomato (B) WRKY genes. WRKY gene expression was obtained from the RNA-seq data. WRKY genes and various tissues are represented as rows and columns. Green, black, and red elements indicate low, regular, and high signal intensity, respectively. Cluster analysis was performed based on expression profiles of 61 CaWRKYs (A) and 81 SlWRKYs (B) in various tissues (root, stem, leaf, flower, and fruit). CaWRKYs that belong to the same group are clustered together for a more intuitive analysis.

Based on the CaWRKY expression profiles in various tissues (root, leaf, fruit) and different stages of fruit development (Fig. 3), we found that more than half (54.2%) of CaWRKYs were simultaneously expressed in the root, leaf, and fruit. Moreover, root and leaf possess many common CaWRKYs (Fig. 3A). Further analysis suggested that nearly 40% of CaWRKYs were always expressed during the process of fruit ripening (Dev5 to Dev8), and 19.4% of CaWRKYs seem to be expressed only at the late stage of fruit maturation (Dev8) (Fig. 3B).
Figure 3

Number of expressed CaWRKYs in different tissues.

The interaction of vegetative tissues (roots and leaves) and reproductive tissue (fruits) (A) and the number of expressed CaWRKYs in different fruit developmental stages (Dev5, Dev6, Dev7, Dev8) (B).

Further analysis of the expression profiles in various tissues revealed that, although group I members possess only 24% of the detected expressed CaWRKYs (Fig. 1), the percentage of group I members in reproductive tissues (bud, flower and fruit) and especially in fruits at the early mature stages, was significantly higher (~42%) (Table 2), suggesting the potentially important role of group I CaWRKYs during fruit ripening. The subgroup IId presented a similar situation (Table 2). In contrast, although group III contained 10.0% of all expressed CaWRKYs, the members of this group were barely detected in fruits. The expression profiles of other groups and subgroups varied among different tissues. For example, the proportion of expressed CaWRKYs from subgroups IIa and IIb were well distributed in all the tissues tested, and group IIc had the lowest percentage in the bud (Table 2).
Table 2

Subfamily constitution of expressed CaWRKY genes in different tissues of pepper plants.

TypeRoot%Stem%Leaf%Bud%Flower%FruitTotal%
Dev5%Dev6%Dev7%Dev8%
I1025.6924.31024.4833.3926.5945.0942.9838.1729.21223.5
IIa25.125.537.328.325.915.014.814.814.235.9
IIb512.825.424.928.338.8210.029.529.528.359.8
IIc717.91027.0922.028.3617.6210.0314.3419.5625.01121.6
IId512.8513.5512.2312.5411.8420.0314.3523.8312.559.8
IIe512.8410.8512.2416.7514.715.029.514.828.3611.8
III410.3410.8614.628.3411.800.000.000.028.3611.8
NG12.612.712.414.212.915.014.800.014.235.9
Total39100371004110024100341002010021100211002410054100

NG: None-group, genes that were not assigned to any group; Dev 5: Mature green, the full size green fruit (5–6 cm); Dev6: Breaker, fruit turning red; Dev7: Breaker plus 3days; Dev8: Breaker plus 5 days.

In order to confirm the reliability of RNA-seq data, qPCR was used to test and verify the expression of CaWRKY genes in nine specific tissues (root, stem, leaf, bud, flower, green fruit, red fruit, and seed) of the pepper commercial F1 hybrid Zhejiao-3. Ten CaWRKY genes with tissue-specific expression patterns were selected for comparison. The results obtained were consistent with the RNA-seq data (Figs 2 and 4), proving the reliability of the RNA-seq data33 (http://peppersequence.genomics.cn).
Figure 4

Expression of 12 CaWRKY genes in various tissues.

The expression levels of these CaWRKYs in various tissues (root, stem, leaf, bud, flower, green fruit, red fruit, and seed) were tested using qPCR and the results showed high consistence with the RNA-seq data.

