Literature DB >> 27885333

Astragalus Polysaccharide Suppresses 6-Hydroxydopamine-Induced Neurotoxicity in Caenorhabditis elegans.

Haifeng Li1, Ruona Shi1, Fei Ding1, Hongyu Wang1, Wenjing Han1, Fangli Ma2, Minghua Hu2, Chung Wah Ma2, Zebo Huang3.   

Abstract

Astragalus membranaceus is a medicinal plant traditionally used in China for a variety of conditions, including inflammatory and neural diseases. Astragalus polysaccharides are shown to reduce the adverse effect of levodopa which is used to treat Parkinson's disease (PD). However, the neuroprotective effect of Astragalus polysaccharides per se in PD is lacking. Using Caenorhabditis elegans models, we investigated the protective effect of astragalan, an acidic polysaccharide isolated from A. membranaceus, against the neurotoxicity of 6-hydroxydopamine (6-OHDA), a neurotoxin that can induce parkinsonism. We show that 6-OHDA is able to degenerate dopaminergic neurons and lead to the deficiency of food-sensing behavior and a shorter lifespan in C. elegans. Interestingly, these degenerative symptoms can be attenuated by astragalan treatment. Astragalan is also shown to alleviate oxidative stress through reducing reactive oxygen species level and malondialdehyde content and increasing superoxide dismutase and glutathione peroxidase activities and reduce the expression of proapoptotic gene egl-1 in 6-OHDA-intoxicated nematodes. Further studies reveal that astragalan is capable of elevating the decreased acetylcholinesterase activity induced by 6-OHDA. Together, our results demonstrate that the protective effect of astragalan against 6-OHDA neurotoxicity is likely due to the alleviation of oxidative stress and regulation of apoptosis pathway and cholinergic system and thus provide an important insight into the therapeutic potential of Astragalus polysaccharide in neurodegeneration.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27885333      PMCID: PMC5112302          DOI: 10.1155/2016/4856761

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Parkinson's disease (PD) is one of the most prevalent neurodegenerative disorders characterized by progressive loss of dopaminergic neurons in substantia nigra of the midbrain. The dopaminergic neurodegeneration results in severe dopamine depletion and thus leads to a variety of motor complications, including muscle rigidity, tremors, bradykinesia, and postural instability [1]. In the advanced stages of PD, the emerged cognitive and mental problems, such as dementia, depression, and anxiety, further reduce life quality and increase cost burden [2]. Evidences from clinical and epidemiological investigations have demonstrated that the onset and progression of PD is closely associated with aging process. For instance, PD affects approximately 7–10 million people worldwide, and its annualized incidence rate dramatically increases from 0.041% in individuals of 40–49 years old to 0.428%–1.903% in people above 60 years old [3, 4]. Given the detrimental consequences of PD, development of promising therapeutics represents an urgent social and medical need. A number of studies have revealed that the cause of PD correlates with certain genetic and environmental risk factors, such as mutations in specific genes and toxin exposure [5]. For example, 6-hydroxydopamine (6-OHDA), a toxic oxidation metabolite of dopamine, is detected in the brains and urine of patients with PD [6]. This neurotoxin can selectively enter dopaminergic neurons through dopamine or noradrenaline transporter (DAT and NAT, resp.) and then stimulate overproduction of reactive oxygen species (ROS) via enzymatic oxidation and autooxidation [7]. Increased ROS level elicited by 6-OHDA damages cellular proteins and nucleus, leading to dopaminergic neuron death and dysfunction in PD patients [7]. In experimental models, the administration of 6-OHDA is also able to induce a variety of physiological events including neuronal death and behavioral deficit similar to PD. Caenorhabditis elegans is a relatively simple but powerful animal model in neurobiology field [8]. It has a well-characterized nervous system consisting of 302 neurons, and the neuronal signalling processes such as neurotransmitter formation and release are well conserved. Moreover, exogenous neurotoxin-induced alterations in C. elegans are also similar with those in more complex systems. For example, 6-OHDA is capable of degenerating dopaminergic neurons via DAT in both human and C. elegans [9]. In addition, genetic manipulation with fluorescent reporter allows for visual inspection of neuronal viability and behavioral performance in the nematodes. Astragalus membranaceus is a well-known Chinese medicine with antiaging functions recorded in Shen Nong's Classic of Materia Medica (~110 BC). It is widely used against mental and emotional stress, anorexia, fatigue, and general weakness [10]. A number of studies have revealed that the neuroprotective effect of A. membranaceus is associated with its polysaccharide fraction. For instance, we have recently found that astragalan, an acidic polysaccharide isolated from A. membranaceus, is able to reduce the neurotoxicity of polyglutamine, the critical pathogenic protein in Huntington's disease [11]. Astragalus polysaccharide is also shown to protect rat astrocyte cultures against oxidative damage induced by levodopa, which is widely used in PD treatment but shows adverse effects [12], suggesting a neuroprotective potential of the polysaccharide. However, studies on the underpinning mechanisms of neuroprotection of Astragalus polysaccharides in PD models are lacking. Therefore, we investigated the protective effect of the Astragalus polysaccharide astragalan against 6-OHDA neurotoxicity using C. elegans models and attempted to unravel the underlying mechanisms, including its effects on lifespan, ROS and lipid peroxidation levels, antioxidant enzyme activities, apoptosis-related gene expression, and acetylcholinesterase activity.

