Literature DB >> 27775666

Stage-Wise Identification and Analysis of miRNA from Root-Knot Nematode Meloidogyne incognita.

Parthiban Subramanian1, In-Chan Choi2, Vimalraj Mani3,4, Junhyung Park5, Sathiyamoorthy Subramaniyam6, Kang-Hyun Choi7,8, Joon-Soo Sim9, Chang-Muk Lee10, Ja Choon Koo11, Bum-Soo Hahn12.   

Abstract

In this study, we investigated global changes in miRNAs of Meloidogyne incognita throughout its life cycle. Small RNA sequencing resulted in approximately 62, 38, 38, 35, and 39 Mb reads in the egg, J2, J3, J4, and female stages, respectively. Overall, we identified 2724 known and 383 novel miRNAs (read count > 10) from all stages, of which 169 known and 13 novel miRNA were common to all the five stages. Among the stage-specific miRNAs, miR-286 was highly expressed in eggs, miR-2401 in J2, miR-8 and miR-187 in J3, miR-6736 in J4, and miR-17 in the female stages. These miRNAs are reported to be involved in embryo and neural development, muscular function, and control of apoptosis. Cluster analysis indicated the presence of 91 miRNA clusters, of which 36 clusters were novel and identified in this study. Comparison of miRNA families with other nematodes showed 17 families to be commonly absent in animal parasitic nematodes and M. incognita. Validation of 43 predicted common and stage-specific miRNA by quantitative PCR (qPCR) indicated their expression in the nematode. Stage-wise exploration of M. incognita miRNAs has not been carried out before and this work presents information on common and stage-specific miRNAs of the root-knot nematode.

Entities:  

Keywords:  Meloidogyne incognita; microRNA expression; quantitative polymerase chain reaction; stage-specific

Mesh:

Substances:

Year:  2016        PMID: 27775666      PMCID: PMC5085782          DOI: 10.3390/ijms17101758

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

Root-knot nematodes (RKNs) belong to the group of plant-parasitic nematodes (PPN), which are detrimental to diverse plant species [1]. Members of genus Meloidogyne constitute the RKNs, among which Meloidogyne incognita (M. incognita) is an important agricultural pest [2]. The life cycle of this nematode can be divided into five stages beginning with eggs that develop into root-infecting J2 juveniles. Upon invading the host, the J2 worms attach to the root and develop permanent feeding sites. Molting under favorable conditions leads to the formation of sedentary third (J3) and fourth (J4) stage juveniles. In the next stage, mature male and female adults are formed. Male adults, however, are not required for reproduction and saccate female worms produce eggs that hatch to release J2 worms into the soil to continue infecting neighboring plant roots. M. incognita can affect a wide range of hosts and commonly results in stunted plants, loss of vigor, and wilting, symptoms that occur due to the disruption of nutrient and water uptake [1,2]. Conventional control methods against RKNs employ fumigant nematicides and non-fumigant chemicals including carbamates and organophosphates, which are effective but have several drawbacks such as direct environmental pollution, indirect pollution due to mobility from the root zone, and reduction of soil health by adhering to organic matter [3,4]. Currently emerging methods report on the use of RNA interference (RNAi) as an eco-sustainable strategy to control root-knot nematodes from infecting plants. MicroRNAs (miRNAs) are short endogeneous RNA molecules (length ~22 nt) that are involved in the post-transcriptional regulation of genes in living organisms [5]. Since their discovery, a huge amount of research has been carried out on sequencing miRNAs from several organisms including plants, insects, and higher animals. These RNAs do not code for proteins but are involved in the regulation of mRNA by binding to their 3′ untranslated region (UTR) and causing the phenomenon of RNA interference (RNAi) [6]. As mentioned earlier, RNAi has been widely proposed as a potential strategy to control nematodes in plants [7,8,9,10]. Each miRNA contains a “seed sequence” at its 5′ end that aids target recognition and a stem-loop structure for further processing by enzymes Drosha or Dicer to release a precursor miRNA (pre-miRNA), both properties currently used to identify putative miRNAs [11,12]. Although updated miRNA databases contain huge collections of miRNA from viruses, microalgae, worms, flies, and mammals, their expression in cells and the exact targets of several of these miRNAs remain to be validated [12]. The nematode Caenorhabditis elagans provides an excellent model for miRNA-based studies that can be employed to control other parasitic nematodes [13]. Several studies hitherto have been conducted on the development of strategies and identification of miRNA targets to control plant-parasitic nematodes [14,15,16]. In the context of PPNs, the availability of the whole genome sequence of M. incognita [17] has led to several investigations focusing on elucidating potential miRNAs that can be used to control the pest in plants. The currently available literature provides us with information on miRNAs in the egg and J2 stages of M. incognita [15,18]. Comprehensive information on miRNA of M. incognita from all five life stages (egg, J2, J3, J4, and female) would be very useful to understand the physiological processes occurring in the nematode at various stages of its growth and also develop stage-specific markers or control strategies. To our knowledge, stage-wise exploration of miRNAs in M. incognita has not been carried out before and this work presents information on the nematode miRNAs expressed at each stage of its life cycle.

2. Results

2.1. Small RNA Library of Meloidogyne incognita (M. incognita)

A flowchart depicting the course of experiments carried out is given in Figure 1. Following deep sequencing, five sRNA libraries of M. incognita were constructed to cover the developmental stages of the nematode life cycle with their respective high quality reads, namely: egg (61,825,587), J2 (37,460,733), J3 (38,071,041), J4 (34,295,558), and female stage (39,048,713). From the high-quality reads, further exclusion of non-informative sequences based on PHERD quality, adaptor sequences, contaminated sequences, and sequences containing poly(A) tails was carried out to obtain clean reads (18–30 nt) (Table 1).
Figure 1

Flowchart of the miRNA analysis performed in the present study. The encircled numerals (I to V) indicate the order in which the experiments were carried out. The sequencing data from an Ilumina sequencer was used as raw data, which were further cleaned and annotated to segregate as well as identify different types of sRNAs. Known miRNAs were identified using miRBase and identification of novel miRNAs was carried out using MIREAP software, results from both of which were then analyzed to study families, clusters, and the validation of their expression.

Table 1

Statistics of small RNAs obtained from high-throughput sequencing.

TypeEgg%J2%J3%J4%Female%
Total reads62,073,59110037,620,60910038,474,31110034,530,13210039,252,166100
Low quality248,0040.40159,8760.42403,2701.05234,5740.68203,4530.52
High quality61,825,58799.6037,460,73399.5838,071,04198.9534,295,55899.3239,048,71399.48
In high quality reads *
3′ Adapter null36,5440.0627,3880.0776,2700.2029,0370.0832,3000.08
Insert null29,3900.0538,4510.1020,1430.0530,3750.0937,0740.09
5′ Adapter contaminants769,4631.24339,5650.9185,4320.22323,6660.94992,9572.54
<18 bp405,3910.66851,8462.271,438,6453.781,001,2272.92336,0380.86
Poly-A32260.013310.004400.002510.004800.00
Clean reads60,581,57397.9936,203,15296.6436,450,11195.7432,911,00295.9637,649,86496.42

* To proceed with annotation of sRNA the following have to be excluded from the sequencing results: (1) low-quality reads; (2) 5′ adapter contaminants; (3) reads without 3′ primer; (4) reads without the insert tag; (5) reads with poly A; and (6) reads shorter than 18 nt.