Conserved constitutive highly expressed CaWRKYs in pepper and tomato

Of all the expressed CaWRKYs, 16 were highly expressed and found abundantly in each tissue. These were identified (Supplemental Table S4) as group I (5), group II (10) and NG (1) and defined as conserved, constitutively highly expressed CaWRKYs (Table 3). The expression levels of these CaWRKY genes in most tested tissues were significantly higher than the basic RPKM value (5.0), some of which reaching up to 500 (CaWRKY28 in leaf, RPKM = 487.77). With the average expression level of 185.97 among all the tested tissues, CaWRKY28, a member of group I, had the highest expression in almost every tissue (Supplemental Table S4).
Table 3

Constitutively highly expressed CaWRKYs in pepper, tomato, and potato.

NameLocus no.TypeNameLocus no.Type
CaWRKY28Capana06g001506ISlWRKY11solyc07g066220.2.1I
CaWRKY53Capana11g001882ISlWRKY12solyc06g066370.2.1I
CaWRKY38Capana07g002454ISlWRKY01solyc12g014610.1.1I
CaWRKY21Capana03g003085ISlWRKY61solyc07g065260.2.1I
CaWRKY24Capana04g001820ISlWRKY27solyc03g104810.2.1I
CaWRKY27Capana06g001110IIaSlWRKY47solyc05g012770.2.1I
CaWRKY11Capana02g002230IIbSlWRKY75solyc12g006170.1.1I
CaWRKY34Capana07g001387IIbSlWRKY06solyc07g047960.2.1I
CaWRKY03Capana01g002803IIcSlWRKY51solyc07g005650.2.1I
CaWRKY36Capana07g001968IIcSlWRKY73solyc06g068460.2.1IIa
CaWRKY23Capana04g000568IIdSlWRKY25solyc07g051840.2.1IIb
CaWRKY60Capana00g003083IIdSlWRKY74solyc02g080890.2.1IIb
CaWRKY30Capana06g003072IIdSlWRKY33solyc02g093050.2.1IIc
CaWRKY41Capana08g001012IIeSlWRKY20solyc02g088340.2.1IIc
CaWRKY10Capana02g001642IIeSlWRKY63solyc01g079260.2.1IIc
CaWRKY12Capana02g003053NGSlWRKY53solyc05g012500.2.1IIc
   SlWRKY42solyc08g006320.2.1IId
   SlWRKY58solyc04g078550.2.1IId
   SlWRKY78solyc07g055280.2.1IId
   SlWRKY57solyc06g008610.2.1IId
   SlWRKY15solyc09g066010.1.1IId
   SlWRKY07solyc01g079360.2.1IId
   SlWRKY16solyc01g095630.2.1III
   SlWRKY76solyc03g095770.2.1III
   SlWRKY23solyc09g015770.2.1III
   SlWRKY54solyc05g050330.2.1III

NG: None-group, genes that were not assigned to any group.

Additionally, 26 out of 81 constitutively highly expressed tomato WRKYs (SlWRKYs) from various tissues (root, leaf, bud, flower and fruit) were identified (Fig. 2B; Table 3; Supplemental Table S4). Phylogenetic analyses of 16 and 26 SlWRKYs constitutively highly expressed in pepper and tomato, respectively, revealed 14 pairs of orthologous genes (Fig. 5), implying their potential functional conservation. The results showed that, in addition to the resemblance in group constitution between pepper and tomato (Table 3), some SlWRKY members were also evolutionarily conservative with genes of pepper. For example, pepper CaWRKY28 and tomato SlWRKY12 were both constitutively highly expressed in various tissues as orthologous proteins. The similar phenomenon was also observed in many other conserved highly expressed WRKY pairs (Fig. 5; Table 3), indicating that the basic expression pattern of WRKY transcription factors might have been formed before the differentiation of Solanaceae plants and that they performed conservative and basic functions in plant growth and development.
Figure 5

Phylogenetic analysis of constitutively highly expressed WRKYs in tomato and pepper.

The orthologous genes between tomato and pepper are highlighted in gray.