2. Materials and Methods

2.1. Preparation of Polysaccharides

The dry roots of Astragalus membranaceus (Fisch.) Bunge were purchased from Tongrentang Group (Bozhou, China). The polysaccharide astragalan was prepared essentially as described previously [11]. Briefly, the sliced roots were refluxed in ethanol, and the materials were used for isolation of Astragalus polysaccharides. The polysaccharides were then fractionated by anion-exchange chromatography on a DEAE-Sepharose Fast Flow (GE Healthcare, Uppsala, Sweden) column eluted with water followed by 0.5 M NaCl solution, and the yield of the acidic polysaccharide obtained from NaCl eluate was 1.56%. Further fractionation of the acidic polysaccharide by gel filtration on a Sepharose 6 Fast Flow column exhibited a distinct single peak (data not shown), indicating the homogeneity of the polysaccharide. Thus, the acidic polysaccharide was used as astragalan in the following experiments. The molecular weight of astragalan was measured using high-performance gel permeation chromatography [13], and its number-average molecular weight (Mn) and weight-average molecular weight (Mw) were 427,906 Da and 482,372 Da, respectively. The polydispersity, a ratio of Mw to Mn, of astragalan was ~1.1, indicating a relatively narrow molecular weight distribution of astragalan. Glycosyl composition of astragalan was measured by gas chromatography after methanolysis [14], and the molar composition of monosaccharides in astragalan was 19.2% arabinose, 6.9% rhamnose, 16.0% galactose, 28.8% glucose, and 29.1% galacturonic acid.

2.2. Nematode and Bacterial Strains

All Caenorhabditis elegans and Escherichia coli strains were obtained from the Caenorhabditis Genetics Centre (University of Minnesota, Minneapolis, MN, USA). The BZ555 (Pdat-1:GFP) nematodes were maintained at 20°C on NGM agar plates with E. coli OP50 as food. Synchronization was performed using the standard alkaline hypochlorite method as described [15].

2.3. 6-OHDA Exposure and Astragalan Treatment

6-OHDA (Sigma, St. Louis, MO, USA) was used to induce selective degeneration of dopaminergic neurons in BZ555 nematodes as described previously [16]. Briefly, synchronized L3 larvae were incubated with 50 mM 6-OHDA and 10 mM ascorbic acid in S. medium supplemented with E. coli NA22 for 1 h at 20°C. After treatment, the nematodes were washed three times with M9 buffer and then incubated with astragalan at the indicated concentrations in S. medium containing E. coli NA22 for 24 h. Then 75 μg/mL 5-fluoro-2′-deoxyuridine was added to inhibit reproduction. After further incubation for 48 h, the nematodes were used for various assays. In dopaminergic neurodegeneration, food-sensing behavior, and survival assays, epigallocatechin-3-gallate (EGCG) (final concentration of 0.05 mM) was used as a positive control.

2.4. Dopaminergic Neurodegeneration Assay

The nematode dopaminergic neurodegeneration was examined as described previously [16]. In brief, after treatment with 6-OHDA and astragalan, the nematodes were washed with M9 buffer, paralyzed by 50 mM sodium azide, and then mounted onto a 2% agar pad on a glass slide. About 30 nematodes were randomly selected in each treatment, and the GFP fluorescence was imaged using an IX51 inverted fluorescence microscope (Olympus, Tokyo, Japan). The fluorescence intensity in head region was estimated using Image Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA).

2.5. Food-Sensing Behavior Assay

The food-sensing behavior was carried out as described [16]. Briefly, a 9 cm NGM agar plate was spread with E. coli OP50 overnight at 37°C in a ring with an inner diameter of 1 cm and an outer diameter of 8 cm. After treatment with 6-OHDA and astragalan, the nematodes were washed with M9 buffer and transferred to the center of the NGM agar plate with or without bacterial lawn in a drop of M9 buffer, allowed to sit for 5 min, and then the number of body bends of each nematode was counted microscopically for 1 min. The slowing rate was calculated as follows: slowing rate = (N control − N food)/N control, where N food and N control represent the numbers of body bends in the plates with and without bacteria lawn, respectively. At least 15 nematodes were scored in each treatment.

2.6. Survival Assay

The survival of C. elegans was performed using liquid culture at 20°C as described previously [11]. In brief, the nematodes were treated with 6-OHDA and astragalan as above and further incubated in S. medium containing E. coli NA22 (initial OD570 of ~0.6) and 100 μg/mL ampicillin for 24 h. The nematodes were then transferred into 96-well plates (about 10 nematodes per well). The day of nematode transfer was set as Day 0 in this assay. The numbers of live and dead nematodes were counted microscopically every 2 days based on their movements.