As reads from the different stages had varied sequencing depths, we normalized using the DESeq2 package of R to obtain the DESeq2 values. On studying the length distribution of the sRNAs, the most dominant peaks occurred at 22 nt (Figure 2A). The duplicate reads from the clean read data were removed to obtain unique reads, which were also studied. In the case of unique reads, dominant peaks were observed at 23 nt length for all stages of development (Figure 2B). When we mapped the clean and unique reads to the reference genome (ASM18041v1), we found high mapping ratios in clean read from the egg, J2, and female stages, whereas clean reads from the J3 and J4 stages showed low mapping percentages (Table S1). Unique reads showed low mapping ratios in all the developmental stages.
Figure 2

Length distribution of small RNAs at different stages (egg, J2, J3, J4, and female). Frequencies of reads were normalized using DESeq2 to illustrate relative abundances of reads with different lengths under the same scale. (A) Clean reads; (B) unique reads.

2.2. Classification of M. incognita sRNAs

The sRNA sequences were annotated by comparing the sequence results to various databases. Among clean reads, we were able to classify 84.55% of the sequences as mRNA, miRNA, rRNA, repeat, snRNA, snoRNA, and tRNA. The remaining 15.45% remained as unannotated sequences (Figure 3A). In the case of the unique reads, a majority of the sRNAs were observed to be unannotated sequences (58.86%) (Figure 3B). Repeat associated RNAs are given in Figure S1. In terms of miRNA, the distribution was high in clean reads but decreased after removal of duplicates (Figure 3B).
Figure 3

Annotation of small RNAs of M. incognita. (A) Clean reads; (B) unique reads.

2.3. Known and Novel miRNAs of M. incognita

Known and novel miRNA families were predicted using miRBase and MIREAP software, respectively, in comparison with the reference genome (ASM18041v1). We selected sequences with no more than two mismatches and a free gap around the seed region to be considered as a miRNA. Initially, the total number of annotated miRNA families identified were 9325, which were distributed across the egg, J2, J3, J4, and female stages (Table 2). These were considered known miRNAs. On removing duplicates at each stage, we obtained a total of 7627 known miRNA families across all the stages, which were further reduced to 3878 unique miRNA families. Similarly, MIREAP analysis of the unannotated sRNAs indicated 1407 novel miRNAs distributed across all the stages (Table 2 and Table S2). After eliminating duplicate reads we obtained a total of 778 unique novel miRNAs (Table S3). Following this, sequences with a read count above 10 (R > 10) from the unique miRNA reads were listed and re-assorted to combine miRNA subfamilies, which resulted in 2724 known and 383 novel miRNA families (Table 2) (Tables S4 and S5). Highly expressed known miRNA across all stages included miR-58, miR-1c, miR-124b, miR-71, miR-7062, miR-30e, miR-228, miR-100a, miR-6763, let-7, miR-72, miR-425, miR-7904, miR-3526, and miR-716b (Table 3). On studying novel miRNAs, the length of the pre-miRNAs in all the stages of the nematode life cycle was found to occur at a range of 60–109 nucleotides and we observed that the majority of the pre-miRNAs occurred at a range of 80–99 nucleotides (Figure S2). All the predicted novel miRNAs were confirmed with their characteristic stem-loop structures (Figure 4, Supplementary data: Novel miRNA secondary structures). Also, the minimal folding free energy index (MFEI) values were calculated (Table S6). We observed that 41.7% of the sequences (587 reads) had a negative MFEI value of over 0.85, while the remaining 58.2% of the sequences (820 reads) showed values less than 0.85. Highly expressed novel miRNAs at each developmental stage are shown in Table 4.
Table 2

Statistics of miRNA combining all developmental stages.

KnownNovel
Clean DataReassortmentClean DataReassortment
StagesmiRNA Families (R ≥ 3 *)Unique miRNA FamiliesR > 10 #Final UniquemiRNA Candidates (R ≥ 3)Unique miRNA CandidatesR > 10Final Unique
Egg3529297520692724649488378383
J215561221806199131106
J317521091735885559
J4132110357131086353
Female11671305825363250178
Total932576275218 1407987774
Unique 3878 778

* R ≥ 3 read count greater than or equal to 3; # R > 10 read count greater than 10, reassortment-combining repeated subfamilies of miRNA and sequences with high sequence similarity.

Table 3

Highly expressed known miRNA families of Meloidogyne incognita (M. incognita).

miRNA FamilyKnown miRNA IDDESeq2 Normalized ValuesSequence (5′ to 3′)LengthG + C Content
EggJ2J3J4Female
miR-58MI0301822.2218.6516.2417.5020.41TGAGATCAGTCCAGATTCGT2045
miR-1cMI0317121.3319.7316.1513.9617.46TGGAATGTAAAGAAGTATGTAGA2330
miR-124bMI0250020.7418.5814.0313.4312.68TAAGGCACGCGGTGAATGCTGA2255
miR-71MI0295020.5220.7119.5418.7520.06TGAAAGACATGGGTAGTTGAGACG2446
miR-7062MI0303718.1017.6119.1917.9019.27TGAGGACTGCTTGTGGAGTGCT2255
miR-30eMI0161811.7011.1116.2117.5219.57CTTTGATCGGATGATTTGT1937
miR-228MI0037719.3617.8416.9115.9317.17AATGGCACCAAATGAATTCACGG2343
miR-100aMI0016619.2615.3113.2112.8313.64AACCCGTAGATCCGAACTAGTCTT2446
miR-6763MI0336515.0814.9717.5917.8219.24TGGGGAGTTTGGCTGGGGCG2070
let-7MI0305912.4310.6715.7117.9719.02TGAGGTAGTAGGTTGTATAGTT2236
miR-72MI0081918.4816.3212.1112.8413.18AGGCAAGATGTTGGCATTGCTGA2348
miR-425MI0104816.8016.9718.418.7517.29ATCGGGGGTGTCGTAATCTTT2148
miR-7904MI0274318.2715.7315.4017.0115.71TCAAAAATTCCGTTGCGTCGCA2245
miR-3526MI0361415.1616.7617.4418.1317.35TTGAAGACTGAAGTGGAGA1942
miR-716bMI0191615.4616.4417.4617.5417.11GCAGATCTTGGTGGTAGTAGCAAAT2544

Table shows highly expressed known miRNA across all stages. Read counts from the sequencing data were normalized to obtain DESeq2 values.

Figure 4

Pre-miRNA structure prediction of novel miRNAs from each stage of the M. incognita life cycle. Figures show structures, free energy values, and stem-loop structures for selected novel miRNAs.

Table 4

Novel miRNA identification using MIREAP to distinguish pre miRNA among unannotated sRNA.

