Literature DB >> 27910939

Real-time PCR-based serotyping of Streptococcus agalactiae.

Kathleen M Breeding1, Bhavana Ragipani2, Kun-Uk David Lee2, Martin Malik2, Tara M Randis2, Adam J Ratner2,3.   

Abstract

Group B Streptococcus (GBS) is an encapsulated, gram-positive pathogen that is an important cause of neonatal invasive infections, including sepsis and meningitis. There are ten known GBS serotypes based on distinct capsule compositions (Ia, Ib, II-IX), and current candidate capsular polysaccharide conjugate vaccines target only a subset of these. Serotyping of GBS isolates is important for understanding local epidemiology and for monitoring for serotype replacement or capsular switching. However, serotyping generally requires either latex agglutination, multiplex PCR with analysis of band sizes, or analysis of whole genome sequences-all techniques that are either expensive or not widely available. Here we report the development of a robust real-time PCR assay for determining GBS serotypes. Using both a diverse reference set of strains encompassing all ten serotypes and a collection of clinical isolates, we demonstrate concordance between real-time PCR serotyping and latex agglutination. We propose that real-time PCR serotyping represents an attractive alternative to current serotyping methods and may allow for improved acquisition of GBS serotype data.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27910939      PMCID: PMC5133537          DOI: 10.1038/srep38523

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Streptococcus agalactiae (Group B Streptococcus [GBS]) is a major cause of neonatal morbidity and mortality worldwide12. While the incidence of GBS early-onset sepsis has decreased substantially in the United States following the implementation of universal screening and intrapartum antimicrobial prophylaxis34, these represent resource-intensive policies that are subject to missed opportunities for prevention56. Because of these limitations, improved methods for prevention of GBS disease are urgently needed. Immunization with capsular polysaccharide (CPS)-protein conjugates can induce serotype-specific immunity7, and candidate GBS conjugate vaccines are currently being tested in clinical trials8. The serotype of a GBS strain is determined by the genes in the cps locus, and 10 distinct serotypes (Ia, Ib, II-IX) have been described to date910. Understanding the serotype distribution of GBS in both disease and colonization states is crucial to inform rational vaccine policies and to detect events such as capsular switching1112 and serotype replacement. Capsular typing of GBS is generally performed using latex agglutination with type-specific antibodies, though both multiplex PCR131415 and flow cytometry16 strategies have been described. More recently, whole-genome sequences have been used to determine GBS serotypes17. Here we describe a novel TaqMan-based real-time PCR strategy for serotyping GBS based on detection of specific cps locus sequences and demonstrate its applicability using both a defined set of strains from a reference laboratory and a set of primary clinical isolates.

Materials and Methods

Bacterial strains and growth conditions

A total of 68 clinical GBS isolates were included in this study. Of these, 47 S. agalactiae serotype reference stains were provided by the Streptococcus laboratory at the Respiratory Diseases Branch of the Centers for Disease Control and Prevention (CDC). For some isolates, multilocus sequence type (MLST) determination was determined by the Streptococcus reference laboratory using established protocols (http://pubmlst.org/sagalactiae/). The remaining 21 isolates were deidentified sterile site isolates collected between 2010 and 2015 in New York City. All specimens were cultured on trypticase soy (TS) or 5% sheep blood agar plates at 37 °C and then grown overnight in TS media at 37 °C.

Serotyping by latex agglutination

All GBS isolates were serotyped by latex agglutination with the Immulex Latex Agglutination Streptococcus B kit (Staten Serum Institute; Copenhagen, Denmark) according to the manufacturer’s instructions. Briefly, 10 μl of the latex reagent was added to a single colony of GBS suspended in 10 μl of saline. The reaction was rotated and interpreted as positive if agglutination was visible after 30 seconds.

TaqMan real-time PCR serotyping

Primers and probes were designed to amplify unique regions of the polysaccharide capsular genes of each of the serotypes of S. agalactiae (Table 1). In order to generate these primer/probe sets, DNA sequences from specific capsular polysaccharide (cps) operons were obtained from National Center for Biotechnology Information databases (Table 1). Trimmed predicted cpsE-cpsL regions were aligned with using the CLUSTALW algorithm (Supplemental File 1). Specific primer and probe sequences and target regions were hand-selected from this multiple alignment of all 10 cps operons and are listed in Table 1. Oligonucleotides and probes were obtained from Integrated DNA Technologies (Coralville, IA). Oligonucleotides were unmodified and desalted, and probes were labeled with a fluorescent probe (5′ 6-carboxyfluorescein (6-FAM)) and two quenchers (internal ZENTM, and 3′ Iowa Black® FQ) and purified by high-pressure liquid chromatography.
Table 1

Target genes, primer and probe sequences for GBS serotyping by real-time PCR.

