| Literature DB >> 27761137 |
Jianbo Li1, Huixia Jia2, Xiaojiao Han1, Jin Zhang1, Pei Sun1, Mengzhu Lu2, Jianjun Hu2.
Abstract
Salix psammophila is a desert shrub willow that has extraordinary adaptation to abiotic stresses and plays an important role in maintaining local ecosystems. Moreover, S. psammophila is regarded as a promising biomass feedstock because of its high biomass yields and short rotation coppice cycle. However, few suitable reference genes (RGs) for quantitative real-time polymerase chain reaction (qRT-PCR) constrain the study on normalization of gene expression in S. psammophila until now. Here, we investigated the expression stabilities of 14 candidate RGs across tissue types and under four abiotic stress treatments, including heat, cold, salt, and drought treatments. After calculation of PCR efficiencies, three different software, NormFinder, geNorm, and BestKeeper were employed to analyze systematically the qRT-PCR data, and the outputs were merged by RankAggreg software. The optimal RGs selected for gene expression analysis were EF1α (Elongation factor-1 alpha) and OTU (OTU-like cysteine protease family protein) for different tissue types, UBC (Ubiquitin-conjugating enzyme E2) and LTA4H (Leukotriene A-4 hydrolase homolog) for heat treatment, HIS (Histone superfamily protein H3) and ARF2 (ADP-ribosylation factor 2) for cold treatment, OTU and ACT7 (Actin 7) for salt treatment, UBC and LTA4H for drought treatment. The expression of UBC, ARF2, and VHAC (V-type proton ATPase subunit C) varied the least across tissue types and under abiotic stresses. Furthermore, the relative genes expression profiles of one tissue-specific gene WOX1a (WUSCHEL-related homeobox 1a), and four stress-inducible genes, including Hsf-A2 (Heat shock transcription factors A2), CBF3 (C-repeat binding factor 3), HKT1 (High-Affinity K+ Transporter 1), and GST (Glutathione S-transferase), were conducted to confirm the validity of the RGs in this study. These results provided an important RGs application guideline for gene expression characterization in S. psammophila.Entities:
Keywords: Salix psammophila; abiotic stresses; quantitative real-time PCR; reference genes; tissue types
Year: 2016 PMID: 27761137 PMCID: PMC5050224 DOI: 10.3389/fpls.2016.01505
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
The comprehensive details of the genes used for Salix psammophila RGs selection.
| Gene abbreviation | Gene name | Gene accession in | Gene accession in | Amplicon length (bp) | Amplification efficiency (%) | |
|---|---|---|---|---|---|---|
| Tubulin beta chain | SapurV1A.0612s0060.1 | willow_GLEAN_10025465 | 190 | 105.57 | 0.9982 | |
| Histone superfamily protein H3 | SapurV1A.0311s0010.1 | willow_GLEAN_10003889 | 219 | 107.63 | 0.9993 | |
| Actin 7 | SapurV1A.0231s0320.1 | willow_GLEAN_10001533 | 173 | 95.27 | 0.9946 | |
| Actin 11 | SapurV1A.0018s0700.1 | willow_GLEAN_10010347 | 173 | 95.19 | 0.9947 | |
| Ubiquitin family | SapurV1A.0014s0290.1 | willow_GLEAN_10018914 | 207 | 91.98 | 0.9994 | |
| Elongation factor-1 alpha | SapurV1A.0023s0300.1 | willow_GLEAN_10019594 | 243 | 103.30 | 0.9996 | |
| 60-kDa chaperonin β-subunit | SapurV1A.0081s0600.1 | willow_GLEAN_10013343 | 152 | 89.13 | 0.9995 | |
| Lipocalin-like gene | SapurV1A.0347s0210.1 | willow_GLEAN_10011584 | 174 | 93.69 | 0.9971 | |
| Seed storage/lipid transfer protein | SapurV1A.0214s0050.1 | willow_GLEAN_10024899 | 164 | 93.68 | 0.9994 | |
| ADP-ribosylation factor 2 | SapurV1A.0014s0160.1 | willow_GLEAN_10018905 | 246 | 91.18 | 0.9967 | |
| Leukotriene A-4 hydrolase homolog | SapurV1A.0023s0630.1 | willow_GLEAN_10019570 | 156 | 112.13 | 0.9949 | |
| Ubiquitin-conjugating enzyme E2 | SapurV1A.0237s0020.1 | willow_GLEAN_10023705 | 183 | 97.25 | 0.9901 | |
| V-type proton ATPase subunit C | SapurV1A.0123s0450.1 | willow_GLEAN_10019233 | 189 | 119.11 | 0.9873 | |
| OTU-like cysteine protease family protein | SapurV1A.0615s0200.1 | willow_GLEAN_10023705 | 187 | 115.76 | 0.9917 |
The primer sequences used in this study.