Preferentially and specifically expressed CaWRKY genes during pepper fruit ripening

According to the expression standard (RPKM ≥5.0), 31 CaWRKY genes were expressed during fruit maturation and the highest expression level (RPKM = 200.28) was detected for CaWRKY28 in the late maturation stage of the fruit (Dev8: 5th day after breaker). Among the 31 CaWRKY genes, four of them were preferentially expressed at Dev6 (breaker), Dev7 (3rd day after breaker) and Dev8, while only one of the specifically expressed CaWRKY was detected in the late maturation stage of the fruit (Dev8) (Table 1; Supplemental Table S4). The five preferentially or specifically expressed CaWRKYs belong to group I (CaWRKY24 in Fruit-Dev7, RPKM = 58.45; CaWRKY51 in Fruit-Dev6, RPKM = 7.82), group IIb (CaWRKY11 in Fruit-Dev8, RPKM = 171.69), and NG (CaWRKY01 in Fruit-Dev8, RPKM = 31.42; CaWRKY52 in Fruit-Dev6, RPKM = 5.57) (Table 1; Supplemental TableS4). The analysis of the average expression level of CaWRKYs suggested that the 31 CaWRKYs expressed in fruit are globally induced during the fruit ripening process. The average expression level of group IIb was dramatically increased from 7.24 (Dev5: mature green stage) to 101.70 (Dev8) (Supplemental Table S5). Unlike the other groups, which demonstrated sustained increase in expression during the ripening process, the expression levels of group IIa and group IId attained the highest levels at Dev7 and showed a sudden decrease at Dev8 (Supplemental Table S5).

CaWRKYs expressed during pepper fruit maturation are regulated by different types of stresses

The expression of CaWRKY genes in pepper fruit under abiotic stress conditions (high temperature, high salinity, and drought) was analyzed using qPCR. Stress-induced genes were identified (change fold ≤0.5 as down-regulated or change fold ≥1.5 as up-regulated). The results showed that of all CaWRKY genes expressed in fruit, 26 and 27 genes were regulated by high temperature and high salinity, respectively, whereas only 14 responded to drought stress (Supplemental Tables S6 and S7). All of the 22 CaWRKYs expressed in premature fruits (Dev5 and Dev6), with the exception of CaWRKY31 and CaWRKY60, were regulated by at least one of the tested stress treatments. Meanwhile, all the 30 CaWRKYs expressed during the late-maturity period (Dev7 and Dev8), except for CaWRKY31 and CaWRKY60, were regulated by at least one type of stress (Supplemental Tables S6 and S7). As shown in Supplemental Table S6, a much greater number of genes were regulated by high temperature and high salinity than by drought, and most of them were up-regulated. However, when exposed to drought, most CaWRKYs seem to be down-regulated (Supplemental Table S6). The high consistency of the regulatory pattern of CaWRKY genes under heat and high salinity indicated a close relationship between the two pathways and the function of CaWRKYs in the signaling pathway. The stress-regulated CaWRKY genes demonstrated diverse expression patterns at different maturing stages of pepper fruit. Some stress-induced CaWRKYs were constitutively expressed throughout the ripening period, whereas others exhibited different expression patterns during pre-maturation and full maturation stages (Supplemental Table S4). In the late maturity stage, not only were more CaWRKYs detected in fruit, but also the expression levels of the corresponding genes increased (Supplemental Table S4), which means that heat-, drought-, and salinity-regulated CaWRKY genes preferentially participated in the process at the late maturity stage. The involvement of many heat-, high salinity-, and drought-regulated CaWRKYs during fruit maturation indicates an important role of these genes in the response of fruit to abiotic stresses.