2.7. Determination of ROS Level

The ROS level in C. elegans was determined using 2′,7′-dichlorofluorescin diacetate (DCFH-DA) (Sigma, St. Louis, MO, USA) as previously described [17]. Briefly, approximately 1000 nematodes treated with 6-OHDA and astragalan were collected, washed, and homogenized in 350 μL of PBS (50 mM, pH 7.8) with 0.1% Tween 20 on ice. The supernatant was collected by centrifugation, and its protein content was determined by BCA assay kit (Thermo Fisher, Waltham, MA, USA). Then 50 μL of the supernatant was transferred into a black 96-well plate and incubated with 50 μL of 100 μM DCFH-DA. The DCF fluorescence was determined in a Fluoroskan Ascent FL microplate reader (Thermo, Waltham, MA, USA) every 10 min for 2 h at an excitation of 485 nm and an emission of 535 nm. The ROS level was calculated as the DCF fluorescence per μg proteins.

2.8. Determination of Antioxidant Enzyme Activity and Malondialdehyde Content

The antioxidant enzyme activities and malondialdehyde (MDA) content were determined as previously described [17]. Briefly, about 2,000 nematodes treated with 6-OHDA and astragalan were collected, washed with M9 buffer, and homogenized in 150 μL of PBS (50 mM, pH 7.8) with 1% Triton X-100 and 1 mM PMSF on ice. The supernatant was collected by centrifugation and then used to determine superoxide dismutase (SOD) activity, catalase (CAT) activity, glutathione peroxidase (GPx) activity, and MDA content by the assay kits (Beyotime, Shanghai, China). The protein content of the supernatant was determined by BCA assay kit. The SOD and GPx activities were expressed as U/mg proteins, CAT activity was expressed as U/μg proteins, and MDA content was expressed as nM/mg proteins.

2.9. Quantitative Real-Time PCR

Total RNA of the nematodes with or without 2.0 mg/mL of astragalan treatment was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). After reverse transcription, relative quantification of cDNA by real-time PCR was performed using SYBR Green I (BioRad, Hercules, CA, USA) and MyiQ™2 real-time detection system (BioRad, Hercules, CA, USA) as described previously [11]. Data were normalized to BZ555 nematodes without 6-OHDA exposure and astragalan treatment using the geometric mean of cdc-42, pmp-3, and Y45F10D.4 as the reference genes. The primers for PCR analysis are listed in Table 1.
Table 1

List of primers used for quantitative real-time PCR.

Forward (5′ → 3′)Reverse (5′ → 3′)
Apoptosis-related genes
egl-1 CTAGCAGCAATGTGCGATGACGGAAGCATGGGCCGAGTAG
ced-9 TGCTCAGGACTTGCCATCACTTGACTCTCCGATGGACATTCTT
ced-4 AAGTCGAGGATTAGTCGGTGTTGAGAGCCATTGCGAGTGACTTG
ced-3 TCAACGCGGCAAATGCTGCCTGCACAAAAACGATTTTC

Reference genes
cdc-42 CTGCTGGACAGGAAGATTACGCTCGGACATTCTCGAATGAAG
pmp-3 GTTCCCGTGTTCATCACTCATACACCGTCGAGAAGCTGTAGA
Y45F10D.4 GTCGCTTCAAATCAGTTCAGCGTTCTTGTCAAGTGATCCGACA

2.10. Determination of Acetylcholinesterase Activity

The acetylcholinesterase (AChE) activity of C. elegans was determined as previously described [18]. Briefly, approximately 3,000 nematodes with or without 2.0 mg/mL of astragalan treatment were washed twice with M9 buffer and then homogenized in PBS (50 mM, pH 7.8) on ice. The lysate supernatant was collected by centrifugation and then used for determination of AChE activity by the assay kit (Jiancheng Institute of Biotechnology, Nanjing, China). The protein content was determined by BCA assay kit. The AChE activity was expressed as U/mg proteins.

2.11. Statistical Analysis

The statistical analysis was performed primarily by GraphPad Prism 5.01 for Windows (GraphPad Software, San Diego, CA, USA). Statistical significance was determined by Student's t-test or one-way ANOVA followed by Tukey's post hoc test. The survival data were analyzed by Kaplan-Meier method and Peto's log-rank test using SPSS 17.0 for Windows (SPSS, Chicago, IL, USA). A probability value of p < 0.05 was considered to be statistically significant. All experiments were performed at least three times.

3. Results and Discussion

3.1. Astragalan Alleviates 6-OHDA-Induced Neurodegeneration in C. elegans

It is well characterized that C. elegans contains eight dopaminergic neurons, including two anterior deirid (ADE) neurons and four cephalic (CEP) neurons in the head and two posterior deirid (PDE) neurons in the posterior lateral position [19]. The transgenic C. elegans strain BZ555 constitutively expresses GFP in dopaminergic neurons, and the GFP fluorescence intensity indicates the neuronal viability. Previous studies have shown that 6-OHDA exposure reduces the GFP fluorescence markedly in ADE and CEP neurons and weakly in other dopaminergic neurons of C. elegans [20]. Therefore, we used this transgenic model to investigate whether the Astragalus polysaccharide astragalan was able to inhibit 6-OHDA-mediated neurodegeneration. As shown in Figure 1, in 6-OHDA-exposed BZ555 nematodes, the GFP fluorescence intensity of ADE and CEP neurons was decreased to 46.8% of the unexposed nematodes (p < 0.05), demonstrating the capability of 6-OHDA to impair dopaminergic neurons. When the 6-OHDA-intoxicated nematodes were treated with astragalan at the indicated concentrations (1.0, 2.0, or 4.0 mg/mL), the GFP fluorescence intensities were increased to 77.1%, 84.6%, and 82.9%, respectively (p < 0.05), which are comparable with the action of the positive control EGCG (74.7% at 0.05 mM), a green tea polyphenol reported to prevent 6-OHDA neurotoxicity [21]. These results demonstrate that astragalan is capable of alleviating 6-OHDA-mediated dopaminergic neurodegeneration in C. elegans model.
Figure 1