IDRead CountmiRNA Precursor Sequence (5′ to 3′)Seq LengthA%T%G%C%(A + T)%(G + C)%MFEI
Mi-egg-m0251485,952CAAACAAAGGACGAATCGTTTGCACATCGGTGTTTTTATGTTATCGCAAAACATCGATATGCAGGTTCGCCCTTTTTTGATT8226.834.119.519.561.039.0−0.92
Mi-egg-m019112,935TTGACAAAAAAACTTACGGACATATTTTTGCGGGAGGATGGAGAGGTATAGAGTCCGCAAAATCTGTCCGCAAGTCGCTGTCTGTCCG8828.425.027.319.353.446.6−0.66
Mi-egg-m04628712TGTCACCGTCCAAATTACATTCCTGTCCAAATCAATTTTGCCGGCCGAATTATATTTGGACAAGAATGTAATTTGGACGGTGACATT8728.732.218.420.760.939.1−1.49
Mi-egg-m00038299ATTGATCCGCACTTGTAGTGGTGTAAGCTTGTTTTGTAAAAGCAATTTTGTTGCGCCCAGGCAAATAAGCTCGCTTCTACAGGCGTGGGTCTTC9421.333.025.520.254.345.7−0.91
Mi-egg-m00893922TTTCCGTACTTGGCTCAAAGTTGGACAATTTATATGTTAATCGAAAGAGCTCGTTGATAAATTGTCCATTTTTGAACCAATTACGGAAAGT9130.835.218.715.465.934.1−1.29
Mi-J2-1-m01967496CTCGTCTAGCCGACTCTGTTGGTTGTAGGTGTTTTTTGAAAAAATTAATCATCACAACCCCCTAGAGTTCGCTAGGTGGAAAATG8525.931.822.420.057.642.4−0.82
Mi-J2-1-m01235502ATAGCCGATCGTTTGGGTTGATGATACGAACAATTGACCTACACCTTGCTGTGACAACATGTTCTTGATCGTTGACGCAACCACCTTGAGTAAC9426.628.721.323.455.344.7−0.45
Mi-J2-1-m01951377ACGCGCCGCCTGCTCCGGCATTTCTCTCGCTAGGGCCCTTGCGATAGATAGTTGGCTGTTTCGGTTATGGCAGTC7512.029.329.329.341.358.7−0.54
Mi-J2-1-m0093898GATTGCGACCAGGCGTCGTCTCCGGCGGTTTCGAGTTAACAGTAAAAGCTGAAGCCGTAGGAGACGTCGTTAGGTTGCCTTCTC8420.225.031.023.845.254.8−0.99
Mi-J2-1-m0041888CTTCGAGGCGGAATCCGGCTATCAATTCGCGCGGTTCCCCGTCCACAAGATTGCGAAGCAAAGTGAGTTTCTCGATGTCGGACCCTGAACTCGAGT9621.922.927.128.144.855.2−0.57
Mi-J3-m0081272CCATATGTTCAGGCTGAAGCGTTTTGGAATATTCTGCGCCAATTTAAAAAACAGAGCAATATTGCACTCGTTTCGGCCTGAGCTTTGGT8925.831.522.520.257.342.7−0.92
Mi-J3-m0062182TTTAATTAAAGAGCAATGAAGAAATATTTGACTAGAGTCTCAGAAAAATAATTTTGTTGAAAATTTTAAAGTCGGAGCTCTTTGAAAAGAT9141.833.017.67.774.725.3−0.80
Mi-J3-m0040110TAGTTCTTGGATGGGTGTGCCTCTCCAGTCGTGTTTTTGGCCTAGTGCCACTATTTGGCTCATGACTAGATCCACACTCATCTAAGCACTT9117.635.222.025.352.747.3−0.89
Mi-J3-m0036100TCCATGTTTTGACTGACCGTGTCTGTCCGTGTTTTGATGGCTCTTCAGGCAAAACGCGGACAGACACGGCCAGTCAAAACACGG8422.625.026.226.247.652.4−1.29
Mi-J3-m000582TCCACAATTTTTCCACAGCATGAACATCGGACATGACAAATATTGAAGTGTCCGATGTTCATGCTTAGGAATTATTGTGGAA8231.730.519.518.362.237.8−1.58
Mi-J4-m01001385CCTTATTCCGTGGGGACTTTACATTGTGCAGCGTTAATATTTTTGGTGTACTTTTTGACATCATCGTTGCACATGTTTAGGCCCATCGGAAGATGGT9719.638.123.718.657.742.3−0.92
Mi-J4-m0006704ATTCTCGTCTAGCCGACTCTGTTGGTTGTAGGTGTTTTTAAAAATAATCATCACAACCCCCTAGAGTTCGCTAGGTGGAAAATG8426.232.121.420.258.341.7−0.88
Mi-J4-m0048475TTAGTCGTTTACCCTGTAGTCCCGAGCCGTTTGAGAGAGACGTTACTTAAAACGTTGTTTGAAACCAAACGGAACTCGAGATGGGGAAGACGATTAGAAA10031.025.026.018.056.044.0−0.83
Mi-J4-m0102475ATTTTTAGTCGTTTACCCTGTAGTCCCGAGCCGTTTGAGACTATAAAACGTTGTTTGAAACCAAACGGAACTCGAGATGGGGAAGACGATTGAAAA9631.327.124.017.758.341.7−0.84
Mi-J4-m0079158GCAGGAGGACGGGGTCTGGCTTGGTTCTCATCTAGTATATACTTAGAAAACTGATGAGATCATACCAGATCACATTCGCTTGTTA8527.129.424.718.856.543.5−0.82
Mi-Female-m02122151CCCCGTATCTTTGGCCCTCGCGAATCCTTTTTAGGTGGCTTAATTATTAACAGCCAATCATGTGCAGGGATGGCCGAGCGGTCTAAGGCGCCAGA9521.126.326.326.347.452.6−0.56
Mi-Female-m02861358CATTTCGAGTTGAGATTTCTAATGAGCATTGTACGCCGCTAGTGAGACAGAAATTGTTTTATGTAAAATGCCCCTCTGAAATCTCAACTCGATTTTGT9827.634.719.418.462.237.8−0.91
Mi-Female-m02211122TTATGTGTATGTTGAGGTAGTAGGTTGTATAGTTAAAGAACAGTATCAGTCGGAGTAACTAACGCAGCCTGCTCACTCGGCAATCACATTC9128.629.724.217.658.241.8−0.87
Mi-Female-m0142457ATTGAAATGAGCGGTCGTGTCCGAGTGGTTAAGGAGATTGACTCGAAATCAATTGGGCTCTGCCCGCACAGGTTCGAA7825.624.430.819.250.050.0−0.65
MI-Female-m0140300GACAATCTTTGATTGATCGTCCTGACATTGTCATGCGGTTTTACGCTGACAAAGTTAGGGAGGTACACAAGGACTTGAA7927.8292517.757.043.04−0.93

Id—miRNA identity, Seq length—sequence length, MFEI—minimal folding free energy index. Five highly expressed novel miRNA from each stage were taken and shown here to explain the processing of novel miRNAs.