CaWRKY expression under hormone treatment

Many CaWRKYs have been reported to take part in biological processes regulated by plant hormones712. In our study, the qPCR analysis showed that most CaWRKYs expressed in fruit could be regulated by the four hormones tested, namely SA, JA, ABA, and BR (Supplemental Tables S7 and S8). Of all these CaWRKY genes, the expression of 24, 25, 24 and 18 genes was significantly changed (induced or repressed) under SA, JA, ABA and BR treatment, respectively (Supplemental Table S8). The number of up-regulated CaWRKYs was significantly higher than that of down-regulated genes under SA, ABA, and BR treatments, whereas the number of JA-induced and repressed genes remained almost the same (Supplemental Tables S7 and S8). Furthermore, compared to the other plant hormones, CaWRKYs expressed in fruits seemed to be less sensitive to BR. Overall, the expression of CaWRKY genes in different stages of fruit maturity demonstrated divergent response profiles under each of the four hormone applications. The role of ABA in various biological processes, including fruit ripening, seed dormancy and environmental stress responses, has been widely reported283637. However, to better understand the roles of CaWRKYs in the ABA-dependent fruit ripening and stress responses, we further analyzed the CaWRKY expression profiles under ABA treatment. The results showed that most of the 31 CaWRKYs expressed in fruit were significantly regulated by ABA; 17 were up-regulated and 6 were down-regulated (Supplemental Table S8). As ABA takes part in various stress responses including those to high salinity, drought, and extreme temperatures37, the expression patterns of all the CaWRKYs expressed in fruits under ABA were compared under the three abiotic stress (high salinity, drought, and heat) treatments. Almost all ABA-induced CaWRKY genes were regulated by at least one of the stresses applied (Supplemental Table S9). These ABA- and stress-regulated CaWRKY genes demonstrated a similar trend, especially under ABA, high-salinity, and heat treatments. Most of them were induced, suggesting a common and positive or sometimes redundant role in the ABA and environmental stress signaling pathways.