 Sequence (5′-3′)Target GeneAmplicon Size (bp)NCBI Accession
Ia-FGTTTAAAAATCCTGATTTTGATAGAATTTTAGCAGCTTTTAACcpsH207CP000114.1
Ia-RCTGATATTTTGAATATTATTATGCAAACAATAATAATATGTTCCCCCTA   
Ia-P6-FAM-TCGTTGATT/ZEN/ATCGGTATAGTATCATTG GCT-IAbFQ   
Ib-FGTATTAAATTCGTTATTTAGAAGTCCAGAATTTCATAGAGTCATTGCcpsH195FO393392.1
Ib-RGGCATAATAATATAGAAATCCTAAACAAGACAAAATAATTGCATTAAAC   
Ib-P6-FAM-TGC ATT CAA/ZEN/TTCACTGGCAGTAGGG- IAbFQ   
II-FCACATATATATTAAAGTTCACCCTAGAGATAACATTGACTACTCTAATCcpsK151AAJO01000077.1
II-RCTAATGCCGTGGAAAAATATGTAATCCCAACATCAAATT   
II-P6-FAM-AATGCAACA/ZEN/GTAATACAAAGGAACATC CCT- IAbFQ   
III-FGGAATTGTTCTTTATTTTTCTGCCTcpsI170AL766849.1
III-RACTATACCAAAAGTTGAGAATAATAATACAATACTCCAATGA   
III-P6-FAM-ATGTTACAC /ZEN/GCTCTTTGAGGAAATAGATCC- IAbFQ   
IV-FGAAGAAAATATATATTTGCCATACAGTATATCATCTCCTTATTACAATTATCcpsK159AF355776.1
IV-RCATAGAATACCTTCTTTATTGGTACGTTTACATAAATCATCAATATTAAC   
IV-P6-FAM-AGGGAACAG /ZEN/AGGAGATCAATAATTATATTGGC- IAbFQ   
V-FCAAAATTCAATGAGAGAATGTTGTATTTTTTTGAGGCAATTCcpsO153AE009948.1
V-RCAATCATCTTCCCACATATATCTATTCCACCAAATACTTC   
V-P6-FAM-ATTTTCCAC /ZEN/ATAATACATCTTTAATCTCTGCTG T- IAbFQ   
VI-FGACAGTCTATTACGAAAGTATAAGAGCGATTcpsH219HF952106.1
VI-RAGCTTGTAGATTATCCTGTTTTGTTTGATAGCTTCTCTATATAG   
VI-P6-FAM-CCCTCCAGT/ZEN/GTGGGAATATTTTTAGGTTCAC- IAbFQ   
VII-FGAGGGCTTACCTCACGACAGGAGAAGTAAAAAATATAAAGcpsK160AY376403.1
VII-RGCTGCGTTAATAACAATACTGACTTTGGAGC   
VII-P6-FAM-AGTCTTACC/ZEN/CAAGAACAAAAGTCTCTGATT- IAbFQ   
VIII-FGACTAATGGTTAAGTATGCTAACTTGCTAATTTGTGATAGTAAcpsR152AY375363
VIII-RCTTGTCCTTAAAATTGTGTTTTGACTTTGTCAGATCAGTC   
VIII-P6-FAM-ATGCTCCTA/ZEN/AAACAACCTACATCGCCTATG- IAbFQ   
IX-FCATTGAGCAAAGAGAAAACAGTATATGTCAAAGGGCcpsO128CGBY01000002
IX-RATGTTCAAGGATAAAATCTCTATTATGTTGCATTGCTTCA   
IX-P6-FAM-AGTACTACC/ZEN/AGACAGTCATACAAAGAGAAT- IAbFQ   
  Sequences are presented 5' to 3' with probe modifications as indicated (6-carboxyfluorescein [6-FAM] fluorescent probe, internal ZENTM and Iowa Black® FQ [IAbFQ] quenchers).
Genomic DNA was extracted from overnight cultures of GBS using the Qiagen DNeasy Blood and Tissue Kit according to the manufacturer’s instructions. PCR reactions were performed in a final volume of 20 μl and consisted of 10 μl Taqman Universal Mastermix (Applied Biosystems), 7.4 μl sterile water, 0.2 μl forward primer (100 μM stock), 0.2 μl reverse primer (100 μM stock), 0.2 μl probe (100 μM stock), and 2 μl GBS DNA (25 ng/μl, unless otherwise indicated in the text.) Triplicate reactions were performed on a StepOne Plus thermal cycler (Applied Biosystems) and analyzed using StepOne software. Reaction parameters were as follows: initial incubation at 50 °C for 2 minutes; initial denaturation at 95 °C for 10 minutes; 35 cycles of PCR at 95 °C for 15 seconds and 60 °C for 1 min. Positive reactions were defined as a cycle threshold (CT) < 30 for 50 ng DNA template/reaction. Negative control reactions (no DNA template) were included with every run. Results were compared to latex agglutination.

