| Literature DB >> 27771780 |
T Gosiewski1, A H Ludwig-Galezowska2, K Huminska3,4, A Sroka-Oleksiak1, P Radkowski2, D Salamon1, J Wojciechowicz3, M Kus-Slowinska3, M Bulanda1, P P Wolkow5.
Abstract
Blood is considered to be a sterile microenvironment, in which bacteria appear only periodically. Previously used methods allowed only for the detection of either viable bacteria with low sensitivity or selected species of bacteria. The Next-Generation Sequencing method (NGS) enables the identification of all bacteria in the sample with their taxonomic classification. We used NGS for the analysis of blood samples from healthy volunteers (n = 23) and patients with sepsis (n = 62) to check whether any bacterial DNA exists in the blood of healthy people and to identify bacterial taxonomic profile in the blood of septic patients. The presence of bacterial DNA was found both in septic and healthy subjects; however, bacterial diversity was significantly different (P = 0.002) between the studied groups. Among healthy volunteers, a significant predominance of anaerobic bacteria (76.2 %), of which most were bacteria of the order Bifidobacteriales (73.0 %), was observed. In sepsis, the majority of detected taxa belonged to aerobic or microaerophilic microorganisms (75.1 %). The most striking difference was seen in the case of Actinobacteria phyla, the abundance of which was decreased in sepsis (P < 0.001) and Proteobacteria phyla which was decreased in the healthy volunteers (P < 0.001). Our research shows that bacterial DNA can be detected in the blood of healthy people and that its taxonomic composition is different from the one seen in septic patients. Detection of bacterial DNA in the blood of healthy people may suggest that bacteria continuously translocate into the blood, but not always cause sepsis; this observation can be called DNAemia.Entities:
Mesh:
Substances:
Year: 2016 PMID: 27771780 PMCID: PMC5253159 DOI: 10.1007/s10096-016-2805-7
Source DB: PubMed Journal: Eur J Clin Microbiol Infect Dis ISSN: 0934-9723 Impact factor: 3.267
Sequences of primers and probes utilized in the study
| Amplification | Primer | Sequence 5’–3’ | Origin | Target sequences | Amplification program |
|---|---|---|---|---|---|
| External | F | ACGGCCNNRACTCCTAC | This study | V3 and V4 |
|
| R | TTACGGNNTGGACTACHV | ||||
| Internal | F | CCTACGGGNGGCWGCAG | [15] |
| |
| R | GACTACHVGGGTATCTAATCC | ||||
| Overhang adaptersa | F | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | Illumina | ||
| R | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG |
aThe overhang adapter sequences were added to the internal primer attached to the 5′ end
Fig. 1Rarefaction curves for patients with sepsis (orange curve) versus healthy patients (red curve) and NTC samples (blue curve); p = 0.002
Fig. 2Weighted UniFrac PCoA plot derived from NGS sequencing of blood samples taken from healthy volunteers (n = 23, red), NTC samples (blue) and patients with sepsis (n = 62, yellow)
Fig. 3Phyla abundances in the studied groups
Fig. 4Effect of patients status on taxonomy composition of order abundances
Fig. 5Representative results of nested amplification of the 16S libraries and the negative control (NTC). Amplicon 550 bp