Identification of Listeria Spp. Strains Isolated from Meat Products and Meat Production Plants by Multiplex Polymerase Chain Reaction.

Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect six Listeria species (L. grayi, L. welshimeri, L. ivanovii, L. monocytogenes, L. seeligeri, L. innocua) in a single reaction. One hundred eighteen Listeria spp. strains, isolated from meat products (sausages) and processing plants (surfaces in contact and not in contact with meat), were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria. PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth.

Introduction

Human listeriosis is a severe human illness caused by the foodborne pathogen Listeria monocytogenes. Human listeriosis has low prevalence but a fatality rate of 16% (EFSA and ECDC, 2015), and primarily affects children, the elderly, pregnant women and people with compromised immune systems (Rocourt et al., 2000). Symptoms are caused primarily by the ability of the pathogen to survive inside the monocytic cells and to cross the blood-brain and the trans-placental barrier (Vazquez-Boland et al., 2001). In pregnant women L. monocytogenes is generally asymptomatic in the mother but can lead to abortion, stillbirth or a generalized infection, with sepsis or meningitis in the neonate (Allerberger, 2007). In immune-competent people, listeriosis develops as a typical febrile gastroenteritis, while in immune-compromised adults, such as the elderly and patients receiving immunosuppressive agents, listeriosis can manifest as septicaemia or meningoencephalitis (Allerberger and Wagner, 2010).

Different kinds of foods are implicated in the transmission of the pathogen to humans, primarily ready-to-eat foods, such as fermented sausages, ripened soft cheeses, raw and smoked fish (McLauchlin, 1996a, 1996b; Aureli et al., 2000; Gillespie et al., 2006). Between 2004 and 2011, in sardinian sausage production plants, prevalence of L. monocytogenes comprised in a range between 29 and 36.3% were detected in meat samples, of 11% in surfaces not in contact with meat and of 17.4% in surfaces in contact with meat (Meloni et al., 2009; Mureddu et al., 2014).

Although most outbreaks of human listeriosis and 85% of animal cases are caused by L. monocytogenes, several authors reported cases of infection by Listeria seeligeri, Listeria ivanovii and Listeria innocua (Rocourt and Grimont, 1983; Bubert et al., 1999; Johnson et al., 2004; Liu et al., 2004).

Human cases of infection with L. ivanovii are rare and mainly related to immune-compromised patients (Cummins et al., 1994). Rocourt et al. in 1986 reported a case of human listeriosis by L. seeligeri, which caused meningitis in an immunocompromised patient. Finally, a case of fatal bacteremia in a 62 years old patient, caused by L. innocua was reported in 2003 (Perrin et al., 2003).

Clinical manifestations of listeriosis caused by L. monocytogenes and other Listeria species are non-specific. Moreover, L. monocytogenes shows morphological and biochemical similarity with other Listeria species (Vazquez-Boland et al., 2001; Johnson et al., 2004) and the coexistence of various Listeria species in the same food has been reported (Ryu et al., 2013). Considering this, many surveys have shown that the presence of Listeria species different from monocytogenes could conceal the presence of L. monocytogenes, resulting in false negative results (Petran and Swanson, 1993; Curiale and Lewus, 1994; Cornu et al., 2002). Therefore, the development of rapid, specific and sensitive diagnostic tests, for the effective control of the disease would be desirable, in order to distinguish L. monocytogenes from other Listeria species.

The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect 6 Listeria species in a single reaction.

Materials and Methods

Bacterial strains

One hundred eighteen Listeria spp. strains, isolated from meat product and processing plants, were included in the study. Moreover, Listeria species references strains (L. monocytogenes: ATCC 19111; L. seelingeri: ATCC 35967; L. ivanovii: ATCC 19119; L. grayi: ATCC 25401; L. innocua: DSMZ 20649; L. welshimeri: DSMZ 20650) purchased from the American Type Culture Collection (ATCC) and the Leibniz-Institut DSMZ-Deutsche Sammulung von Mikroorganismen und Zellkulturen GmbH (DSMZ), were used. All Listeria strains were cultivated in ALOA (Biolife, Milan, Italy) at 37 °C for 24 h and in Oxford medium (Biolife) at 30°C for 24 h. All isolates with typical Listeria spp. morphological characteristics were submitted to confirmatory tests (Gram stain, catalase and oxidase tests).