| Gene abbreviation | Forward primer sequence (5′–3′) | Reverse primer sequence (5′–3′) |
|---|---|---|
| ATGAGTGGAGTGACGTGCTG | CATCCCACATTTGCTGTGTC | |
| AAGAGGCAGCTGAGGCATAC | TTCCACCGGTACAGCCTAAC | |
| GGTTTGCTGGTGATGATGCA | GCTGACAATACCGTGCTCAA | |
| TTCCCTTTATGCCAGTGGTC | AGCCACGCTCAGTCAAGATT | |
| AAGCCCAAGAAGATCAAGCA | ACCACCAGCCTTCTGGTAAA | |
| GATTTGAAGCGTGGGTTTGT | AGCATCTCCGTTCTTCAGGA | |
| TGCCAAAAATGCTGGTGTTA | GGCAACATCTGACCACCTTT | |
| CATTCTTGCCCATCATTCCT | CCTCTTCTTTGGCCTTCTCC | |
| TCTGTGCTGTCATGCTTTCC | AGGGTGAGTGGAGTTCATGG | |
| TCTGATGGTGGGTCTCGATG | TCCACCACACGATCTCTGTC | |
| TGGCTATTTCGTCCAGGTGT | CAGCAAACACTCTCTCTGCC | |
| TGGCATCGAAACGGATCTTG | ACGGATAGTCTGGAGGAAAATGA | |
| GCCATTCGTGTCTTTGCAGA | TCCCAAGCCGAATATCCCTC | |
| ATTGGTGAGGAGGTGCAAGA | CTGATCCCACCCCTTCATCA | |
| CGATACAGCTCTTCGAGGGT | CCATCAACTTCAGCTGCCTC | |
| GAGGGAACACATTGCTGCAA | CCACCTAATGCCACAGATGC | |
| TGCAGGGCGGAGAATATTCA | CCGAGTCCGCGAAATTAAGG | |
| TCCCAAGACCACAAACCACA | TTTCTTCCCTCGCAGACAGT | |
| GGATGTCTTACTGGCTGCCA | CGCGAGGCCTAGAAGAAAAC | |
Rankings of candidate RGs for normalization and their expression stability values calculated using the NormFinder program.
| Rank | Tissue | Heat | Cold | Salt | Drought | Total | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | Gene | Stability | |
| 1 | 0.0560 | 0.0647 | 0.0416 | 0.0937 | 0.0293 | 0.1272 | ||||||
| 2 | 0.1269 | 0.0818 | 0.1061 | 0.1179 | 0.0579 | 0.1542 | ||||||
| 3 | 0.1364 | 0.1113 | 0.1189 | 0.1466 | 0.0739 | 0.1695 | ||||||
| 4 | 0.2222 | 0.1263 | 0.1245 | 0.1750 | 0.0866 | 0.1990 | ||||||
| 5 | 0.2355 | 0.1836 | 0.1493 | 0.1906 | 0.0979 | 0.2029 | ||||||
| 6 | 0.2377 | 0.1974 | 0.1822 | 0.2051 | 0.1117 | 0.2310 | ||||||
| 7 | 0.2642 | 0.2134 | 0.1833 | 0.2086 | 0.1187 | 0.2412 | ||||||
| 8 | 0.3049 | 0.2209 | 0.2121 | 0.2098 | 0.1320 | 0.2516 | ||||||
| 9 | 0.3112 | 0.2952 | 0.2189 | 0.2101 | 0.1415 | 0.2525 | ||||||
| 10 | 0.3475 | 0.2984 | 0.2460 | 0.2208 | 0.2326 | 0.2736 | ||||||
| 11 | 0.3567 | 0.3438 | 0.2478 | 0.2503 | 0.2414 | 0.2930 | ||||||
| 12 | 0.3608 | 0.3579 | 0.2846 | 0.2573 | 0.2828 | 0.3211 | ||||||
| 13 | 0.4325 | 0.3631 | 0.3377 | 0.3668 | 0.2964 | 0.3431 | ||||||
| 14 | 0.4593 | 0.4324 | 0.3879 | 0.4263 | 0.4837 | 0.3978 | ||||||
Rankings of candidate RGs in order of their expression stability as calculated by BestKeeper.