Discussion

The WRKY transcription factors, a large protein superfamily, is found abundantly in plants, with hundreds of WRKYs identified up to now242538. The number of WRKY genes in plants range from one in green algae to 75 WRKYs in Arabidopsis339. Furthermore, most of these proteins are reported to be involved in defense and resistance processes404142. Recently, the genome of the tomato plant, a representative of the Solanaceae, has been found to encode at least 81 SlWRKYs38. In our study, 61 CaWRKYs were identified using bioinformatics in pepper. It is well known that tomato and pepper, which represent a typical climacteric and non-climacteric fruit, respectively, have emerged as models for fruit ripening. Our study showed that about 36% of CaWRKYs and 35% of SlWRKYs were expressed in pepper and tomato fruits, respectively (Fig. 2), indicating the potentially critical role of WRKYs in plant growth and development, especially in the regulation of fruit ripening in the two species. In the present study, 16 CaWRKYs were constitutively highly expressed in almost every tissue tested, suggesting their importance and fundamental functions in pepper plant development (Table 3; Fig. 2). At least 25 SlWRKYs were also found to be constitutively highly expressed in most tomato tissues. The subfamily constitution of these CaWRKYs and SlWRKYs were found to be very similar (Table 3). Moreover, 13 pairs of orthologous WRKY were identified (Fig. 5), further indicating the potentially conserved role of these WRKYs in plant development in Solanaceae plants. Additionally, the work on SlWRKY genes by Huang et al.38 and qPCR results of pepper CaWRKY under biotic and abiotic stress conditions (Supplemental Table S7) indicate that the expression of several pairs of constitutively expressed orthologous WRKYs is highly consistent. For example, CaWRKY36 and SlWRKY53 are both significantly induced by high salinity and B. cinerea infection, CaWRKY11 and SlWRKY74 are up-regulated under drought condition. The highly similar stress response pattern of these orthologous CaWRKY and SlWRKY strongly suggests that the potential roles of WRKY transcription factors in plants are conserved and already formed before the differentiation of tomato and pepper as separate species in the family of Solanaceae. Fruit ripening is a complex biological process and comprises a series of morphological, physiological, and biochemical processes that encompass pigmentation, nutrition, and metabolism of other flavor substances314344. Numerous transcription factors have been reported to take part in the regulation of fruit ripening. For instance, a MADS-box transcription factor gene (LeMADS-RIN) defined as a master regulator of ripening, was found to affect all known ripening pathways2945. In addition, transcription factors, such as bHLH, NAC, bZIP, and WRKY, also function during tomato or pepper fruit ripening3146. In pepper, more than half of the CaWRKY genes were expressed at different stages of ripening. Among them, six highly expressed CaWRKYs that belonged to either group I (4) or group IId (2) were detected at the early maturation stages (Dev5 and Dev6). In the late stages of pepper maturation (Dev7 and Dev8), not only was the average expression level higher compared to that in the pre-maturity stage (Supplemental Table S5), but also the CaWRKY constitution of groups was more diverse. The diverse constitution of CaWRKYs at this stage reflected the more complicated biological processes at work in this stage of fruit ripening. The significant transcript level changes of numerous CaWRKY genes in our study led us to believe that, similar to other maturation-regulating transcription factors identified in tomato (SlNAC1, RIN, and ERF)444748, CaWRKY also plays an important role in the fruit ripening regulatory network. Early evolutionary origin of the group I WRKYs is supported by the fact that all WRKYs identified in lower plants belong to this group4950. We found that group I comprised nearly 25% of the total identified CaWRKYs. Of these, only two CaWRKY members have been functionally identified in disease resistance process (CaWRKY13/Ca02g003339 and CaWRKY45/Ca09g001251)5152. Although current studies attribute group I CaWRKYs to disease resistance, our results suggest that group I CaWRKYs play a more important and fundamental role than other groups in reproductive development, especially in ripening of pepper fruit. Group I proteins composed around 24% of all expressed CaWRKYs in the five tissues analyzed (root, stem, leaf, bud, flower, and fruit). Interesting, nearly 30% of the expressed CaWRKYs during fruit ripening and two of the four CaWRKYs (CaWRKY24 and CaWRKY51) preferentially expressed in fruits belonged to group I. Moreover, the average expression level of group I CaWRKY genes was also higher in pepper fruit tissues, and transcription abundance increased along with the ripening process (Supplemental Table S5). In contrast, the remaining group III CaWRKYs were absent during maturation, revealed by their very low expression level in ripening fruits (Table 2; Supplemental Table S5). These results suggest the possible major role of group I CaWRKYs in pepper fruit development, especially in the fruit maturation process. As a complex and genetically programmed process characterized by changes in the color, texture, flavor, and aroma30, fruit maturation is affected by various internal and environmental factors, including different hormones like ethylene (ET), auxin (IAA), and ABA283144 and stress conditions such as salinity, high temperature, or cold2748. For example, IAA is known to retard tomato ripening by regulating ET and ABA28. The down-regulation of auxin-responsive transcription factor gene (ARF) during pepper maturation also indicates the negative role of auxin31. Moreover, salinity positively affects the contents of antioxidant compounds at different ripening stages of pepper fruits27. In our study, most CaWRKYs expressed in the fruit are regulated by high salinity, drought, or heat and exhibit a similar trend, especially when induced by both high salinity and heat acting together (Supplemental Tables S6 and S7). This phenomenon supported the argument that some abiotic stresses share common gene regulating responses and signal transduction pathways53. Among the three abiotic stresses applied, the effect of both high salinity and heat was more significant as compared to drought on CaWRKY genes expressed in fruits, indicating that the fruit ripening process might be more sensitive to salinity and high temperature. As a stress responsive plant hormone, ABA can effectively increase the pigmentation and accelerate ripening of sweet cherry fruits54. We found that some CaWRKYs simultaneously regulated by abiotic stresses and ABA followed the same pattern, suggesting that these CaWRKY genes were regulated by stress-induced ABA in fruit. However, some other CaWRKYs demonstrated a different stress-regulated pattern as compared to ABA application. For example, ABA-induced CaWRKY12 and CaWRKY37 were both repressed under high temperature, and the expression of drought-repressed CaWRKY06 increased after ABA treatment (Supplemental Table S7). Comprehensive analysis of CaWRKY expression pattern under ABA treatment revealed that ABA is not only involved in many stress responses, but also reminds us of the complexity of the pepper fruit ripening process, which involves a myriad of CaWRKY transcription factors, interconnected with plant hormones and stress responding pathways.

