| Literature DB >> 27768062 |
Gaia Palmini1, Roberto Zonefrati1, Carmelo Mavilia1, Alessandra Aldinucci2, Ettore Luzi1, Francesca Marini1, Alessandro Franchi1, Rodolfo Capanna3, Annalisa Tanini1, Maria Luisa Brandi4.
Abstract
The current improvements in therapy against osteosarcoma (OS) have prolonged the lives of cancer patients, but the survival rate of five years remains poor when metastasis has occurred. The Cancer Stem Cell (CSC) theory holds that there is a subset of tumor cells within the tumor that have stem-like characteristics, including the capacity to maintain the tumor and to resist multidrug chemotherapy. Therefore, a better understanding of OS biology and pathogenesis is needed in order to advance the development of targeted therapies to eradicate this particular subset and to reduce morbidity and mortality among patients. Isolating CSCs, establishing cell cultures of CSCs, and studying their biology are important steps to improving our understanding of OS biology and pathogenesis. The establishment of human-derived OS-CSCs from biopsies of OS has been made possible using several methods, including the capacity to create 3-dimensional stem cell cultures under nonadherent conditions. Under these conditions, CSCs are able to create spherical floating colonies formed by daughter stem cells; these colonies are termed "cellular spheres". Here, we describe a method to establish CSC cultures from primary cell cultures of conventional OS obtained from OS biopsies. We clearly describe the several passages required to isolate and characterize CSCs.Entities:
Mesh:
Year: 2016 PMID: 27768062 PMCID: PMC5092197 DOI: 10.3791/53884
Source DB: PubMed Journal: J Vis Exp ISSN: 1940-087X Impact factor: 1.355
|
|
|
|
|
|
| Nanog | Forward primer Reverse primer | CCCAGCTGTGTGTACTCAAT GGTTCAGGATGTTGGAGAGTT | 87 | 60 |
| Oct 3/2 | Forward primer Reverse primer | GGGAGGAGCTAGGGAAAGA TCCTTCCTTAGTGAATGAAGAACT | 77 | 60 |
| Sox2 | Forward primer Reverse primer | TGCAGTACAACTCCATGACC GGACTTGACCACCGAACC | 125 | 55 |
| CD133 | Forward primer Reverse primer | CCAGAAGCCGGGTCATAAAT ATTCACTCAAGGCACCATCC | 127 | 56 |