Efficient DNA barcode regions for classifying Piper species (Piperaceae).

Piper species are used for spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and insecticides. Here barcode analysis was performed for identification of plant parts, young plants and modified forms of plants. Thirty-six Piper species were collected and the three barcode regions, matK, rbcL and psbA-trnH spacer, were amplified, sequenced and aligned to determine their genetic distances. For intraspecific genetic distances, the most effective values for the species identification ranged from no difference to very low distance values. However, Piper betle had the highest values at 0.386 for the matK region. This finding may be due to Piper betle being an economic and cultivated species, and thus is supported with growth factors, which may have affected its genetic distance. The interspecific genetic distances that were most effective for identification of different species were from the matK region and ranged from a low of 0.002 in 27 paired species to a high of 0.486. Eight species pairs, Piper kraense and Piper dominantinervium, Piper magnibaccum and Piper kraense, Piper phuwuaense and Piper dominantinervium, Piper phuwuaense and Piper kraense, Piper pilobracteatum and Piper dominantinervium, Piper pilobracteatum and Piper kraense, Piper pilobracteatum and Piper phuwuaense and Piper sylvestre and Piper polysyphonum, that presented a genetic distance of 0.000 and were identified by independently using each of the other two regions. Concisely, these three barcode regions are powerful for further efficient identification of the 36 Piper species.

Introduction

Plants in the genus have been used since prehistoric times for a variety of human activities. They are used as spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and as insecticides (Chaveerach et al. 2006a, Scott et al. 2008, Fan et al. 2011). , the betel plant, is one of the most important and well-known species of the genus. It contains important chemical substances, such as chavicol, cineol and eugenol, used in essential oils, medicines and insecticides (Yusoff et al. 2005, Misra et al. 2009). Eugenol has been reported as having anti-oxidant and anti-inflammatory properties (Misra et al. 2009). Although the betel plant is of great economic importance, it is challenging to cultivate. The main problem is foot and leaf rot, which is caused by the fungus Dast. In addition, the plant is subject to leaf spot, which is caused by bacteria (Silayoi et al. 1985, Banka and Teo 2000). Investigations of the genus in Thailand (Chaveerach et al. 2008, 2009) have found that among the 43 species, some produce a betel-like scent. Of these, all are wild species and hardy, producing numerous branches and leaves. They are tolerant and resistant to disease. Some produce a stronger scent than betel. Therefore, these species might be equally or more economically beneficial than the betel plant. The assured advantage is that there would be more choices of plants for use (Sanubol et al. 2014). Medicinal plants have been used in natural and modified forms. The modified forms such as dried sliced plant parts, powder and capsules, are difficult to recognize by physical features. Therefore, reliable identification methods for these plant forms should be developed. DNA barcoding is the most reliable and applicable method for identification. The method was developed in 2003 (Hebert et al. 2003). It principally uses short DNA sequences from appropriate genome regions for the identification of organisms. The CO1 and 16s rDNA regions have been successfully used for most animals. For example, Hebert et al. (2004) used the to discriminate between bird species. Zhang and Hanner (2012) used sequences of , 16s RNA, MT-CYB and RNA 18s in 242 species of fish and in 11 species.

mitochondrially encoded cytochrome c oxidase I

For plants, however, it is more of a challenge. Currently, several research groups are seeking a suitable genome region, and this effort has led to the identification of appropriate regions for DNA barcoding in some plant groups, such as the matK gene (Siripiyasing et al. 2012, Tanee et al. 2012), the rbcL gene (Tanee et al. 2012, Kwanda et al. 2013), the psbA-trnH spacer region (Chaveerach et al. 2011).

The standard barcodes used for most investigations of plants are the three plastid barcodes, which include matK gene, rbcL gene and psbA-trnH spacer, and one nuclear (ITS) regions identified by the CBOL Plant Working Group (2009), Chaveerach et al. (2011), Hollingsworth et al. (2011) and Monkheang et al. (2011). With the importance of species as economically valued plants worldwide and with the plant parts of many species being used, such as the trunk, leaves and fruits, as well as young plants and processed plant materials in the forms of powder and slices, identifying the species used is paramount to verify the authenticity of such goods. Therefore, these products should have a specific marker that identifies a species using barcode for each species.