Among novel miRNAs, the highly expressed families across the developmental stages of M. incognita are mentioned in Table 5. Studying the dominance of nucleotide bases at the first and ninth positions among the miRNAs shows that U and A were the preferred bases at these positions (Figure 5). Among the known miRNAs, the preferred first nucleotide base was U (57.47%), and at the ninth position A was found to be dominant (47.52%) (Figure 5A). In the case of novel miRNAs predicted using MIREAP software, the base A was found to be preferred at the first position (82.81%) and the ninth position was dominated by U (83.65%) (Figure 5B).
Table 5

Highly expressed novel miRNA across all stages of the nematode life cycle.

miRNA IDDESeq2 Normalized ValuesSequence (5′ to 3′)LengthG + C Content (%)
EggJ2J3J4Female
MIN0028411.4013.6012.1711.859.34TCACAACCCCCTAGAGTTCGCTAG2454
MIN0033311.318.5011.8711.8811.71TGGGGACTTTACATTGTGCAGCG2352
MIN000799.359.5911.1611.018.31AGGCTGAAGCGTTTTGGAATATT2339
MIN0001810.3010.209.909.3611.61AACTTACGGACATATTTTTGCG2236
MIN0030810.338.126.548.366.54TGAGATCATACCAGATCACAT2138
MIN000539.679.429.629.659.62ACTTGTAGTGGTGTAAGCTTGTT2339
MIN000759.569.567.887.857.81AGGCGTCGTCTCCGGCGGTTTC2268
MIN003758.718.287.257.259.81TTTGGACAAGAATGTAATTTGGA2330
MIN000157.819.098.697.928.92AACGCGGACAGACACGGCCAGT2264
MIN003217.238.408.036.536.91TGCGGACATGTGGAGGACGAGC2264

Table shows highly expressed novel miRNA families across all the stages of the M. incognita life cycle. Read counts from sequencing data were compared and normalized to obtain the DESeq2 values.

Figure 5

Nucleotide bias at each nucleotide position of known and novel miRNA of all developmental stages combined. (A) Known miRNA from annotation aligned to the miRNA precursor/mature miRNA in miRBase (allowing two mismatches and free gaps); (B) novel miRNAs predicted from the unannotated small RNAs using MIREAP software (Read ≥ 3).

Comparison of miRNA families conserved in other nematodes was tabulated (Table 6). We found that among the compared nematodes, which contain pathogens and free-living nematodes, miRNA families miR-266, miR-2208, miR-2209, and miR-5593 were conserved only in M. incoginta and C. elegans. The miRNA families that were absent in M. incognita were miR-52, miR-59, miR-62, miR-237, miR-245, miR-258, miR-259, miR-354, miR-355, miR-356, miR-358, miR-786, miR-789, miR-791, miR-1829, miR-4922, and miR-5592. These miRNAs were also found to be absent in the other parasitic nematodes Brugia malayi, Ascaris suum, and Haemonchus contortus. However, they are present in several species of Caenorhabditis (Table 6).
Table 6

Comparison of conserved miRNA families among other nematode species.

miRNA FamilyMeloidogyne incognita (This Study)Free-Living NematodesParasitic Nematodes
C. brenneriC. briggsaeC. elegansC. remaneiPanagrellus redivivusPristionchus pacificusAscaris suumBrugia malayiHaemonchus contortus
let-7++++++++
lin-4+++++++
miR-1+++++++++
lsy-6+++
miR-2++++++++
miR-34++++++++
miR-35+++
miR-36++++++++
miR-39+++++
miR-42++++
miR-43+++++
miR-44+++++++++
miR-46++++++++++
miR-48+++++
miR-49+++++
miR-50++++++++
miR-51+++++
miR-52++++
miR-54++++
miR-55++++
miR-56+++
miR-57+++++++
miR-58+++++
miR-59+++
miR-60++++++
miR-61+++++
miR-62++++
miR-63+++++
miR-64+++
miR-67++++++
miR-70+++
miR-71+++++++++
miR-72++++++++++
miR-73+++++
miR-74+++++
miR-75+++++
miR-76++++
miR-77+++++
miR-9++++++++++
miR-80+++++
miR-81++++++
miR-83+++++++
miR-84+++++++
miR-85+++++
miR-86++++++++++
miR-87++++++++++
miR-90+++++
miR-124++++++++++
miR-228+++++
miR-230++++
miR-231+++++
miR-232+++++
miR-233+++++
miR-234+++++++++
miR-235++++
miR-236+++++++++
miR-237+++
miR-238++++
miR-239++++++++
miR-240+++
miR-241+++++
miR-242++++
miR-244+++++
miR-245++++
miR-246+++++
miR-247+++
miR-248++++
miR-249++++
miR-250+++++
miR-251+++++
miR-252+++++++++
miR-253++++
miR-254+++++
miR-255+++++
miR-258+
miR-259+++
miR-266++
miR-268++++
miR-353+++
miR-354++
miR-355++++
miR-356+++
miR-357+++++
miR-358++
miR-359+++
miR-360+++++
miR-392+++
miR-785++++
miR-786+++
miR-787+++
miR-788+++
miR-789++
miR-790+++++
miR-791++
miR-1822+++++
miR-1829+
miR-2208++
miR-2209++
miR-2214+++
miR-4922+
miR-5592+
miR-5593++

C.—Caenorhabdits. The information was tabulated from results of the BGI (Beijing Genome Institute, Beijing, China) sequencing report. The data for comparison for miRNA families were obtained from miRNA database miRBase version 18.

Cluster analysis showed that 91 clusters at a threshold of 2000 bp and each cluster contained a minimum of one miRNA family and a maximum of six miRNA families (Table S7). Six clusters that have been previously reported in M. incognita in other studies were confirmed in our analysis. We identified 36 novel clusters located across the M. incognita genome that were constituted by novel miRNA families (Table 7). These clusters have not been reported in any other organism, including other nematodes. Further, we identified 45 clusters that contained previously identified miRNAs and novel miRNA families. Eight clusters (in contigs MiV1ctg164, MiV1ctg192, MiV1ctg237, MiV1ctg268, MiV1ctg342, MiV1ctg430, MiV1ctg516, and MiV1ctg78) that have already been reported in other organisms were also found (Table S7). Mapping of the miRNAs revealed that 2147 known and 464 novel miRNAs could be mapped to the reference genome (ASM18041v1a). These miRNAs were distributed among exons, introns, and intergenic regions but were absent in both untranslated regions (3′ and 5′ UTRs) (Table S8).
Table 7

Novel miRNA clusters of M. incognita found in our study.