Materials and Methods

Identification of CaWRKY encoding genes

The amino acid sequences of Capsicum annuum L. ‘Zunla-1’ were downloaded from the pepper genome database (PGD, http://peppersequence.genomics.cn)33 and used to construct a local database using the software Bioedit 7.0 (www.softpedia.com/get/Science-CAD/BioEdit.shtml). A Blastp search was performed using the amino acid sequences of the WRKY transcription factors from tomato and potato3855. Additionally, the hidden Markov model (HMM) profile of the WRKY domain (Pfam: PF03106) from Pfam 27.0 database (http://pfam.xfam.org/) was used to identify candidate WRKY sequences. The e-value used was 1e−5. After excluding the redundant sequences, the remaining sequences were determined by Pfam 27.0.

Expression analysis of pepper and tomato WRKYs in various tissues

Two Illumina RNA-seq datasets downloaded from the PGD and Tomato Functional Genome Database (TFGD, http://ted.bti.cornell.edu/) were used to analyze the expression patterns of WRKY genes in the root, stem, leaf, bud, flower, and fruit tissues of pepper and in the root, leaf, bud, flower, and fruit tissues of tomato, respectively. Fragments per kilobase of exon model per million mapped (FPKM) values were log2-transformed and heat maps with hierarchical clustering were exhibited using the software Mev 4.9.056.

Phylogenetic analysis of WRKYs

Amino acid sequences of all WRKYs from pepper and tomato were detected using SMART (http://smart.emblheidelberg.de/). Conserved WRKY domains from WRKY transcription factors in pepper and tomato were aligned using ClustalX version 1.83 with default settings (http://www.clustal.org/). A phylogenetic tree was constructed using the software MEGA 5.0557 based on conserved WRKY domains. In the phylogenetic tree, relative branch support was assessed using bootstraps (1000 replicates). Branch lengths were calculated by pairwise comparison of the genetic distances, and missing data were treated by pairwise deletions of gaps.

Plant materials and stress and hormone treatments

Seeds of the pepper cultivar Zhejiao-3 were germinated in plastic pots with a 3:1 (v/v) mixture of peat and vermiculite and grown in a growth room (25 °C/22 °C, 12 h light/12 h dark). The roots, stems, leaves, buds, and flowers were harvested from 8-week-old pepper plants. The 4-week-old seedlings were sprayed with 10 mM salicylic acid (SA), 100 μM jasmonic acid (JA), 50 μM abscisic acid (ABA), and 10 μM brassinolide (BR) solutions, and leaves were collected 12 h later. For abiotic stress treatments, 4-week-old seedlings were exposed to high salt by culturing them in 150 mM NaCl solution for 12 h, exposed to drought by withholding water for 9 d, or to heat by elevating the temperature to 42 °C for 3 h, and leaves were collected at the end of each treatment. All materials were frozen in liquid nitrogen and used for the following expression analyses.

RNA isolation, cDNA synthesis, and quantitative RT-PCR analysis

Total RNA from all samples was isolated using TRIZOL reagent and single-stranded cDNA was synthesized following the manufacturer’s procedure (TIANGEN, Beijing, China). Gene-specific primer pairs were designed using GeneScript real-time PCR primer design (www.genescript.com; Supplemental Table S10) and further verified for their specificity by observing a single amplicon during electrophoresis. qPCR reactions were carried out using the following program: 10 min at 94 °C, 30 cycles of 45 s at 94 °C, 45 s at 55 °C, and 1 min at 72 °C, followed by an extension of 7 min at 72 °C. The ubiquitin-conjugating enzyme genes (UBI1-F:AAGGAAATGTGTGTCTCAAC; UBI1-R: TCCAAATGCCAAACTTCTAG) were used as a reference. Relative gene expression was calculated in accordance with the methods described by Livak and Schmittgen58.