Effect of astragalan on 6-OHDA-induced degeneration of dopaminergic neurons in C. elegans. (a) Representative fluorescence images of Pdat-1::GFP in dopaminergic neurons were taken from the transgenic C. elegans strain BZ555. The nematodes were exposed to 50 mM 6-OHDA for 1 h prior to treatment with astragalan (2.0 mg/mL) or EGCG (0.05 mM). Scale bars, 20 μm. (b) Graphical presentation for fluorescence intensity of Pdat-1::GFP in dopaminergic neurons of the nematodes treated with or without astragalan at the indicated concentrations (0.5–4.0 mg/mL). Results are presented as mean ± SEM of three independent experiments. p < 0.05 versus 6-OHDA-exposed nematodes.

3.2. Astragalan Attenuates 6-OHDA-Induced Food-Sensing Deficit in C. elegans

Under normal conditions, C. elegans moves slowly to sense and consume food. Since the dopamine-mediated neural circuit regulates the basal slowing response of C. elegans to food [16], a reduced dopamine level caused by the dopaminergic neurodegeneration makes the nematodes defective in this food-sensing behavior. Since astragalan is able to suppress 6-OHDA-induced dopaminergic neurodegeneration as shown above, we tested whether it could rescue the deficit of food-sensing performance under 6-OHDA exposure. As shown in Figure 2(a), the slowing rate of BZ555 nematodes was 0.73, while 6-OHDA exposure significantly decreased the slowing rate to 0.35 (p < 0.05), indicating a deficit of food-sensing behavior due to dopaminergic neuronal dysfunction. When treated with astragalan at the indicated concentrations (1.0, 2.0, or 4.0 mg/mL), the slowing rate of 6-OHDA-intoxicated nematodes was significantly increased to 0.57, 0.66, and 0.64, respectively (p < 0.05). As a control, treatment with EGCG also increased the slowing rate to 0.63 under 6-OHDA exposure. However, treatment with astragalan (1.0–4.0 mg/mL) alone had almost no effect on the slowing rate of BZ555 nematodes (Figure 2(b)), indicating that astragalan per se did not affect the viability of dopaminergic neurons under normal condition. Together, these data demonstrate that astragalan is able to rescue dopaminergic neuronal dysfunction mediated by 6-OHDA.
Figure 2

Effect of astragalan on food-sensing behavior in C. elegans. (a) The body bends of BZ555 nematodes treated with or without astragalan (1.0–4.0 mg/mL) after 6-OHDA exposure were counted, and the slowing rate was defined as the rate decrease of body bends in the plates with bacteria lawn compared with those without bacteria lawn. (b) The body bends of BZ555 nematodes treated with or without astragalan (1.0–4.0 mg/mL) were counted and used to calculate the slowing rate. Results are presented as mean ± SEM of three independent experiments. p < 0.05 versus 6-OHDA-exposed nematodes.

It is known that Astragalus polysaccharide has antitumor effect against human tumor cells [22]. Interestingly, however, studies have also shown that Astragalus polysaccharide has protective effects on neuronal cells [11, 12]. This paradox is likely due to the distinct but also overlapping mechanisms regulated by the polysaccharide under different disease and stress contexts. The anticancer effect of Astragalus polysaccharide is most likely due to its immunomodulatory effect rather than direct cytocidal action [23, 24]. For instance, Astragalus polysaccharide has shown therapeutic effect by promoting the secretion of proinflammatory cytokines including interleukin and tumor necrosis factor in S180 sarcoma-bearing mice [23]. On the other hand, the polysaccharide can also protect microglial cells against lipopolysaccharide-stimulated inflammation through suppression of nuclear factor-κB and protein kinase B signalling pathways [25]. Interestingly, recent studies have shown that immunotherapy not only is a successful strategy that mediates tumor regression in patients with metastatic cancer but also holds the promise to treat neurodegenerative diseases [26]. Therefore, the specific roles of Astragalus polysaccharide in neurons and cancer cells may depend on different cellular and physiological environment.