Reaction sensitivity and interference by non-targeted strains

Sensitivity was evaluated by determining the cycle threshold on 10-fold serial dilutions of bacterial DNA from 5 ng to 50 pg per reaction. Potential interference was assessed by real-time PCR using each primer/probe set under the conditions above with a mixture of chromosomal DNA from all ten GBS serotypes (strains AR959 - AR968) at a final amount of 25 ng for each strain (250 ng total DNA) per reaction as template.

Results

Accuracy of real-time PCR serotyping using a validation set

We used a set of 47 validation strains (≥3 per serotype) from the CDC Streptococcus laboratory to determine whether the primer/probe combinations listed in Table 1 could be used for accurate serotyping. In all cases, there was detection of the predicted sequence using the real-time PCR protocol (Table 2) and no positive reactions with any of the other serotype primer/probe combinations (not shown). We confirmed the serotype of each of the 47 strains by latex agglutination, and there was 100% concordance between the PCR-based and latex agglutination methods for the validation set.
Table 2

Cycle thresholds for real-time PCR serotyping of CDC validation strains.

StrainSerotypeMLSTCT
20154637IaST119.40 (17.76–22.18)
20155889IaST2317.61 (16.61–18.17)
20155226IaST1917.56 (17.49–17.60)
2008232728Ia 18.22 (17.98–18.65)
2014210282Ia 18.55 (18.46–18.61)
20153631IbST116.24 (15.77–16.60)
20153550IbST817.62 (17.49–17.76)
20155787IbST1216.75 (16.52–17.12)
2008232729Ib 17.21 (17.08–17.41)
2014210284Ib 19.54 (19.17–19.93)
20154198IIST116.83 (16.82–16.86)
20155757IIST2216.90 (16.68–17.09)
20155810IIST2816.33 (16.23–16.44)
2008232738II 19.76 (19.25–20.54)
2014210280II 17.54 (17.42–17.68)
20154686IIIST1719.53 (18.99–20.60)
20154526IIIST1918.23 (17.71–18.82)
20155871IIIST33517.54 (16.34–18.23)
2008232582III 18.99 (18.34–19.67)
2014210283III 19.93 (19.87–20.29)
20151912IVST45217.30 (16.53–17.93)
20155826IVST45917.41 (16.95–18.10)
20152623IVST46817.69 (17.55–17.85)
2011201884IV 19.93 (19.90–19.98)
2014210293IV 18.71 (18.66–18.78)
20155749VST115.45 (15.19–15.89)
20155753VST1915.91 (15.63–16.22)
20155859VST2615.25 (15.13–15.31)
2008232731V 18.45 (17.89–18.92)
2014210268V 18.13 (18.09–18.17)
20156225VIST118.66 (18.09–19.10)
20155762VIST118.16 (17.60–18.68)
20154691VIST117.51 (16.84–17.85)
2010228816VI 20.98 (20.55–21.29)
2013225975VI 21.42 (21.09–21.97)
20154086VIIST116.55 (15.88–16.96)
20154176VIIST117.11 (16.51–17.56)
4832-06VII 19.91 (19.50–20.49)
2014201718VII 19.45 (19.29–19.66)
20140487VIII 16.05 (15.13–17.01)
20150287VIII 16.06 (15.25–17.65)
2014207299VIII 14.80 (13.89–15.56)
5030-08VIII 18.24 (18.09–18.35)
2013226269VIII 23.08 (22.97–23.29)
20155073IXST13016.73 (15.57–18.06)
7509-07IX 18.36 (18.34–18.39)
2014203375IX 17.77 (17.41–17.97)

Reported CT is the mean of three technical replicates, with range given in parentheses. Serotype as determined by latex agglutination and MLST (when available) are indicated.