ContigStartEndStrandCluster
MiV1ctg1228,236228,259+MIN0559
228,430228,451MIN0402
MiV1ctg103108,004108,026MIN0712
108,057108,078+MIN0565
MiV1ctg105819,24919,270+MIN0362
19,96819,989+MIN0509
MiV1ctg114342364257+MIN0626
43484370+MIN0676
MiV1ctg12259,16459,186+MIN0138
60,88960,909MIN0010
MiV1ctg13112,247112,270MIN0353
112,331112,353MIN0180
MiV1ctg15181,93781,960MIN0158
83,47283,493+MIN0419
MiV1ctg15569,67669,699+MIN0455
69,82669,849+MIN0352
MiV1ctg16244,78044,801MIN0719
44,83244,854+MIN0199
MiV1ctg17264,11764,138MIN0030
64,84264,863+MIN0040
MiV1ctg18162,26562,286MIN0552
MiV1ctg2111,341111,363MIN0017
111,800111,822+MIN0092
MiV1ctg20924,05524,076+MIN0277
24,89824,921MIN0517
MiV1ctg209924752497MIN0509
32343255MIN0362
MiV1ctg22066,96666,988+MIN0591
MiV1ctg286519361958+MIN0631
19892011MIN0630
19912013+MIN0020
MiV1ctg31045,46645,593MIN0751
MiV1ctg34630,08130,101+MIN0007
31,74231,765+MIN0472
MiV1ctg38443,58543,606MIN0040
44,31044,331+MIN0030
MiV1ctg38753,73853,760+MIN0017
53,85653,878MIN0092
MiV1ctg39426,27226,294+MIN0636
26,29526,318MIN0480
26,36126,383MIN0319
28,32528,347MIN0665
MiV1ctg42107,915107,937MIN0188
108,677108,700MIN0198
MiV1ctg47170,763170,784MIN0682
171,345171,365MIN0358
MiV1ctg54711,74711,769MIN0398
12,36712,389+MIN0114
MiV1ctg55434,72234,743+MIN0058
35,93335,954MIN0645
MiV1ctg61419,08619,108+MIN0770
19,13819,159MIN0237
MiV1ctg63837,46937,618+MIN0720
MiV1ctg65532,12032,142+MIN0570
32,90432,924+MIN0155
MiV1ctg68733,20433,226MIN0638
33,41833,440MIN0086
MiV1ctg7176,234176,254+MIN0227
177,333177,354+MIN0567
MiV1ctg72622,61122,634MIN0351
24,14424,166MIN0180
MiV1ctg75109,253109,276+MIN0455
109,403109,426+MIN0352
MiV1ctg78116,03316,052+MIN0173
MiV1ctg87610,11110,133+MIN0501
11,79111,814+MIN0634
MiV1ctg88912,20912,232MIN0116
MiV1ctg9133,529133,550+MIN0594
133,572133,593MIN0672
134,249134,271MIN0371

This table represents 36 novel clusters among the 91 clusters located across the M. incognita genome identified in the present study.

2.4. Stage-Specific Expression of M. incognita miRNA

Studying the stage-wise expression showed that among the known miRNAs, 169 families were commonly expressed across all stages (Table S9; Figure 6). Stage-specific known miRNAs were also observed: the egg stage had the maximum number of stage-specific miRNAs (1122 families), followed by the female stage, which showed 174 stage-specific miRNAs (Figure 6A) (Table S10). On studying the highly shared miRNAs between two stages, we found 128 miRNAs to be expressed both in the egg and female stages, followed by 112 miRNAs being expressed in the egg as well as the J2 stage. The least number of commonly expressed miRNAs among the stages were observed in J2, J3, and J4 stages (miR-1718, miR-3654, miR-622, miR-6883, miR-7631, and miR-7930) and, similarly, six miRNAs were commonly expressed across the J2, J3, and female stages (miR-1268, miR-1728, miR-199a, miR-3095, miR-4037, and miR-4534).
Figure 6

Distribution of miRNA expression across stages of the M. incognita life cycle. (A) Known miRNA (2724); and (B) novel miRNA (383).

Among the novel miRNA, 13 families (MIN00015, MIN00018, MIN00053, MIN00068, MIN00075, MIN00079, MIN00113, MIN00131, MIN00284, MIN00308, MIN00321, MIN00333, and MIN00375) were commonly expressed in all stages (Figure 6B). The maximum number of stage-specific miRNA families was found in the egg stage, which was also the case in the known miRNAs. Stages J3 and J4 had the least number of specific novel miRNAs (Figure 6B). Similar to the known miRNAs, the highest number of shared miRNAs between two stages was found to be between the egg and female stages (14 miRNAs). Also, the second highest number of shared miRNAs was found to between the egg and J2 stages (13 miRNAs). This trend is similar for both known as well as novel miRNAs: a high number of miRNAs are shared between the egg and female stages in addition to the egg and J2 stages. The most highly expressed known miRNAs specific to each stage are miR-286, miR-2401, miR-8, miR-6736, and miR-17 in the egg, J2, J3, J4, and female stages, respectively. In the case of novel miRNA, MIN00001, MIN00016, MIN00005, MIN00022, and MIN00021 showed the highest expression in the egg, J2, J3, J4, and female stages, respectively (Table 8 and Table S10).
Table 8

Highly expressed stage-specific miRNAs of M. incognita.

miRNAStagemiRNASequences (5′ to 3′)Read Count
Known miRNAEggmiR-286TGACTAGACAAACAACTCGTGT137,573
J2miR-2401AGAGTTTGACTAGGGCGG122,762
J3miR-8TAATAATGTAGGTAATGGAAGTCG140,213
J4miR-6736CTGGGGCGGCACATCTGTGGT107,793
FemalemiR-17ACTAGCAGTGAGGACTGCTTGTGG107,167
Novel miRNAEggMIN00001AAAAACAGCTGAGTACTTGTCG80
J2MIN00016AACGGAACTCGAGATGGGGAAG116
J3MIN00005AAAATTTTAAAGTCGGAGCTCT131
J4MIN00022AAGGAAATTGGATGCCGGCATT12
FemaleMIN00021AAGCTTCCCAGTGGCGGAGTCG244
Expression patterns of known and novel miRNA were illustrated using heatmap and hierarchical clustering. In both known and novel miRNA expression, we found the egg stage to have the highest number of stage-specific miRNAs (Figure 7). In the case of known miRNAs, we observed clustering of the J3 and J4 as well as the J2 and female stages to form two subclades. The egg stage formed a different clade and was far from the expression profiles of the other stages (Figure 7A). Among novel miRNAs, primary clustering was also between the J3 and J4 stages. The female stage miRNA expression profile was the most distant compared to the other stages (Figure 7B).
Figure 7

Heat map for the DESeq2-normalized expression profiles of known and novel miRNA families in five developmental stages. (A) Known miRNA; (B) novel miRNA. In both cases, sequences with R > 10 were selected for normalization. The heatmap of the normalized data (Tables S11 and S12) was drawn using MeV (v4.8.1) Pearson correlation applied for clustering. The TreeView tool was used to improve the figure clarity.