3.3. Astragalan Increases the Lifespan of 6-OHDA-Intoxicated C. elegans

It is known that aging contributes to the development of late-onset neurodegenerative diseases, and age-dependent neurodegenerative changes are usually associated with a shortened life expectancy [27]. Therefore, we investigated the effect of astragalan on the lifespan of BZ555 nematodes under 6-OHDA intoxication. As shown in Figure 3, 6-OHDA-exposed nematodes exhibited a shorter mean lifespan (16.8 ± 0.35 d) as compared to that of the unexposed nematodes (19.3 ± 0.48 d) (p < 0.05), suggesting the toxic effect of 6-OHDA to accelerate senescence. When the 6-OHDA-exposed nematodes were treated with astragalan at 2.0 mg/mL, the mean lifespan was significantly increased to 19.4 ± 0.64 d (p < 0.05), which is similar to the action of EGCG (18.1 ± 0.51 d), indicating the capacity of astragalan to delay 6-OHDA-induced senescence. We have previously found that astragalan is able to extend the lifespan of wild-type and transgenic polyglutamine C. elegans, and its antiaging activity is associated with the modulation of DAF-16, a major downstream component of the insulin/insulin-like growth factor 1 (IGF-1) signalling pathway related to both lifespan regulation and stress resistance [11]. Recent studies have revealed that manipulation of insulin-related signalling pathways can resist 6-OHDA-mediated neurotoxicity. For example, ginsenoside Rg1 alleviates dopaminergic neuronal injury in 6-OHDA-lesioned rats through IGF-1 receptor, while IGF-1 receptor antagonist JB-1 reduces the neuroprotective effects of ginsenoside Rg1 [28]. Together, these results suggest that regulation of DAF-16 may contribute to the protective effect of astragalan against 6-OHDA neurotoxicity.
Figure 3

Effect of astragalan on the lifespan of 6-OHDA-intoxicated C. elegans. The BZ555 nematodes were treated with or without 2.0 mg/mL of astragalan after exposure to 6-OHDA, and the survival rates were scored every 2 days from the beginning of adulthood until all dead. A representative Kaplan-Meier survival curve from at least three independent experiments is presented.

3.4. Astragalan Reduces ROS Level and MDA Content and Enhances Antioxidant Enzyme Activities in 6-OHDA-Intoxicated C. elegans

Oxidative stress is known to play an important role in the pathological process of age-related neurodegenerative diseases. For example, the increase of ROS level and oxidized lipids and proteins was observed in the brains of both sporadic and familial PD patients [29]. The oxidation of 6-OHDA generates cytotoxic hydrogen peroxide and other reactive species, leading to dopaminergic neuronal apoptosis [7]. Therefore, antioxidant intake represents a promising strategy against age-related neurodegenerative disorders [30]. Here we tested whether astragalan was able to reduce ROS level in C. elegans under 6-OHDA exposure using the DCF method. As shown in Table 2, the ROS level of 6-OHDA-exposed nematodes was significantly increased as compared to that of unexposed nematodes (p < 0.05). When the nematodes were cotreated with 6-OHDA and 2.0 mg/mL of astragalan, the ROS level was reduced compared with that of the nematodes exposed to 6-OHDA alone (p < 0.05). When BZ555 nematodes were treated with 2.0 mg/mL of astragalan, the ROS level was also reduced (p < 0.05). We then further examined the effect of astragalan on the content of MDA, a toxic lipid peroxidation product. As shown in Table 2, 6-OHDA exposure increased the MDA content in BZ555 nematodes, while astragalan was able to reduce the increased MDA content in 6-OHDA-intoxicated nematodes (p < 0.05), indicating its ability to inhibit lipid peroxidation. Together, these data demonstrate the antioxidant capacity of astragalan against 6-OHDA intoxication. Since PD is closely associated with oxidative stress, our results suggest an involvement of antioxidant activity in the neuroprotective effect of astragalan. This is supported by previous studies; for instance, a combination of antioxidant creatine and coenzyme Q10 can delay cognitive function decline and reduce plasma phospholipid level in PD patients [31].
Table 2

Effect of astragalan on ROS level, antioxidant enzyme activities and malondialdehyde content in C. elegans.

TreatmentROS levela MDA contentb Antioxidant enzyme activity
SODc CATd GPxc
BZ5554.55 ± 0.2012.52 ± 2.6369.35 ± 2.651.53 ± 0.0917.19 ± 0.24
Astragalan3.60 ± 0.01e 9.64 ± 0.9072.02 ± 6.561.48 ± 0.1019.15 ± 1.29
6-OHDA7.97 ± 0.55e 16.21 ± 4.43e 43.90 ± 3.12e 1.34 ± 0.0712.32 ± 0.33e
6-OHDA/Astragalan4.70 ± 0.10f 14.39 ± 2.25f 69.33 ± 2.46f 1.45 ± 0.1016.44 ± 0.99f

aROS level, DCF fluorescence/μg proteins; bMDA content, nM/mg proteins; cSOD and GPx activities, U/mg proteins; dCAT activity, U/μg proteins; e p < 0.05 versus BZ555 nematodes without 6-OHDA exposure and astragalan treatment; f p < 0.05 versus 6-OHDA-exposed BZ555 nematodes.