The aim of this research was to construct barcodes for species in Thailand using matK, rbcL and the psbA-trnH spacer regions, as these species are important medicinal plants that have not been fully explored for barcode identification. Here we initiate the development of reference barcodes for plant parts, young plants and plant products.

Materials and methods

Plant materials

Species and sites of recently reported in Thailand (Chaveerach et al. 2006a, 2006b, 2007, 2008, Sudmoon et al. 2011) were collected and carefully identified followed the literatures. Leaf samples were kept on ice, transferred to the laboratory, and then stored at -20 °C until further use.

DNA extraction

Whole genomic DNA was extracted using a Plant Genomic DNA Extraction Kit (RBC Bioscience) following the kit protocols.

Amplification of barcode fragments

analyses were performed with primer pairs (5'–3') ATCCATCTGGAAATCTTAGTTC and GTTCTAGCACAAGAAAGTCG (CBOL Plant Working Group 2009) for the matK gene, GTCACCACAAACAGAGACTAAAGC and GTAAAATCAAGTCCACCRCG (CBOL Plant Working Group 2009) for the rbcL gene, and GTTATGCATGAACGTAATGCTC and CGCGCATGGTGGATTCACAATCC (Hollingsworth et al. 2011) for the psbA-trnH spacer region. The reaction mixture (30 µl) consisted of 1× GoTaq Green Master Mix (Promega), 0.5 µM primers, and 30 ng of DNA template. The amplification profile included pre-denaturation at 94 °C for 1 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 52 °C (for matK) or 55 °C (for rbcL and the psbA-trnH spacer) for 30 s, extension at 72 °C for 1 min and a final extension at 72 °C for 5 min. The amplified products were subjected to 2% agarose gel electrophoresis.

Polymerase chain reaction

DNA sequencing and sequences analyses

The specific fragments amplified were sequenced at the DNA Sequencing Unit, Faculty of Medicine, Ramathibodi Hospital, Bangkok, Thailand. The sequences were then analyzed using Blast tools (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences were aligned for each genome region amplified to determine genetic distance values PageBreakby MEGA6 (Tamura et al. 2013) using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. The sequences were submitted to GenBank and corresponding accession numbers were given.

Results

Thirty-six species were collected to construct barcodes. Because most of the species that we investigated were wild, it was difficult to collect a sufficient amount of samples from all 36 species to adequately construct barcodes. Sufficient samples were obtained for four species, , , and , which are all economic plants.

The amplification of barcode bands from the matK region was not successful in two species, including and (♀). This may be because the DNAs were fragmented at the primer regions. Table 1 shows the GenBank accession numbers corresponding to 119 sequences from the matK, rbcL and psbA-trnH spacer regions for all 36 species studied.

Table 1.

GenBank accession numbers of DNA barcoding from three regions of species.