Additional Information

How to cite this article: Cheng, Y. et al. Putative WRKYs associated with regulation of fruit ripening revealed by detailed expression analysis of the WRKY gene family in pepper. Sci. Rep. 6, 39000; doi: 10.1038/srep39000 (2016). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  53 in total

1.  Unraveling the regulatory network of the MADS box transcription factor RIN in fruit ripening.

Authors:  Guozheng Qin; Yuying Wang; Baohua Cao; Weihao Wang; Shiping Tian
Journal:  Plant J       Date:  2011-12-19       Impact factor: 6.417

2.  CaWRKY6 transcriptionally activates CaWRKY40, regulates Ralstonia solanacearum resistance, and confers high-temperature and high-humidity tolerance in pepper.

Authors:  Hanyang Cai; Sheng Yang; Yan Yan; Zhuoli Xiao; Junbin Cheng; Ji Wu; Ailian Qiu; Yan Lai; Shaoliang Mou; Deyi Guan; Ronghua Huang; Shuilin He
Journal:  J Exp Bot       Date:  2015-04-06       Impact factor: 6.992

3.  CaWRKY58, encoding a group I WRKY transcription factor of Capsicum annuum, negatively regulates resistance to Ralstonia solanacearum infection.

Authors:  Yuna Wang; Fengfeng Dang; Zhiqin Liu; Xu Wang; Thomas Eulgem; Yan Lai; Lu Yu; Jianju She; Youliang Shi; Jinhui Lin; Chengcong Chen; Deyi Guan; Ailian Qiu; Shuilin He
Journal:  Mol Plant Pathol       Date:  2012-10-11       Impact factor: 5.663

4.  The Mg-chelatase H subunit of Arabidopsis antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.

Authors:  Yi Shang; Lu Yan; Zhi-Qiang Liu; Zheng Cao; Chao Mei; Qi Xin; Fu-Qing Wu; Xiao-Fang Wang; Shu-Yuan Du; Tao Jiang; Xiao-Feng Zhang; Rui Zhao; Hai-Li Sun; Rui Liu; Yong-Tao Yu; Da-Peng Zhang
Journal:  Plant Cell       Date:  2010-06-11       Impact factor: 11.277

5.  Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5' upstream regions of genes coding for sporamin and beta-amylase from sweet potato.

Authors:  S Ishiguro; K Nakamura
Journal:  Mol Gen Genet       Date:  1994-09-28

Review 6.  An update on abscisic acid signaling in plants and more...

Authors:  Aleksandra Wasilewska; Florina Vlad; Caroline Sirichandra; Yulia Redko; Fabien Jammes; Christiane Valon; Nicolas Frei dit Frey; Jeffrey Leung
Journal:  Mol Plant       Date:  2008-01-14       Impact factor: 13.164

7.  Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum.

Authors:  Shengxiong Huang; Yongfeng Gao; Jikai Liu; Xiaoli Peng; Xiangli Niu; Zhangjun Fei; Shuqing Cao; Yongsheng Liu
Journal:  Mol Genet Genomics       Date:  2012-05-09       Impact factor: 3.291

8.  Roles of arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress.

Authors:  Han Chen; Zhibing Lai; Junwei Shi; Yong Xiao; Zhixiang Chen; Xinping Xu
Journal:  BMC Plant Biol       Date:  2010-12-19       Impact factor: 4.215

9.  Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid.

Authors:  Wenbo Jiang; Diqiu Yu
Journal:  BMC Plant Biol       Date:  2009-07-22       Impact factor: 4.215

10.  Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

Authors:  Wei-Ping Diao; John C Snyder; Shu-Bin Wang; Jin-Bing Liu; Bao-Gui Pan; Guang-Jun Guo; Ge Wei
Journal:  Front Plant Sci       Date:  2016-02-23       Impact factor: 5.753

View more
  26 in total

1.  Integrated omics analysis identified genes and their splice variants involved in fruit development and metabolites production in Capsicum species.