The endogenous antioxidant system, including antioxidant enzymes and nonenzymatic antioxidants, is known to scavenge excessive ROS and maintain cellular redox balance. For example, SOD converts superoxide radicals to hydrogen peroxide and oxygen, while CAT and GPx detoxify hydrogen peroxide to water [32]. Inherited and acquired deficiencies of antioxidant system such as a defect in antioxidant enzyme activity lead to an imbalance of cellular redox environment and thus promote a variety of disorders including PD. For example, inhibition of Cu/Zn-SOD expression and activity aggravates 6-OHDA-mediated neuronal apoptosis [33]. Therefore, enhancing antioxidant system function is helpful to reduce oxidative damage in neurodegenerative diseases. In this study, we examined the effect of astragalan on antioxidant enzyme activities and found that 6-OHDA exposure caused a significant decrease of both SOD and GPx activities in BZ555 nematodes (p < 0.05). However, 2.0 mg/mL of astragalan was able to increase SOD and GPx activities in the nematodes with 6-OHDA exposure (p < 0.05). It also slightly enhanced CAT activity in 6-OHDA-intoxicated nematodes (Table 2). Interestingly, Astragalus polysaccharides are previously shown to scavenge various ROS species in vitro and increase the level of nonenzymatic antioxidant glutathione in porcine circovirus type 2 infected cells [34, 35]. Together, these findings indicate that Astragalus polysaccharide is capable of enhancing antioxidant system function, and this ability may provide protections against 6-OHDA-induced damage.

3.5. Astragalan Suppresses the Proapoptotic Gene egl-1 Expression in 6-OHDA-Intoxicated C. elegans

In C. elegans, several proteins, including CED-4, CED-3, CED-9, and EGL-1, play a critical role in programmed cell death. The mammalian Apaf-1 counterpart CED-4 promotes the proteolytic activation of CED-3, which is the mammalian caspase-1 homolog and acts as the executor in apoptosis process. This activation process can be inhibited by CED-9, a homolog of the mammalian Bcl-2 and Bcl-XL antiapoptotic proteins. The BH3-only domain protein EGL-1 is a nematode counterpart of proapoptotic Bcl-2 family members. It interacts with CED-9-CED-4 complex and promotes the release of CED-4, resulting in the activation of CED-3 [36]. Previous reports have shown that 6-OHDA exposure induces apoptosis-like changes, such as condensed chromatin structures and shrunken cell morphologies, in dopaminergic neurons of C. elegans [37]. To investigate whether the aforementioned apoptosis-related proteins were involved in the actions of 6-OHDA and astragalan, we examined the mRNA levels of ced-4, ced-3, ced-9, and egl-1 using quantitative real-time PCR. As shown in Figure 4, unexpectedly, 6-OHDA exposure did not influence the transcript levels of ced-4, ced-3, ced-9, and egl-1 in BZ555 nematodes, suggesting that these gene expressions may be not involved in 6-OHDA-mediated neuronal apoptosis in C. elegans. Interestingly, another neurotoxin 1-methyl-4-phenylpyridnium ion (MPP+) that can trigger parkinsonism also destroys C. elegans dopaminergic neurons independent of ced-4 pathway [38]. However, a recent study has shown that 6-OHDA activates the mitochondrial apoptosis pathway including the release of cytochrome c to cytosol and the activation of caspase-3 in rat adrenal phaeochromocytoma PC12 cells [39], indicating that other mechanisms may contribute to 6-OHDA-induced neuronal apoptosis. On the other hand, in 6-OHDA-intoxicated nematodes, treatment with 2.0 mg/mL of astragalan exhibited negligible effects on the mRNA levels of ced-4, ced-3, and ced-9 but significantly reduced the mRNA level of egl-1 as compared to those in the nematodes exposed to 6-OHDA alone, indicating a potential of astragalan in regulating apoptotic pathway.
Figure 4

Effect of astragalan on the transcript levels of apoptosis-related genes in C. elegans. The mRNA levels of ced-3, ced-4, ced-9, and egl-1 of BZ555 nematodes with or without 2.0 mg/mL of astragalan treatment under 6-OHDA exposure were performed using quantitative real-time PCR. Data are normalized to the nematodes without 6-OHDA and astragalan treatment and presented as mean ± SEM of three independent experiments. p < 0.05 versus 6-OHDA-exposed nematodes.

A large body of evidence has shown that modulation of apoptotic pathway holds promise to delay aging and treat aging-related neurodegenerative disorders. For instance, a decrease of ced-3 expression by overexpression of the mammalian KIF11 homolog bmk-1 extends the lifespan of wild-type C. elegans [40]. The BH3-only domain protein Bim plays a pivotal role in mouse cerebrovascular degeneration induced by β-amyloid peptide, the main component of amyloid plaques in patients with Alzheimer's disease, while a decrease of Bim expression attenuates the death of cerebral endothelial cells [41]. Therefore, our data suggest that the regulation of proapoptotic gene egl-1 expression may contribute to the protective effects of astragalan in C. elegans. In addition, a number of signalling pathways play important roles in free radical-mediated cell death [42, 43]. Among these pathways that respond to stresses, the MAPK family, including p38, ERK, and JNK, are important regulators in cell survival and death. Recent studies have shown that MAPKs are involved in the antioxidant and antiapoptotic effects of Astragalus polysaccharides. For example, Astragalus polysaccharides ameliorate doxorubicin-induced oxidative stress and apoptosis by inhibiting p38 MAPK pathway in cultured primary neonatal rat ventricular myocytes [44]. Thus, the MAPK pathway is likely associated with the protective function of astragalan in 6-OHDA-intoxicated C. elegans. Nevertheless, other stress-response signalling pathways may also be involved. For example, a sulfated polysaccharide isolated from sea cucumber Stichopus japonicus prevents 6-OHDA cytotoxicity through activation of PI3K/Akt signalling pathway in human neuroblastoma SH-SY5Y cells [45]. However, the exact signalling mechanisms underlying the neuroprotective effect of astragalan need further investigation.