Scientific name	GenBank accession number#
	matK	psbA-trnH spacer	rbcL
Piper argyritis	KM073990	JX442927, KM055176	JX291978, KM055126
Piper betle (♀)	GU372747, KM098143	GQ891996, JQ248053	JQ248074
Piper betle (♂)	KM098144	JQ248050	JQ248071
Piper betloides	KM098135	JQ248051	JQ248072
Piper boehmeriifolium	KM073991, KM073992	KM055177, KM055178	KM055127, KM055128
Piper caninum	KM073993, KM073994	KM055179, KM055180	KM055129, KM055130
Piper colubrinum	GU372751, KM073995	GQ892000	KM055131
Piper crocatum	KM098136	JQ248047	JQ248068
Piper dominantinervium	KM073996, KM073997	KM055181, KM055182	KM055132, KM055133
Piper hongkongense	KM073998, KM073999	KM055183, KM055184	KM055134, KM055135
Piper khasianum	KM074000, KM074001	KM055185, KM055186	KM055136, KM055137
Piper kraense	KM074002, KM074003	KM055187, KM055188	KM055138, KM055139
Piper longum	KM074004, KM074005	KM055189, KM055190	KM055140, KM055141
Piper maculaphyllum	KM074006, KM098137	JQ248046, KM055191	JQ248067, KM055142
Piper magnibaccum	KM074007, KM074008	KM055192, KM055193	KM055143, KM055144
Piper montium	n/a	KM055194, KM055195	KM055145, KM055146
Piper mutabile	KM074035	KM055196, KM055197	KM055147, KM055148
Piper nigrum	KM074009, KM074010	GQ891994, KM055198, KM055199	KM055149, KM055150
Piper pedicellatum var. eglandulatum	KM074011, KM074012	KM055200, KM055201	KM055151, KM055152
Piper pendulispicum (♀)	KM074013, GU372748	KM055202, GQ891997	KM055153, JX291979
Piper phuwuaense	KM074014, KM074015	KM055203, KM055204	KM055154, KM055155
Piper pilobracteatum	KM074016, KM074017, KM074018, KM074019	KM055205, KM055206, KM055207, KM055208	KM055156, KM055157, KM055158, KM055159
Piper polysyphonum	KM074020, KM074021	KM055209, KM055210	KM055160, KM055161
Piper protrusum	KM074032, KM074033	GU980900, KM055223	KM055172, KM055173
Piper retrofractum	GU372749, KM074034	GQ891998, KM055224	KM055175
Piper ribesioides	GU372750, KM074022	GQ891999, KM055211	KM055162
Piper rubroglandulosum (♀)	n/a	JX442926	JX291977
Piper rubroglandulosum (♂)	KM098138	JX442925	JX291976
Piper sarmentosum	GU372746, KM074023, KM074024	KM055212, KM055213	KM055163, KM055164
Piper semiimmersum	KM098139	JQ248045	JQ248066
Piper submultinerve	KM098140	JQ248048	JQ248069
Piper sylvaticum	KM074025, KM074026	KM055214, KM055215	KM055174
Piper sylvestre	KM074027, KM074028	KM055216, KM055217	KM055165, KM055166
Piper thomsonii var. trichostigma	KM074029	KM055218	KM055167
Piper tricolor	KM098141	JQ248049	JQ248070
Piper umbellatum	n/a	KM055219, KM055220	KM055168, KM055169
Piper wallichii	KM074030, KM074031	KM055221, KM055222	KM055170, KM055171
Piper yinkiangense	KM098142	JQ248052	JQ248073

# the sequence data deposited at www.ncbi.nlm.nih.gov/Genbank; n/a is "not amplified"

The intraspecific genetic distances for each region were the following: 1) for the matK region, the lowest value of 0.000 was observed in , , and , while the highest value of 0.386 was observed for ; 2) for the rbcL region, the lowest value of 0.000 was observed in , , , , , , , and , while the highest value of 0.166 was observed in ; 3) for the psbA-trnH spacer region, the lowest value of 0.000 was observed in , , , , , , , , and while the highest value of 0.117 was observed in .

The interspecific genetic distances for each region were the following: 1) for the matK region the lowest value of 0.000 was observed in the paired species and , and , and , and , and , and , and and and , while the highest value of 0.486 was observed between and ; 2) for the rbcL region, the lowest value of 0.000 was observed between pairs and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and PageBreakPageBreak, and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and , and and , while the highest value of 0.213 was observed in the and pair; 3) for the psbA-trnH spacer region the lowest value of 0.000 was observed in the pairs of and , and , and , and , and , and , and , and , and , and , and , and , and , and , and and , while the highest value of 0.228 was observed between and .

The genetic distance of the matK region in Table 2 is a representative example.

Table 2.

Genetic distance values of the matK region for identification, a representative example.