Serotyping of clinical isolates

We used the real-time PCR serotyping assay on a collection of 21 clinical sterile-site GBS isolates (Table 3). In 21/21 (100%) of cases, a single serotype was detected at CT < 30, and in all of those, the result was confirmed by latex agglutination.
Table 3

Real-time PCR serotyping of clinical GBS isolates is concordant with latex agglutination.

StrainReal-time PCRLatex Agglutination
AR611IVIV
AR618IIIIII
AR624IIII
AR626IIIIII
AR629IVIV
AR630IbIb
AR631IIIIII
AR634IIIIII
AR667IIIIII
AR880IIIIII
AR905IaIa
AR1019IaIa
AR1021IIIIII
AR1036IaIa
AR1037IVIV
AR1046IIIIII
AR1049IaIa
AR1053IaIa
AR1054IIIIII
AR1055IIIIII
AR1056IIIIII

A collection of 21 clinical isolates of unknown serotypes was tested by real-time PCR and by latex agglutination. All strains gave a single serotype by real-time PCR (CT < 30; range 15–23 for 50 ng template/reaction).

Sensitivity of real-time PCR serotyping and potential interference

In order to determine the sensitivity of the real-time PCR protocol, we performed serial dilutions of the extracted DNA from 20 of the validation strains, from 5 ng to 50 pg per reaction. As predicted, CT increased as the total amount of bacterial DNA template in the reaction decreased (Fig. 1), though the majority of strains remained under the 30 cycle threshold, even at 50 pg per reaction. For all primer sets, detection of target sequences (CT < 30) was robust to the inclusion of an excess of non-targeted GBS DNA.
Figure 1

Serial dilution of GBS genomic DNA template demonstrates sensitivity of real-time PCR serotyping.

Serotyping reactions were performed on 20 validation strains using 5 ng, 500 pg, and 50 pg of template per reaction. Cycle threshold increased with decreasing template amounts but remained detectable for all strains even at the lowest concentration tested.

Discussion

Clinical microbiology laboratories routinely identify GBS but do not typically report serotype data. However, as the development of vaccines that target a subset of the ten known GBS serotypes proceeds, it will become increasingly important to understand the distribution of vaccine and non-vaccine serotypes and to monitor for capsular switching and serotype replacement. Non-nucleic acid-based laboratory methods for GBS serotyping techniques can be labor intensive and expensive, may require high-titer serotype-specific antisera and can create an added barrier for performing GBS serotype prevalence studies. Latex agglutination kits may be used for GBS serotyping in reference laboratories but are costly and not routinely available. Molecular capsular typing techniques, including multiplex PCR1314 and targeted analysis of whole genome sequences17, may be advantageous because of adaptability to newly available sequence information and relative ease of performance. In one prior study, real-time PCR was reported to distinguish among serotypes Ia, Ib, and III only18. We designed custom primer-probe sets for detection of all ten GBS serotypes. Unlike many prior methods, serotyping by real-time PCR is not based on operator interpretation of biochemical reactions and allows for specific identification of a GBS serotype despite interference from other bacterial DNA. Although the current assay is likely too technically demanding for routine laboratory adoption, it may be useful in the context of epidemiologic studies as an alternative to existing multiplex PCR assays. With further development, this novel method may allow for detection of GBS serotypes directly from clinical specimens without the need for culture. Limitations of this real-time PCR-based serotyping include an inability to identify new serotypes directly (as specific primer-probe sets are required for detection) and dependence on conservation of the targeted genetic regions within a particular serotype. Further validation of these primer-probe sets on a globally representative set of isolates is underway, as all of the tested strains originated in North America. Studies of larger, more diverse strain collections will be required to ensure that the primer-probe sets are sensitive and specific across an appropriate range of isolates.