2.5. In Vitro Confirmation of Specific miRNA Expression

High-throughput sequencing results of miRNA represented as read counts were normalized by DESeq2 normalization and normalized values were taken as a measure of miRNA expression level. Of the three commonly expressed miRNA candidates for internal standards, we observed similar expression patterns during qPCR studies (Figure S3). Upon experimental verification using quantitative PCR, we observed that all the chosen miRNAs were expressed in the nematode. Expression profiles of the 40 miRNAs were consistent when we compared expression with internal standards MI03018 and MI02743. On studying stage specificity, four of 10 miRNAs in the egg, three of nine in J2, all five in J3, and one of nine miRNAs in female were found to show specific expression (Figure S4). We were unable to detect any stage-specific miRNAs in the J4 stage from the stage-specific miRNAs selected from our sequencing data. During our experimental validation, few miRNAs were putatively known to be stage-specific; they also exhibited expression in other stages. However, their expression was highest in the stages at which they were characterized to be stage-specific by high-throughput sequencing data. A set of the selected stage-specific miRNA, their sequencing, and the qPCR results are shown in Figure 8.
Figure 8

Validation of sequencing and real-time expression of stage-specific miRNAs. (A) Expression profiles of selected known and novel stage specific miRNA from high-throughput sequencing data. The normalized values of the stage-specific miRNAs are given at the top of the columns. Columns with DESeq2 values not mentioned had a normalized score of 0.1 to 1.6; (B) relative expression levels of known and novel miRNA studied using qPCR. The miRNA MI03018 (miR-58) was used as an internal standard.

3. Discussion

Reports on the sRNAs in M. incognita are currently emerging that indicate its importance as a plant parasitic nematode, and this report aims to study the stage-wise expression of miRNA across various stages of its development. This is the first summary of information on its sRNA across all stages and can serve as a potential resource for miRNA-mediated control studies on M. incognita in the future. Reports of miRNA-mediated regulation of C. elegans genes across developmental stages are available that can provide a model for other nematodes [13,19,20]. However, a comprehensive report on miRNAs from plant parasitic nematodes such as M. incognita can be helpful to identify and study the regulation of plant parasitism-related genes in nematodes. Earlier studies in miRNA from M. incognita provide an excellent model to identify and study miRNAs of the RKN but are limited by the stages covered across the nematode life cycle [15,18]. In the present study, we sequenced small RNAs from all five stages of the M. incognita life cycle. During our analysis, preliminary mapping of known sequence reads showed a high percentage of mapping that was greatly reduced when unique sequences were mapped to the genome. This was also observed earlier and reported by Wang and coworkers, who explained genetic polymorphisms, the incompleteness of the genome, and sequencing errors as reasons for the phenomenon [15]. In our results, more than 95% of clean reads obtained from sequencing were longer than 18 nt. In general, the majority of the sRNAs range from 21 to 24 nt in size—information that is particularly helpful during initial predictions [17]. Also, an sRNA length of 23 nt was found to be dominant in unique sequence reads, which is consistent with earlier reports on M. incognita sRNAs [15]. Moreover, we observed that miRNAs and unannotated RNAs were the dominant classes of sRNAs, as also observed in a previous study involving sRNAs from the J2 stage of the nematode M. incognita [15]. A total of 9325 known microRNA families and 1407 novel families (read count > 3) were identified in our study. In both cases, the egg stage contributed to the highest amount of microRNAs (known—37.8%; novel—46.1%). Highly expressed known miRNA families include miR-58, miR-1c, miR-124b, miR-71, miR-7062, miR-30e, miR-228, miR-100a, miR-6763, and let-7. Although the exact function of these miRNAs in the M. incognita metabolism remains to be studied, we found reports on the probable function of these miRNAs in other species. The microRNA miR-1 has been known to target heat shock protein HSP60, causing glucose-mediated apoptosis in cardiac muscle cells [21]. miR-124 has been reported to be expressed in neuronal cells and target anti-neural function protein SCP1 and splicing repressor PTBP1 [22,23]. In the case of miR-30, the targets include an integrin ITGB3, ubiquitin-conjugating E2 enzyme UBC9, and tumor protein p53 [24,25]. The microRNA families miR-58 and miR-71 have been extensively reported in Caenorhabditis elegans, where miR-58 has been found to regulate the Transforming Growth Factor (TGF) pathway [26,27], and miR-71 functions in the control of aging in the model nematode [28]. Cluster analysis showed that the miRNA families, both known and novel, were localized to 91 clusters in the genome of M. incognita, where each cluster contained at least one gene of miRNA. We were able to confirm all clusters previously reported in M. incognita [15] except for the novel cluster consisting of NOVEL-1-1/NOVEL-39. Several of the clusters have also been found in other organisms, including Drosophila, mouse, other nematodes, and mammals (Table S7). MicroRNA families from C. remanei (miR-239b), Brugia malayi (miR-228), and Ascaris suum (miR-234) have hitherto not been reported in M. incoginta but reported in other nematodes (Table 6). We were able to map 2147 known and 464 novel miRNA to scaffold assembly set sequences (ASM18041v1a) of M. incognita. Mapping the microRNAs from several organisms showed that they are widely found to originate from the intergenic region or introns [26,29]. Our mapping data also show that our miRNAs were localized to introns and intergenic regions. The number of known as well as novel miRNA in the present study were higher than the number of miRNAs predicted from M. incognita based from prior studies [15,30]. This is because earlier reports used no mismatches and gaps as conditions for miRNA prediction. However, in our study, we matched sequences with no more than two mismatches and free gaps around the seed region to be considered as candidate miRNAs. This is because, as explained earlier, the available genome data is a draft genome and may not be perfect. Our conditions helped to identify a high number of probable miRNA candidates that may have been lost by the stringent conditions used in the prior studies. MIREAP makes use of the sRNA secondary structure, dicer cleavage site, and the minimum free energy to predict novel miRNAs. Candidate novel miRNAs must satisfy two major criteria, namely the presence of a ∼22-nt miRNA sequence contained in one arm of the hairpin, which forms a fold-back precursor structure, and conservation of that ∼22-nt miRNA sequence as well as its secondary structure. Further, we also used the minimal free folding energy index (MFEI) values to confirm the pre-miRNA sequences [30]. In our studies, 41.7% of the novel miRNAs had negative MFEI values of over 0.85. The range of MFEI values for M. incognita miRNAs was reported to be 0.38 to 2.4 [18]. In our study, the average MFEI value was found to be 0.87, which suggests that the majority of the predicted novel miRNA are valid as miRNAs. Results of prior studies also showed miRNAs with MFEI values less than 0.85 [18]. The first nucleotide position of the known and novel mature miRNAs in the present study was found to be dominated by A and U. This is a ubiquitous phenomenon observed in miRNA studies [15,18,31,32]. This can also be taken as a putative marker for confirmation of sRNA sequences as miRNAs, and our results are also in accordance with previous reports. Among the stage-specific miRNAs, known miRNAs specific to the egg stage include miR-286, which is highly specific to the embryo stages of Drosophila melanogaster [33] (Table 8). Other stage-specific miRNA families in the egg stage include miR-493, which is involved in the inhibition of liver metastasis in the mouse, and miR-27, which regulates cholesterol homeostasis and fatty acid metabolism [34,35]. Specific miRNA families from the J2 stage include miR-2401, miR-4451, and miR-2a, which have been reported to be synthesized by bovine animals in response to viral infection, occurring in normal and malignant human B cells, and involved in the repression of Drosophila pro-apoptotic factors, respectively [36,37,38]. In the J3 stage, specific miRNAs included miR-8 and miR-187, which are involved in the regulation of atrophin and the control of ovarian cancer, respectively [39,40]. Highly expressed specific miRNA families in the J4 stage included miR-6736, miR-2072-3, miR-7348, miR-2032a, and miR-2163. Specific miRNA families in the female stage are miR-17 and miR-3180, which are involved in cancers, and miR-133, which is reported to be expressed in muscle tissues [41,42,43]. Quantitative analysis of expression using PCR showed that the stage-specific miRNAs observed in the sequencing based studies were truly expressed in the nematode. We were able to confirm that these miRNAs were authentic and 14 of the 40 known and novel miRNAs in the egg, J2, J3, J4, and female exhibited stage-specific high expression patterns in both sequencing reads and quantitative PCR analyses. However, though the stage-specific miRNA candidate from the J4 stage was highly expressed in quantitative analyses, its expression was found to be high in the J3 stage when studied using PCR. Also, a few miRNAs that were shown to be stage-specific in digital expression studies were found to be expressed in other stages also, albeit in much lower quantities. Among the stage-specific known microRNAs taken for validation, MI01348 has been reported earlier in humans [44,45]. Other known stage-specific microRNAs were reported to be expressed in the mouse (MI02073), the chicken (MI00131), and chordate and cnidarian species (MI01064) [44,46,47,48]. However, the functions of these microRNAs in M. incognita remain to be elucidated and hitherto are only collected in an miRNA database—miRBase. In summary, through the present study, we have tried to amend the available data on M. incognita miRNAs to include miRNAs from all stages of development. This information can be very useful for any studies on the stage-specific control of the nematode or stage-specific functions in the future.