	Piper argyritis	Piper betle	Piper betle	Piper betle	Piper betloides	Piper boehmeriifolium	Piper boehmeriifolium	Piper caninum	Piper caninum	Piper colubrinum	Piper colubrinum	Piper crocatum	Piper dominantinervium	Piper dominantinervium	Piper hongkongense	Piper hongkongense	Piper khasianum	Piper khasianum	Piper kraense	Piper kraense	Piper longum	Piper longum	Piper maculaphyllum	Piper maculaphyllum	Piper magnibaccum	Piper magnibaccum	Piper nigrum	Piper nigrum	Piper pedicellatum	Piper pedicellatum	Piper pendulispicum
Piper argyritis	.000
Piper betle	.323	.000
Piper betle	.076	.362	.000
Piper betle	.126	.386	.106	.000
Piper betloides	.249	.423	.262	.260	.000
Piper boehmeriifolium	.004	.323	.074	.124	.252	.000
Piper boehmeriifolium	.011	.325	.074	.126	.258	.009	.000
Piper caninum	.013	.328	.080	.132	.249	.009	.017	.000
Piper caninum	.013	.328	.080	.132	.249	.009	.017	.000	.000
Piper colubrinum	.020	.332	.087	.134	.267	.017	.022	.026	.026	.000
Piper colubrinum	.089	.375	.143	.195	.310	.085	.093	.093	.093	.072	.000
Piper crocatum	.054	.358	.106	.145	.267	.052	.056	.061	.061	.065	.130	.000
Piper dominantinervium	.004	.323	.072	.121	.252	.002	.007	.011	.011	.015	.087	.050	.000
Piper dominantinervium	.004	.323	.072	.121	.252	.002	.007	.011	.011	.015	.087	.050	.000	.000
Piper hongkongense	.013	.321	.080	.130	.260	.011	.011	.020	.020	.024	.095	.059	.009	.009	.000
Piper hongkongense	.013	.321	.080	.130	.260	.011	.011	.020	.020	.024	.095	.059	.009	.009	.000	.000
Piper khasianum	.007	.325	.076	.126	.249	.002	.011	.011	.011	.020	.087	.054	.004	.004	.013	.013	.000
Piper khasianum	.007	.325	.074	.124	.249	.004	.009	.013	.013	.017	.089	.052	.002	.002	.011	.011	.002	.000
Piper kraense	.004	.323	.072	.121	.252	.002	.007	.011	.011	.015	.087	.050	.000	.000	.009	.009	.004	.002	.000
Piper kraense	.004	.323	.072	.121	.252	.002	.007	.011	.011	.015	.087	.050	.000	.000	.009	.009	.004	.002	.000	.000
Piper longum	.013	.325	.080	.130	.258	.011	.015	.020	.020	.024	.091	.054	.009	.009	.017	.017	.013	.011	.009	.009	.000
Piper longum	.013	.325	.080	.130	.258	.011	.015	.020	.020	.024	.091	.054	.009	.009	.017	.017	.013	.011	.009	.009	.000	.000
Piper maculaphyllum	.065	.369	.130	.171	.282	.065	.072	.074	.074	.080	.141	.111	.065	.065	.074	.074	.063	.063	.065	.065	.072	.072	.000
Piper maculaphyllum	.054	.341	.072	.113	.249	.052	.054	.061	.061	.065	.130	.085	.050	.050	.059	.059	.054	.052	.050	.050	.054	.054	.111	.000
Piper magnibaccum	.007	.325	.074	.124	.249	.004	.009	.013	.013	.017	.089	.052	.002	.002	.011	.011	.002	.000	.002	.002	.011	.011	.063	.052	.000
Piper magnibaccum	.009	.323	.076	.124	.256	.007	.011	.015	.015	.015	.087	.054	.004	.004	.013	.013	.009	.007	.004	.004	.013	.013	.069	.054	.007	.000
Piper nigrum	.015	.334	.087	.130	.262	.017	.022	.026	.026	.030	.102	.061	.015	.015	.024	.024	.020	.017	.015	.015	.022	.022	.072	.063	.017	.020	.000
Piper nigrum	.009	.325	.080	.121	.249	.011	.015	.020	.020	.024	.095	.059	.009	.009	.017	.017	.013	.011	.009	.009	.017	.017	.072	.054	.011	.013	.020	.000
Piper pedicellatum	.011	.328	.080	.126	.252	.007	.015	.015	.015	.024	.091	.054	.009	.009	.017	.017	.009	.011	.009	.009	.013	.013	.067	.046	.011	.013	.022	.013	.000
Piper pedicellatum	.011	.325	.074	.124	.258	.009	.004	.017	.017	.022	.093	.056	.007	.007	.011	.011	.011	.009	.007	.007	.015	.015	.072	.054	.009	.007	.022	.015	.015	.000
Piper pendulispicum	.004	.325	.076	.126	.252	.007	.011	.015	.015	.020	.091	.050	.004	.004	.013	.013	.009	.007	.004	.004	.009	.009	.067	.050	.007	.009	.013	.009	.009	.011	.000

Discussion

Most of the 43 species of wild in Thailand have many functional uses. Only four species, , , and are economic and cultivated species, and all of these species are also used as ingredients in the products mentioned above in the introduction. is a well-known species that is important for its chemical substances, including essential oils, chavicol, cineol and eugenol, which can be used for medicinal and insecticidal purposes. Because these plants are widely used, and used in several forms, which include plant parts, powdered preparations, capsule formulations and other preparations, their authenticity should be verified using DNA barcodes to establish the worthiness of these products for medicinal, cosmetics and house-hold use. To overcome the problems associated with identifying species based on morphological characters, DNA barcoding has been employed. For flowering plants in Thailand, the psbA-trnH spacer region was suggested as an efficient DNA barcode marker in species (Monkheang et al. 2011), as well as and species (Kritpetcharat et al. 2011). In addition, the rbcL gene has been suggested as a marker in parasitic plants, including , , , and species (Kwanda et al. 2013) and the matK gene marker was identified in some medicinal species (Sudmoon et al. 2012). Therefore the authors selected these three regions for barcode promising in the species.

The results from DNA barcoding 36 species using three different marker regions support a previous hypothesis of genetic distance values (Hebert et al. 2003), showing a significant variance in sequences between species and a comparatively small variance within species. Note that the economic and planted species, had the highest intraspecific genetic distance values of 0.386 for the matK region, which may have been due to the presence of human growth factors. The interspecific genetic distances for the matK region were effective for the identification of different species with 27 pairs of species ranging from a low of 0.002 to a high of 0.486, as shown in Table 2 and eight unidentified species pairs had a genetic distance of 0.000. This result agrees with the study by Hao et al. (2013) who claimed that matK had high species identification reliability and suggested that this region should be used for identification of species along with the ITS region. Additionally, the rbcL and psbA-trnH spacer regions are effective for further identification of the other eight species pairs as shown in Table 3. The lowest genetic distance value is 0.010 of the pair and to the highest value 0.129 for the pair and in psbA-trnH spacer region. It can be concluded that these three barcode regions are powerful for further efficient identification of the 36 species.

Table 3.

Interspecific genetic distance values for identification of the eight pairs species by rbcL and psbA-trnH spacer sequences.

Pairs of species	matK region	rbcL region	psbA-trnH spacer region
Piper kraense and Piper dominantinervium	0.000	0.005-0.008	0.111-0.117
Piper magnibaccum and Piper kraense	0.000	0.008	0.1110-0.123
Piper phuwuaense and Piper dominantinervium	0.000	0.000-0.003	0.021-0.026
Piper phuwuaense and Piper kraense	0.000	0.005-0.008	0.021-0.129
Piper pilobracteatum and Piper dominantinervium	0.000	0.003	0.021
Piper pilobracteatum and Piper kraense	0.000	0.003	0.010-0.123
Piper pilobracteatum and Piper phuwuaense	0.000	0.003	0.016-0.021
Piper sylvestre and Piper polysyphonum	0.000	0.000	0.000-0.010

The results presented here support those of Newmaster et al. (2007), who proposed to use matK and the psbA-trnH spacer to identify plants, Sudmoon et al. (2012) who recommended independent analysis of each barcode region, and CBOL Plant Working Group (2009) who proposed rbcL and matK as the core DNA barcode regions for land plants.