3.6. Astragalan Increases Acetylcholinesterase Activity in 6-OHDA-Intoxicated C. elegans

Although PD is characterized by motor impairment and psychiatric disturbance mainly due to nigrostriatal dopaminergic denervation, increasing evidences reveal that a varying degree of degeneration in the cholinergic, serotonergic, and noradrenergic systems also contributes to motor and nonmotor abnormalities [46, 47]. For example, the nigrostriatal dopamine depletion triggers excessive release of excitatory neurotransmitter acetylcholine, leading to dysfunction of the corticobasal ganglia-thalamocortical loop circuits in PD patients [46]. In C. elegans, acetylcholine plays an important role in the control of various behaviors, including locomotion, feeding, mating, and egg laying, whereas acetylcholinesterase (AChE) is able to hydrolyze acetylcholine at neuronal junctions [48]. The administration of 6-OHDA has been reported to decrease AChE activity in animal models such as C. elegans and rats [7, 18, 49]. Thus, targeting AChE, an indirect indicator of cholinergic system function, provides a helpful strategy to alleviate the behavioral deficit in PD progression. In the present study, we tested whether astragalan regulated AChE activity in BZ555 nematodes. As shown in Figure 5, AChE activity was decreased in BZ555 nematodes after being exposed to 6-OHDA (p < 0.05). When the nematodes were cotreated with 6-OHDA and 2.0 mg/mL of astragalan, the decreased AChE activity was significantly elevated (p < 0.05). Interestingly, a previous study has shown that Astragalus polysaccharide was able to attenuate homocysteine-mediated inhibition of vasorelaxation to acetylcholine [50], suggesting its potential to influence cholinergic system. Together, our results suggest that the restoration of cholinergic system function may be associated with the protective effect of astragalan against 6-OHDA-mediated neuronal dysfunction.
Figure 5

Effect of astragalan on the acetylcholinesterase activity in C. elegans. The 6-OHDA-exposed or unexposed BZ555 nematodes were treated with 2.0 mg/mL of astragalan and then used to determine the acetylcholinesterase activities. Results are presented as mean ± SEM of three independent experiments. p < 0.05 versus 6-OHDA-exposed nematodes.

4. Conclusions

In this study, we reveal that A. membranaceus polysaccharide astragalan not only attenuates the degeneration of dopaminergic neurons and the deficiency of food-sensing behavior but also increases the lifespan of 6-OHDA-exposed nematodes. We also demonstrate that astragalan is capable of reducing ROS level and inhibiting lipid peroxidation as well as increasing SOD and GPx activities in 6-OHDA-intoxicated nematodes. Further studies indicate that astragalan is able to reduce the transcript level of proapoptotic gene egl-1 and increase AChE activity in 6-OHDA-exposed nematodes. Together, these findings suggest that the Astragalus polysaccharide astragalan can suppress 6-OHDA neurotoxicity through reducing oxidative stress, regulating apoptosis pathway and restoring cholinergic system function.
  48 in total

1.  Astragalus polysaccharide attenuates lipopolysaccharide-induced inflammatory responses in microglial cells: regulation of protein kinase B and nuclear factor-κB signaling.

Authors:  Tao Luo; Jian Qin; Min Liu; Jun Luo; Fang Ding; Mingling Wang; Limin Zheng
Journal:  Inflamm Res       Date:  2015-02-11       Impact factor: 4.575

2.  Support supplied by Parkinson's disease specialist nurses to Parkinson's disease patients and their spouses.

Authors:  Carina Hellqvist; Carina Berterö
Journal:  Appl Nurs Res       Date:  2015-02-26       Impact factor: 2.257

3.  Caenorhabditis elegans EGL-1 disrupts the interaction of CED-9 with CED-4 and promotes CED-3 activation.

Authors:  L del Peso; V M González; G Núñez
Journal:  J Biol Chem       Date:  1998-12-11       Impact factor: 5.157

4.  Oxidative stress in Parkinson's disease.

Authors:  Shashikant Nikam; Padmaja Nikam; S K Ahaley; Ajit V Sontakke
Journal:  Indian J Clin Biochem       Date:  2009-05-08

Review 5.  Acetylcholine-dopamine balance hypothesis in the striatum: an update.

Authors:  Toshihiko Aosaki; Masami Miura; Takeo Suzuki; Kinya Nishimura; Masao Masuda
Journal:  Geriatr Gerontol Int       Date:  2010-07       Impact factor: 2.730

6.  High-performance gel permeation chromatography of meningococcal polysaccharides.

Authors:  P Newland; B Bingham; E Tarelli; A H Thomas
Journal:  J Chromatogr       Date:  1989-12-08

7.  Analysis of the constancy of DNA sequences during development and evolution of the nematode Caenorhabditis elegans.

Authors:  S W Emmons; M R Klass; D Hirsh
Journal:  Proc Natl Acad Sci U S A       Date:  1979-03       Impact factor: 11.205

8.  Protein phosphatase 2A regulates bim expression via the Akt/FKHRL1 signaling pathway in amyloid-beta peptide-induced cerebrovascular endothelial cell death.