4. Materials and Methods

4.1. Sample Preparation

The nematode M. incognita was maintained in RKN-susceptible tomato plant roots (Solanum lycopersicum var. Rutgers) in a greenhouse at 25 °C. A fresh batch of plants was prepared for collection of M. incognita at various stages. Nematode samples were collected quickly at each developmental stage, i.e., egg, J2, J3, J4, and female, and snap frozen using liquid nitrogen, followed by temporary storage at −70 °C. Total RNA from each sample was extracted using CoreZol reagent (Corebio, Seoul, Korea) as per the manufacturer′s instructions.

4.2. Small RNA Library Construction

A flowchart depicting the flow of experiments carried out is explained in the abstract graphic. Isolation of small RNAs and library construction were performed as described by [49]. In brief, from the isolated total RNA, nucleotides of length 18–30 bp were obtained by gel separation and the purified short nucleotide RNA sequences were ligated with 3′ adapter 6–20 nt and 5′ adapter 12–25 nt at both ends, which was followed by purification according to the manufacturer’s protocol (T4 RNA Ligase, 200 U, 30 U/µL, Takara: D2050, Seoul, Korea). Ligated small RNAs were reverse transcribed with the complimentary sequence of 3′ adaptor (SuperScriptH III Reverse Transcriptase, Invitrogen: 18064-014, Carlsbad, CA, USA), and amplified. Finally, the PCR amplification products were sequenced at BGI (Beijing Genome Institute, Beijing, China) using Illumina HiSeq 2000 (Illumina Inc., San Diego, CA, USA) [50].

4.3. Annotation of M. incognita sRNAs

The software developed and provided by BGI was used to profile the data from high-throughput sequencing. After obtaining the FASTQ format files, the data were processed as per the following steps: (1) exclusion of low quality reads; (2) elimination of reads with 5′ primer contaminants; (3) elimination of reads without 3′ primer; (4) removal of reads without the insert tag; (5) removal of reads containing poly A and (6) elimination of reads shorter than 18 nt. The final clean reads were obtained and their length distribution was summarized. These clean read raw data are available at National Center for Biotechnology Information-Sequence Read Archive (NCBI-SRA) with accession numbers SRP076824, SRP077023, SRP077024, SRP077025, and SRP077026. In the present study, two versions of the reference genome were used, i.e., the Contig assembly sequence set (ASM18041v1) from NCBI was used for annotation and miRNA prediction, whereas scaffold assembly set sequences (ASM18041v1a) from the WormBase database (Available online: http://www.wormbase.org/) were used for miRNA mapping. Clean reads of length ranging from 18 to 30 nt were analyzed to classify the small RNAs. First, the purified tags from the short clean reads were compared to the M. incognita genome sequence from NCBI (ASM18041v1). To find repeat associated RNA, small RNA tags were aligned to the reference genome using tag2repeat (BGI). The ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), and transfer RNA (tRAN) were identified by Basic Local Alignment Search Tool (BLAST-NCBI) against the Genbank and Rfam databases. Small RNA tags were aligned to the reference genome, particularly the gene co-ordinates (exons and introns), to find the degraded fragments of mRNA by BGI-overlap software (Genome Institute, Beijing, China). To make every unique small RNA is mapped to only one annotation, the classification was followed by BGI small RNA pipeline (tag2annotation-BGI) such as rRNA, small cytoplasmic RNA (scRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), tRNA, repeat sequences, and degradation mRNA, i.e., exons (sense and antisense) and introns (sense and antisense); the remaining reads were classified as unannotated small RNAs.

4.4. M. incognita miRNA Analysis

Known miRNAs were identified by matching the sRNAs to miRBase (v. 18) animal mature miRNA database using Tag2miRNA (BGI). Matched sequences with no more than two mismatches and two gaps around the seed region were considered as candidate conserved miRNAs (mismatches ≤ 2, and gaps ≤ 2 around the seed region). A small RNA around the location of an annotated pre-miRNA had at least 16 nt overlap, aligning to known miRNAs in miRBase. Also, they were aligned to the pre-miRNA and mature miRNA of all plants and animals in miRNAs, allowing two mismatches and free gaps. Any candidate small RNA sequence with more than three reads was considered a reliable representation of a miRNA molecule. Unannotated sRNAs that did not belong to any class of RNA but could be aligned to the reference genome were subjected to novel miRNA prediction using MIREAP software (Available online: http://sourceforge.net/projects/mireap) with default parameters. Candidate novel miRNAs satisfying two major criteria, namely presence of a ~22-nt miRNA sequence contained in one arm of the hairpin which when predicted forms a fold-back precursor structure and conservation of that ~22-nt miRNA sequence and its secondary structure were selected. The number of mature miRNAs with predicted hairpin was not less than five in the alignment result. Secondary structures of the miRNAs were confirmed for the presence of stem-loop structure. Pre-miRNA sequences from MIREAP results were used to calculate the minimal folding energy index (MFEI) [30]. The family distribution of the miRNAs and their nucleotide bias were obtained statistically to reduce any bias in the expression and coding of the miRNAs. For cluster analysis, miRNAs were grouped into clusters if they were located within a 2000 bp threshold in the genome during mapping [15]. Known and novel miRNAs with a read count >10 were mapped with reference to the M. incognita genome assembly database (ASM18041v1a; WormBase) to study their location in the genome. Stage-specific miRNAs (read count ≥ 3) were normalized using the DESeq2 package [51]. The DESeq2 normalized values of the miRNAs were taken as an estimation of the specific miRNA expression. For experimental validation we chose 40 stage-specific miRNAs combining all stages and three commonly expressed miRNAs as candidates for internal standards (Tables S13 and S14).