Authors:  Abdul Rawoof; Ilyas Ahmad; Khushbu Islam; John Momo; Ajay Kumar; Vandana Jaiswal; Nirala Ramchiary
Journal:  Funct Integr Genomics       Date:  2022-09-29       Impact factor: 3.674

Review 2.  Thermo-Priming Mediated Cellular Networks for Abiotic Stress Management in Plants.

Authors:  Ambreen Khan; Varisha Khan; Khyati Pandey; Sudhir Kumar Sopory; Neeti Sanan-Mishra
Journal:  Front Plant Sci       Date:  2022-05-13       Impact factor: 6.627

3.  Plasmodium vivax From Duffy-Negative and Duffy-Positive Individuals Share Similar Gene Pools in East Africa.

Authors:  Daniel Kepple; Alfred Hubbard; Musab M Ali; Beka R Abargero; Karen Lopez; Kareen Pestana; Daniel A Janies; Guiyun Yan; Muzamil Mahdi Hamid; Delenasaw Yewhalaw; Eugenia Lo
Journal:  J Infect Dis       Date:  2021-10-28       Impact factor: 5.226

4.  Structural and Functional Insights into WRKY3 and WRKY4 Transcription Factors to Unravel the WRKY-DNA (W-Box) Complex Interaction in Tomato (Solanum lycopersicum L.). A Computational Approach.

Authors:  Mohd Aamir; Vinay K Singh; Mukesh Meena; Ram S Upadhyay; Vijai K Gupta; Surendra Singh
Journal:  Front Plant Sci       Date:  2017-05-29       Impact factor: 5.753

5.  Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development.

Authors:  Yuan Cheng; Xin Pang; Hongjian Wan; Golam J Ahammed; Jiahong Yu; Zhuping Yao; Meiying Ruan; Qingjing Ye; Zhimiao Li; Rongqing Wang; Yuejian Yang; Guozhi Zhou
Journal:  Front Plant Sci       Date:  2017-06-29       Impact factor: 5.753

6.  Global analysis of expression profile of members of DnaJ gene families involved in capsaicinoids synthesis in pepper (Capsicum annuum L).

Authors:  Fang Fei Fan; Fawan Liu; Xian Yang; Hongjian Wan; Yunyan Kang
Journal:  BMC Plant Biol       Date:  2020-07-09       Impact factor: 4.215

7.  Regulation of ethylene-responsive SlWRKYs involved in color change during tomato fruit ripening.

Authors:  Ling Wang; Xue-Lian Zhang; Lu Wang; Yanan Tian; Ning Jia; Shuzhen Chen; Ning-Bo Shi; Xuemei Huang; Chu Zhou; Yaowen Yu; Zhao-Qi Zhang; Xue-Qun Pang
Journal:  Sci Rep       Date:  2017-11-30       Impact factor: 4.379

8.  Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development.

Authors:  Yuan Cheng; Wuying Bian; Xin Pang; Jiahong Yu; Golam J Ahammed; Guozhi Zhou; Rongqing Wang; Meiying Ruan; Zhimiao Li; Qingjing Ye; Zhuping Yao; Yuejian Yang; Hongjian Wan
Journal:  Front Plant Sci       Date:  2017-08-29       Impact factor: 5.753

9.  Genome-wide analysis of WRKY gene family in the sesame genome and identification of the WRKY genes involved in responses to abiotic stresses.

Authors:  Donghua Li; Pan Liu; Jingyin Yu; Linhai Wang; Komivi Dossa; Yanxin Zhang; Rong Zhou; Xin Wei; Xiurong Zhang
Journal:  BMC Plant Biol       Date:  2017-09-11       Impact factor: 4.215

10.  Identification and expression analyses of WRKY genes reveal their involvement in growth and abiotic stress response in watermelon (Citrullus lanatus).

Authors:  Xiaozhen Yang; Hao Li; Yongchao Yang; Yongqi Wang; Yanling Mo; Ruimin Zhang; Yong Zhang; Jianxiang Ma; Chunhua Wei; Xian Zhang
Journal:  PLoS One       Date:  2018-01-16       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.