Authors:  Ke-Jie Yin; Chung Y Hsu; Xiao-Yan Hu; Hong Chen; Sha-Wei Chen; Jan Xu; Jin-Moo Lee
Journal:  J Neurosci       Date:  2006-02-22       Impact factor: 6.167

9.  Antitumor and immunomodulatory activity of Astragalus membranaceus polysaccharides in H22 tumor-bearing mice.

Authors:  Bin Yang; Bing Xiao; Taoyu Sun
Journal:  Int J Biol Macromol       Date:  2013-09-20       Impact factor: 6.953

10.  Regulatory effect of astragalus polysaccharides on intestinal intraepithelial γδT cells of tumor bearing mice.

Authors:  Shuyu Sun; Kang Zheng; Hongyan Zhao; Cheng Lu; Biao Liu; Changyuan Yu; Ge Zhang; Zhaoxiang Bian; Aiping Lu; Xiaojuan He
Journal:  Molecules       Date:  2014-09-23       Impact factor: 4.411

View more
  12 in total

Review 1.  Behavioral Phenotyping and Pathological Indicators of Parkinson's Disease in C. elegans Models.

Authors:  Malabika Maulik; Swarup Mitra; Abel Bult-Ito; Barbara E Taylor; Elena M Vayndorf
Journal:  Front Genet       Date:  2017-06-13       Impact factor: 4.599

Review 2.  Astragalin: A Bioactive Phytochemical with Potential Therapeutic Activities.

Authors:  Ammara Riaz; Azhar Rasul; Ghulam Hussain; Muhammad Kashif Zahoor; Farhat Jabeen; Zinayyera Subhani; Tahira Younis; Muhammad Ali; Iqra Sarfraz; Zeliha Selamoglu
Journal:  Adv Pharmacol Sci       Date:  2018-05-02

3.  GST-4-Dependent Suppression of Neurodegeneration in C. elegans Models of Parkinson's and Machado-Joseph Disease by Rapeseed Pomace Extract Supplementation.

Authors:  Franziska Pohl; Andreia Teixeira-Castro; Marta Daniela Costa; Victoria Lindsay; Juliana Fiúza-Fernandes; Marie Goua; Giovanna Bermano; Wendy Russell; Patrícia Maciel; Paul Kong Thoo Lin
Journal:  Front Neurosci       Date:  2019-10-17       Impact factor: 4.677

4.  Study of the Effect of Neutral Polysaccharides from Rehmannia glutinosa on Lifespan of Caenorhabditis elegans.

Authors:  Yanyan Yuan; Nianxin Kang; Qingxia Li; Yali Zhang; Yonggang Liu; Peng Tan
Journal:  Molecules       Date:  2019-12-15       Impact factor: 4.411

5.  Astragaloside IV Protects 6-Hydroxydopamine-Induced SH-SY5Y Cell Model of Parkinson's Disease via Activating the JAK2/STAT3 Pathway.

Authors:  ZhengHu Xu; Dongfeng Yang; Xiaojing Huang; Huai Huang
Journal:  Front Neurosci       Date:  2021-03-23       Impact factor: 4.677

Review 6.  Anti-Aging Implications of Astragalus Membranaceus (Huangqi): A Well-Known Chinese Tonic.

Authors:  Ping Liu; Haiping Zhao; Yumin Luo
Journal:  Aging Dis       Date:  2017-12-01       Impact factor: 6.745

7.  Astragalus Polysaccharide Extends Lifespan via Mitigating Endoplasmic Reticulum Stress in the Silkworm, Bombyx mori.

Authors:  Jiangbo Song; Min Chen; Zhiquan Li; Jianfei Zhang; Hai Hu; Xiaoling Tong; Fangyin Dai
Journal:  Aging Dis       Date:  2019-12-01       Impact factor: 6.745

8.  Preparation and Neuroprotective Activity of Glucuronomannan Oligosaccharides in an MPTP-Induced Parkinson's Model.

Authors:  Yingjuan Liu; Weihua Jin; Zhenzhen Deng; Jing Wang; Quanbin Zhang
Journal:  Mar Drugs       Date:  2020-08-23       Impact factor: 5.118

9.  Compounds Isolated from Wikstroemia taiwanensis Regulate Bone Remodeling by Modulating Osteoblast and Osteoclast Activities.

Authors:  Zuha Imtiyaz; Yi-Tzu Lin; Fang-Yu Liang; Wen-Fei Chiou; Mei-Hsien Lee
Journal:  Front Pharmacol       Date:  2021-07-13       Impact factor: 5.810

Review 10.  Natural Polysaccharides as Preventive and Therapeutic Horizon for Neurodegenerative Diseases.

Authors:  Manel Dhahri; Mawadda Alghrably; Hamdoon A Mohammed; Syed Lal Badshah; Noreen Noreen; Fouzi Mouffouk; Saleh Rayyan; Kamal A Qureshi; Danish Mahmood; Joanna Izabela Lachowicz; Mariusz Jaremko; Abdul-Hamid Emwas
Journal:  Pharmaceutics       Date:  2021-12-21       Impact factor: 6.321

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.