4.5. Experimental Validation of M. incognita miRNA Expression

Quantitative PCR analysis was used to experimentally validate the expression of miRNAs. Samples of the nematode M. incognita were taken at different developmental stages (egg, J2, J3, J4, and female) and used to isolate total RNA. Nematodes of each developmental stage were carefully collected and total RNA was extracted, followed by storage at −70 °C. Synthesis of cDNA from total RNA samples was carried out using Universal cDNA synthesis kit II (Exiqon, Woburn, MA, USA). For qPCR ExiLENT SYBR® Green kit from Exiqon (Woburn, MA, USA) was used and qPCR was performed on ABI 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with S.D.S 2.2.2 software, as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 60 s with three independent replications containing three technical repeats each time. Negative control sets with no cDNA and no master mix were also tested. Three miRNAs, MI02950 (miR-71-5p), MI03018 (miR-58-3p), and MI02743 (miR-7904-3p), which consistently had analogous expression profiles at all stages of the nematode life cycle, were analyzed to be used as internal control for qPCR studies. The real-time qPCR studies were carried out as two independent experiments with at least three technical repeats. We calculated the fold changes in gene expression from the ΔΔCt values for all the selected miRNAs.

5. Conclusions

The RKN M. incognita is a major agricultural pest and environmental friendly solutions against use of harmful nematicides would be the goal in the future. Studying miRNA at each stage of development provides us with valuable resource for several aspects of study including, physiology and metabolism of the nematode at each stage, development of stage-specific markers, candidates for efficient control of the nematode and more. This study contributes to the existing database of miRNA from M. incognita and aims to serve as a useful source of information for future miRNA based studies.
  47 in total

1.  The small RNA profile during Drosophila melanogaster development.

Authors:  Alexei A Aravin; Mariana Lagos-Quintana; Abdullah Yalcin; Mihaela Zavolan; Debora Marks; Ben Snyder; Terry Gaasterland; Jutta Meyer; Thomas Tuschl
Journal:  Dev Cell       Date:  2003-08       Impact factor: 12.270

2.  The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing.

Authors:  Eugene V Makeyev; Jiangwen Zhang; Monica A Carrasco; Tom Maniatis
Journal:  Mol Cell       Date:  2007-08-03       Impact factor: 17.970

3.  Antisense-mediated depletion reveals essential and specific functions of microRNAs in Drosophila development.

Authors:  Dan Leaman; Po Yu Chen; John Fak; Abdullah Yalcin; Michael Pearce; Ulrich Unnerstall; Debora S Marks; Chris Sander; Thomas Tuschl; Ulrike Gaul
Journal:  Cell       Date:  2005-07-01       Impact factor: 41.582

4.  Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.

Authors:  Bindhya Chal Yadav; Karuppannan Veluthambi; Kuppuswamy Subramaniam
Journal:  Mol Biochem Parasitol       Date:  2006-04-19       Impact factor: 1.759

Review 5.  Biotechnological application of functional genomics towards plant-parasitic nematode control.

Authors:  Jiarui Li; Timothy C Todd; Junghoon Lee; Harold N Trick
Journal:  Plant Biotechnol J       Date:  2011-02-25       Impact factor: 9.803

6.  Regulation of ovarian cancer progression by microRNA-187 through targeting Disabled homolog-2.

Authors:  A Chao; C-Y Lin; Y-S Lee; C-L Tsai; P-C Wei; S Hsueh; T-I Wu; C-N Tsai; C-J Wang; A-S Chao; T-H Wang; C-H Lai
Journal:  Oncogene       Date:  2011-07-04       Impact factor: 9.867

7.  Mir-30 reduction maintains self-renewal and inhibits apoptosis in breast tumor-initiating cells.

Authors:  F Yu; H Deng; H Yao; Q Liu; F Su; E Song
Journal:  Oncogene       Date:  2010-05-24       Impact factor: 9.867

8.  MicroRNA regulation of cell lineages in mouse and human embryonic stem cells.

Authors:  Kathryn N Ivey; Alecia Muth; Joshua Arnold; Frank W King; Ru-Fang Yeh; Jason E Fish; Edward C Hsiao; Robert J Schwartz; Bruce R Conklin; Harold S Bernstein; Deepak Srivastava
Journal:  Cell Stem Cell       Date:  2008-03-06       Impact factor: 24.633

Review 9.  Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing.

Authors:  Markus Hafner; Pablo Landgraf; Janos Ludwig; Amanda Rice; Tolulope Ojo; Carolina Lin; Daniel Holoch; Cindy Lim; Thomas Tuschl
Journal:  Methods       Date:  2008-01       Impact factor: 3.608

10.  miR-58 family and TGF-β pathways regulate each other in Caenorhabditis elegans.

Authors:  María Pilar de Lucas; Alberto G Sáez; Encarnación Lozano
Journal:  Nucleic Acids Res       Date:  2015-09-22       Impact factor: 16.971

View more
  4 in total

1.  Genome-wide identification and characterization of miRNAome from tomato (Solanum lycopersicum) roots and root-knot nematode (Meloidogyne incognita) during susceptible interaction.

Authors:  Pritam Kaur; Neha Shukla; Gopal Joshi; Cheeni VijayaKumar; Arun Jagannath; Manu Agarwal; Shailendra Goel; Amar Kumar
Journal:  PLoS One       Date:  2017-04-20       Impact factor: 3.240

2.  Small RNA Sequencing Reveals Regulatory Roles of MicroRNAs in the Development of Meloidogyne incognita.

Authors:  Huawei Liu; Robert L Nichols; Li Qiu; Runrun Sun; Baohong Zhang; Xiaoping Pan
Journal:  Int J Mol Sci       Date:  2019-11-02       Impact factor: 5.923

3.  Differential Metabolic Profiles during the Developmental Stages of Plant-Parasitic Nematode Meloidogyne incognita.

Authors:  Parthiban Subramanian; Byung-Ju Oh; Vimalraj Mani; Jae Kook Lee; Chang-Muk Lee; Joon-Soo Sim; Ja Choon Koo; Bum-Soo Hahn
Journal:  Int J Mol Sci       Date:  2017-06-24       Impact factor: 5.923

4.  Chitin Biosynthesis Inhibition of Meloidogyne incognita by RNAi-Mediated Gene Silencing Increases Resistance to Transgenic Tobacco Plants.

Authors:  Vimalraj Mani; Chinreddy Subramanyam Reddy; Seon-Kyeong Lee; Soyoung Park; Hyoung-Rai Ko; Dong-Gwan Kim; Bum-Soo Hahn
Journal:  Int J Mol Sci       Date:  2020-09-10       Impact factor: 5.923

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.