Additional Information

How to cite this article: Breeding, K. M. et al. Real-time PCR-based serotyping of Streptococcus agalactiae. Sci. Rep. 6, 38523; doi: 10.1038/srep38523 (2016). Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
  18 in total

1.  Early onset neonatal sepsis: the burden of group B Streptococcal and E. coli disease continues.

Authors:  Barbara J Stoll; Nellie I Hansen; Pablo J Sánchez; Roger G Faix; Brenda B Poindexter; Krisa P Van Meurs; Matthew J Bizzarro; Ronald N Goldberg; Ivan D Frantz; Ellen C Hale; Seetha Shankaran; Kathleen Kennedy; Waldemar A Carlo; Kristi L Watterberg; Edward F Bell; Michele C Walsh; Kurt Schibler; Abbot R Laptook; Andi L Shane; Stephanie J Schrag; Abhik Das; Rosemary D Higgins
Journal:  Pediatrics       Date:  2011-04-25       Impact factor: 7.124

2.  A multiplex PCR assay for the direct identification of the capsular type (Ia to IX) of Streptococcus agalactiae.

Authors:  Monica Imperi; Marco Pataracchia; Giovanna Alfarone; Lucilla Baldassarri; Graziella Orefici; Roberta Creti
Journal:  J Microbiol Methods       Date:  2009-12-01       Impact factor: 2.363

3.  Structure of the type IX group B Streptococcus capsular polysaccharide and its evolutionary relationship with types V and VII.

Authors:  Francesco Berti; Edmondo Campisi; Chiara Toniolo; Laura Morelli; Stefano Crotti; Roberto Rosini; Maria Rosaria Romano; Vittoria Pinto; Barbara Brogioni; Giulia Torricelli; Robert Janulczyk; Guido Grandi; Immaculada Margarit
Journal:  J Biol Chem       Date:  2014-07-02       Impact factor: 5.157

4.  Group B streptococcal disease in the era of intrapartum antibiotic prophylaxis.

Authors:  S J Schrag; S Zywicki; M M Farley; A L Reingold; L H Harrison; L B Lefkowitz; J L Hadler; R Danila; P R Cieslak; A Schuchat
Journal:  N Engl J Med       Date:  2000-01-06       Impact factor: 91.245

5.  Multiplex PCR assay for rapid and accurate capsular typing of group B streptococci.

Authors:  Claire Poyart; Asmaa Tazi; Hélène Réglier-Poupet; Annick Billoët; Nicole Tavares; Josette Raymond; Patrick Trieu-Cuot
Journal:  J Clin Microbiol       Date:  2007-03-21       Impact factor: 5.948

6.  Evidence for rare capsular switching in Streptococcus agalactiae.

Authors:  Elisabete Raquel Martins; José Melo-Cristino; Mário Ramirez
Journal:  J Bacteriol       Date:  2009-12-18       Impact factor: 3.490

7.  Early-onset group B streptococcal disease in the United States: potential for further reduction.

Authors:  Jennifer R Verani; Nancy L Spina; Ruth Lynfield; William Schaffner; Lee H Harrison; Amy Holst; Stepy Thomas; Jessica M Garcia; Karen Scherzinger; Deborah Aragon; Susan Petit; Jamie Thompson; Lauren Pasutti; Roberta Carey; Lesley McGee; Emily Weston; Stephanie J Schrag
Journal:  Obstet Gynecol       Date:  2014-04       Impact factor: 7.661

8.  Structural and genetic diversity of group B streptococcus capsular polysaccharides.

Authors:  Michael J Cieslewicz; Donald Chaffin; Gustavo Glusman; Dennis Kasper; Anup Madan; Stephani Rodrigues; Jessica Fahey; Michael R Wessels; Craig E Rubens
Journal:  Infect Immun       Date:  2005-05       Impact factor: 3.441

9.  Safety and immunogenicity of an investigational maternal trivalent group B streptococcus vaccine in healthy women and their infants: a randomised phase 1b/2 trial.

Authors:  Shabir A Madhi; Clare L Cutland; Lisa Jose; Anthonet Koen; Niresha Govender; Frederick Wittke; Morounfolu Olugbosi; Ajoke Sobanjo-Ter Meulen; Sherryl Baker; Peter M Dull; Vas Narasimhan; Karen Slobod
Journal:  Lancet Infect Dis       Date:  2016-04-29       Impact factor: 25.071

Review 10.  An overview of global GBS epidemiology.