Biochemical profile determination

All the strains were submitted to biochemical identification using the API Listeria system (BioMérieux, Marcy l’Etoile, France).

Genomic DNA extraction

Genomic DNA of the bacterial strains was extracted using the Wizard Genomic Purification Kit (Promega Corp., Madison, WI, USA) according to the manufacturer’s instruction.

Multiplex polymerase chain reaction

A multiplex PCR was developed with the aim to identify the six species of Listeria (L. monocytogenes, L. innocua, L. ivanovii, L. grayi, L. seeligeri and L. welshimeri) and Listeria spp., by using the PCR protocol described by Ryu et al. (2013) that has been partially modified in order to obtain the seven differentials bands for each Listeria species in a single reaction. Primers concentrations are reported in Table 1. All amplification reactions were performed in a final volume of 25 µL containing 5 µL of DNA, 5 µL of 10X PCR buffer (JumpStart REDTq DNA Polymerase, Sigma-Aldrich, St. Louis, MO, USA), 4 mM of MgCl2, 0.1 mM each of dNTP, and 2 U of JumpStart RED Taq (Sigma-Aldrich). All amplification reactions were performed in a Gene-Amp 2700 Thermal Cycler (Applied Biosystems, Foster City, CA, USA) programmed as follows: denaturation at 94°C for 5 min, annealing at 58°C for 30 sec and elongation at 72°C for 30 sec, followed by a final extension period at 72°C for 5 min. The amplified fragments were separated by 3% agarose gel electrophoresis (Roche diagnostics, Milan, Italy) in 1X Tris-acetate EDTA (TAE; Invitrogen, Carlsbad, CA, USA) and stained with ethidium bromide (0.1 mg/mL) for 20 min. The gels were observed and the images acquired by the Gel-Doc UV trans-illuminator (Bio-Rad, Hercules, CA, USA).

Table 1.

Primer pairs used for the identification of the six species and Listeria spp.

Species	Gene	Primer	Sequences (5’-3’)	Product (bp)	Primer concentration (mM)
Listeria species	prs	PrsF	GCTGAAGAGATTGCGAAAGAAG	370	0.4
		PrsR	CAAAGAAACCTTGGATTTGCGG
L. grayi	Oxidoreductasi	JOgrayiF	GCGGATAAAGGTGTTCGGGTCAA	201	0.24
		JOgrayiR	ATTTGCTATCGTCCGAGGCTAGG
L. innocua	Lin0464	Lin0464F	CGCATTTATCGCCAAAACTC	749	2.5
		Lin0464R	TCGTGACATAGACGCGATTG
L. ivanovii	namA	Liv22228F	CGAATTCCTTATTCACTTGAGC	463	0.52
		Liv22228R	GGTGCTGCGAACTTAACTCA
L. monocytogenes	Lmo1030	Lmo1030F	GCTTGTATTCACTTGGATTTGTCTGG	509	0.56
		Lmo1030R	ACCATCCGCATATCTCAGCCAACT
L. seelingeri	Lmo0333	IseelinF	GTACCTGCTGGGAGTACATA	673	1.36
		IseelinR	CTGTCTCCATATCCGTACAG
L. welshimeri	scrA	Lwe1801F	CGTGGCACAATAGCAATCTG	281	2.5
		Lwe1801R	GACATGCCTGCTGAACTAGA

L., Listeria.

Results

Table 2 shows the results of the biochemical identification with the API Listeria. Seventy three (61.9%) strains belonged to L. innocua, 26 (22.03%) to L. welshimeri and 9 (7.62%) to L. monocytogenes. For the remaining 10 strains (8.47%) the API Listeria test gave a doubtful identification.

Table 2.

Results of biochemical and molecular identification.