| Rank | Tissues | Heat | Cold | Salt | Drought | Total | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene | CV | Gene | CV | Gene | CV | Gene | CV | Gene | CV | Gene | CV | |||||||
| 1 | 0.28 | 1.56 | 0.11 | 0.55 | 0.23 | 1.10 | 0.20 | 0.82 | 0.08 | 0.40 | 0.45 | 1.92 | ||||||
| 2 | 0.33 | 1.29 | 0.16 | 0.87 | 0.24 | 1.09 | 0.23 | 1.15 | 0.18 | 0.74 | 0.47 | 2.29 | ||||||
| 3 | 0.41 | 2.04 | 0.19 | 0.84 | 0.26 | 1.10 | 0.27 | 1.06 | 0.22 | 1.06 | 0.50 | 1.98 | ||||||
| 4 | 0.44 | 1.67 | 0.19 | 0.78 | 0.27 | 0.92 | 0.35 | 1.76 | 0.23 | 1.10 | 0.58 | 2.82 | ||||||
| 5 | 0.54 | 2.31 | 0.21 | 1.03 | 0.30 | 1.18 | 0.38 | 1.65 | 0.31 | 1.29 | 0.60 | 2.94 | ||||||
| 6 | 0.68 | 3.33 | 0.35 | 1.44 | 0.35 | 1.68 | 0.41 | 2.00 | 0.32 | 1.29 | 0.65 | 3.50 | ||||||
| 7 | 0.70 | 3.42 | 0.44 | 1.62 | 0.40 | 1.51 | 0.42 | 2.24 | 0.33 | 1.47 | 0.70 | 2.73 | ||||||
| 8 | 0.72 | 3.62 | 0.45 | 2.13 | 0.44 | 2.06 | 0.45 | 1.94 | 0.36 | 1.87 | 0.78 | 3.59 | ||||||
| 9 | 0.90 | 4.01 | 0.54 | 2.82 | 0.48 | 1.79 | 0.53 | 2.45 | 0.40 | 1.96 | 0.80 | 3.72 | ||||||
| 10 | 0.94 | 4.02 | 0.64 | 2.54 | 0.49 | 2.44 | 0.59 | 2.07 | 0.44 | 1.96 | 0.99 | 4.47 | ||||||
| 11 | 1.04 | 4.42 | 0.81 | 3.88 | 0.52 | 1.94 | 0.66 | 3.16 | 0.78 | 2.75 | 1.41 | 6.48 | ||||||
| 12 | 1.20 | 5.34 | 0.94 | 4.25 | 0.55 | 2.83 | 0.80 | 2.84 | 0.82 | 3.56 | 1.45 | 5.41 | ||||||
| 13 | 1.36 | 5.94 | 1.09 | 3.84 | 0.57 | 2.58 | 0.85 | 3.92 | 1.25 | 4.55 | 1.75 | 6.53 | ||||||
| 14 | 1.37 | 6.23 | 2.14 | 7.58 | 1.53 | 7.08 | 1.99 | 7.47 | 1.30 | 4.38 | 2.64 | 9.61 | ||||||
Expression stability ranking of the 14 candidate RGs.
| Method | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| geNorm | ||||||||||||||
| BestKeeper | ||||||||||||||
| NormFinder | ||||||||||||||
| RankAggreg | ||||||||||||||
| geNorm | ||||||||||||||
| BestKeeper | ||||||||||||||
| NormFinder | ||||||||||||||
| RankAggreg | ||||||||||||||
| geNorm | ||||||||||||||
| BestKeeper | ||||||||||||||
| NormFinder | ||||||||||||||
| RankAggreg | ||||||||||||||
| geNorm | ||||||||||||||
| BestKeeper | ||||||||||||||
| NormFinder | ||||||||||||||
| RankAggreg | ||||||||||||||
| geNorm | ||||||||||||||
| BestKeeper | ||||||||||||||
| NormFinder | ||||||||||||||
| RankAggreg | ||||||||||||||
| geNorm | ||||||||||||||
| BestKeeper | ||||||||||||||
| NormFinder | ||||||||||||||
| RankAggreg | ||||||||||||||
Best combination of RGs based on the geNorm and RankAggreg programs.
| Experimental conditions | |||||
|---|---|---|---|---|---|
| Tissues | Heat | Cold | Salt | Drought | Total |