Authors:  Kirsty Le Doare; Paul T Heath
Journal:  Vaccine       Date:  2013-08-28       Impact factor: 3.641

View more
  11 in total

1.  Identification of Group B Streptococcus Capsule Type by Use of a Dual Phenotypic/Genotypic Assay.

Authors:  Areej Alhhazmi; Armaan Pandey; Gregory J Tyrrell
Journal:  J Clin Microbiol       Date:  2017-06-14       Impact factor: 5.948

2.  Molecular characterization of Streptococcus agalactiae isolated from pregnant women and newborns at the University of Gondar Comprehensive Specialized Hospital, Northwest Ethiopia.

Authors:  Mucheye Gizachew; Moges Tiruneh; Feleke Moges; Mulat Adefris; Zemene Tigabu; Belay Tessema
Journal:  BMC Infect Dis       Date:  2020-01-13       Impact factor: 3.090

3.  Vaginal co-colonization with multiple Group B Streptococcus serotypes.

Authors:  Ameneh Khatami; Tara M Randis; Larissa Tavares; Margaret Gegick; Evan Suzman; Adam J Ratner
Journal:  Vaccine       Date:  2018-12-08       Impact factor: 3.641

4.  High Rate of Serotype V Streptococcus agalactiae Carriage in Pregnant Women in Botswana.

Authors:  Brady A'Hearn-Thomas; Ameneh Khatami; Tara M Randis; Moses Vurayai; Margaret Mokomane; Tonya Arscott-Mills; Francis M Banda; Tiny Mazhani; Thabo Lepere; Ponatshego Gaolebale; Seeletso Nchingane; Anna Chamby; Margaret Gegick; Evan Suzman; Andrew P Steenhoff; Adam J Ratner
Journal:  Am J Trop Med Hyg       Date:  2019-05       Impact factor: 2.345

5.  Development of a droplet digital PCR method for detection of Streptococcus agalactiae.

Authors:  Yi-Fan Zeng; Chu-Mao Chen; Xiao-Yan Li; Jun-Jiang Chen; Yan-Ge Wang; Shi Ouyang; Tian-Xing Ji; Yong Xia; Xu-Guang Guo
Journal:  BMC Microbiol       Date:  2020-06-23       Impact factor: 3.605

6.  Prevalence of group B streptococcus colonization in pregnant women in Jiangsu, East China.

Authors:  Yanmei Ge; Fei Pan; Rui Bai; Yuan Mao; Wenli Ji; Fenfang Wang; Huacheng Tong
Journal:  BMC Infect Dis       Date:  2021-05-27       Impact factor: 3.090

7.  Comparison of molecular serotyping approaches of Streptococcus agalactiae from genomic sequences.

Authors:  Georgia Kapatai; Darshana Patel; Androulla Efstratiou; Victoria J Chalker
Journal:  BMC Genomics       Date:  2017-06-01       Impact factor: 3.969

8.  Improving the Sensitivity of Real-time PCR Detection of Group B Streptococcus Using Consensus Sequence-Derived Oligonucleotides.

Authors:  Ameneh Khatami; Tara M Randis; Anna Chamby; Thomas A Hooven; Margaret Gegick; Evan Suzman; Brady A'Hearn-Thomas; Andrew P Steenhoff; Adam J Ratner
Journal:  Open Forum Infect Dis       Date:  2018-07-07       Impact factor: 3.835

9.  Development and analytical validation of real-time PCR for the detection of Streptococcus agalactiae in pregnant women.

Authors:  Daniel F Escobar; Diego A Diaz-Dinamarca; Carlos F Hernández; Daniel A Soto; Ricardo A Manzo; Pedro I Alarcón; Camila H Pinto; Diego N Bastias; Carolayn N Oberg-Bravo; Robert Rojas; Sebastián E Illanes; Alexis M Kalergis; Abel E Vasquez
Journal:  BMC Pregnancy Childbirth       Date:  2020-06-09       Impact factor: 3.007

10.  The effect of group B streptococcus on maternal and infants' prognosis in Guizhou, China.

Authors:  Wei Dai; Youcheng Zhang; Yin Xu; Mingjuan Zhu; Xiaotin Rong; Qing Zhong
Journal:  Biosci Rep       Date:  2019-12-20       Impact factor: 3.840

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.