Matrix isolation	Biochemical identification	Molecular identification
Meat product (61)	L. innocua	L. innocua
Meat product (15)	L. welshimeri	L. welshimeri
Meat product (7)	L. monocytogenes	L. monocytogenes
Meat product (2)	L. welshimeri/L. innocua	L. welshimeri
Meat product (1)	L. welshimeri /L. innocua	L. innocua
Meat product (1)	L. welshimeri (doubt)	L. welshimeri
Meat product (1)	L. innocua	L. innocua
Meat product (1)	L. welshimeri (unacceptable)	L. welshimeri
Meat product (1)	L. welshimeri (unacceptable)	L. welshimeri
Meat product (1)	L. welshimeri (doubt)	L. welshimeri
Meat product (1)	L. welshimeri (doubt)	L. welshimeri
Meat product (1)	Listeria monocytogenes (unacceptable)	L. monocytogens
Scm (9)	L. welshimeri	L. welshimeri
Scm (7)	L. innocua	L. innocua
Scm (1)	L. welshimeri L. monocytogens (doubt)	L. welshimeri
Swcm (3)	L. innocua	L. innocua
Swcm (2)	L. welshimeri	L. welshimeri
Swcm (2)	L. monocytogens	L. monocytogens
Swcm (1)	L. innocua	L. innocua

L., listeria; scm, surfaces in contact with meat; swcm, surfaces without contact with meat.

Figure 1 shows multiplex PCR results using six Listeria species. A gel electrophoresis confirmed that all the primer pairs specifically amplified the desired PCR products. This implied that the primers were specific for detection of the Listeria species used in this study and would not exhibit false-positives on account of the PCR reaction. All 114 strains were subjected to analysis by the multiplex PCR, confirming the biochemical identification. PCR allowed to uniquely identifying strains that had expressed a doubtful profile with API Listeria (Table 2).

Figure 1.

Multiplex polymerase chain reaction results using Listeria species type strains. Marker: 100 bp DNA ladder. CN, negative control; 1, Listeria grayi; 2, Listeria welshimeri; 3, Listeria ivanovii; 4, Listeria monocytogenes; 5, Listeria seeligeri; 6, Listeria innocua.

Discussion

Bacteria of genus Listeria are major foodborne pathogens. As said, most of the human infections caused to bacteria of genus Listeria, are due to L. monocytogenes species, but there have been rare cases of infection caused by other species such as L. seeligeri, L. innocua and L. ivanovii (Rocourt et al., 1986; Perrin et al., 2003; Guillet et al., 2010). The coexistence of various species of Listeria in the same food matrix is a very common occurrence (Ryu et al., 2013) and there is often a higher prevalence of Listeria species other than monocytogenes, which further complicates the isolation of L. monocytogenes. Among the various detection methods for foodborne pathogens, the most widely used are the selective media that are able to detect live bacterial cells directly from the food matrix (Gracias and McKillip, 2004). These conventional methods are widely used, especially in the food industry, because of the relatively low cost. However, cultural techniques present several limitations due to the time of analysis, as they require a pre-enrichment for the recovery of damaged cells and subsequently, long incubation times for isolation on selective media. Other limiting factors are represented by the detection of false negative results, but especially by the need of confirmation analysis such as biochemical identification realized with the API Listeria test and that has very high costs (Gracias and McKillip, 2004). To overcome these disadvantages, various molecular techniques have been developed. The availability of a PCR assay species-specific for the target genes is a valuable contribution to the identification of all Listeria species. Furthermore, this method is a rapid and economic alternative for the detection of the different species, and would be useful for the clinical diagnosis of human patients, and also for the food industry. In this study, we applied a multiplex PCR with high sensitivity for the identification of six species of Listeria. The results of the multiplex PCR have shown, in many cases, a higher specificity than biochemical identification. In fact, 8% of the strains analyzed by API Listeria system gave a doubtful result, while the application of the multiplex PCR allowed an unambiguous identification. Furthermore, this molecular assay does not require a colony in purity for the identification of species.

Conclusions

The results suggest that the multiplex PCR applied in our investigation could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in foodborne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth.