Zhi-Yong He1,2,3, Wen-Yue Wang1, Wei-Yan Hu1,2,4, Lu Yang1, Yan Li1, Wei-Yuan Zhang1, Ya-Shu Yang1, Si-Cheng Liu1, Feng-Lan Zhang1, Rong Mei5, Da Xing3, Zhi-Cheng Xiao1,2, Ming Zhang1. 1. Yunnan Key Laboratory of Stem Cell and Regenerative Medicine, Institute of Molecular and Clinical Medicine, Kunming Medical University, Kunming 650500, China. 2. Department of Anatomy and Developmental Biology, Monash University, Melbourne 3800, Australia. 3. MOE Key Laboratory of Laser Life Science &Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631, China. 4. School of Pharmaceutical Science &Yunnan Key Laboratory of Pharmacology for Natural Products, Kunming Medical University, Kunming 650500, China. 5. Department of Neurology, the First People's Hospital of Yunnan Province, Kunming 650032, China.
Abstract
The PP2C family member Wild-type p53-induced phosphatase 1 (Wip1) critically regulates DNA damage response (DDR) under stressful situations. In the present study, we investigated whether Wip1 expression was involved in the regulation of DDR-induced and depression-related cellular senescence in mouse hippocampus. We found that Wip1 gene knockout (KO) mice showed aberrant elevation of hippocampal cellular senescence and of γ-H2AX activity, which is known as a biomarker of DDR and cellular senescence, indicating that the lack of Wip1-mediated γ-H2AX dephosphorylation facilitates cellular senescence in hippocampus. Administration of the antidepressant fluoxetine had no significant effects on the increased depression-like behaviors, enriched cellular senescence, and aberrantly upregulated hippocampal γ-H2AX activity in Wip1 KO mice. After wildtype C57BL/6 mice were exposed to the procedure of chronic unpredictable mild stress (CUMS), cellular senescence and γ-H2AX activity in hippocampus were also elevated, accompanied by the suppression of Wip1 expression in hippocampus when compared to the control group without CUMS experience. These CUMS-induced symptoms were effectively prevented following fluoxetine administration in wildtype C57BL/6 mice, with the normalization of depression-like behaviors. Our data demonstrate that Wip1-mediated γ-H2AX dephosphorylation may play an important role in the occurrence of depression-related cellular senescence.
The PP2C family member Wild-type p53-induced phosphatase 1 (Wip1) critically regulates DNA damage response (DDR) under stressful situations. In the present study, we investigated whether Wip1 expression was involved in the regulation of DDR-induced and depression-related cellular senescence in mouse hippocampus. We found that Wip1 gene knockout (KO) mice showed aberrant elevation of hippocampal cellular senescence and of γ-H2AX activity, which is known as a biomarker of DDR and cellular senescence, indicating that the lack of Wip1-mediated γ-H2AX dephosphorylation facilitates cellular senescence in hippocampus. Administration of the antidepressant fluoxetine had no significant effects on the increased depression-like behaviors, enriched cellular senescence, and aberrantly upregulated hippocampal γ-H2AX activity in Wip1 KO mice. After wildtype C57BL/6 mice were exposed to the procedure of chronic unpredictable mild stress (CUMS), cellular senescence and γ-H2AX activity in hippocampus were also elevated, accompanied by the suppression of Wip1 expression in hippocampus when compared to the control group without CUMS experience. These CUMS-induced symptoms were effectively prevented following fluoxetine administration in wildtype C57BL/6 mice, with the normalization of depression-like behaviors. Our data demonstrate that Wip1-mediated γ-H2AX dephosphorylation may play an important role in the occurrence of depression-related cellular senescence.
Extensive efforts have been made to investigate the etiology and pathophysiology of depression, a heritable and prevalent mood disorder in the worldwide population. Wild-type p53-induced phosphatase 1 (Wip1) belongs to the PP2C family of Ser/Thr protein phosphatases1 and is also known as Protein phosphatase magnesium-dependent 1 delta (Ppm1d). Many studies so far to reveal Wip1 functions focus on its role in the regulation of cellular stress response and tumorigenesis23. For instance, accumulation of Wip1 protein can be evoked in the nucleus following environmental stressful stimuli such as ionizing radiation1. Wip1 may act to suppress DNA damage signaling kinases Ataxia telangiectasia mutated (ATM) and Tumor suppressor protein TP53 (p53) in humantumor cells4. However, there were only several studies performed to explore how Wip1 regulates brain functions, such as cognitive functions and mood stabilization. It was reported recently by our lab that Wip1 deficiency led to significant reduction of new-born neural cells in mouse olfactory bulb5, abnormal hippocampal dendritic spine morphology and the impairment of hippocampus-dependent contextual memory6. Interestingly, embryonic Wip1 deficiency induced the increase of anxiety- and depression-like behaviors in adult mice7. These studies imply that Wip1 phosphatase may not only play a role in the regulation of cognitive memory, but also in the stabilization of mood. In the present study, we further explored the cellular and molecular mechanisms underlying the aberrantly increased depression-like behaviors in adult Wip1 deficient mice.The potential link between clinical depression severity and accelerated cellular aging has been reported recently, as indicated by the finding that higher depression severity and longer symptom duration in depressivepatients are associated with shorter telomere length8. Furthermore, oxidative DNA/RNA damage increases in peripheral blood of depressive patients910. The increased activity of γ-H2AX, the phosphorylation form of histone H2A member X at serine 139, in response to DNA damage response (DDR) critically regulates cellular senescence and has been considered as a biomarker of cellular senescence11. Accumulation of nuclear DNA damage stimulates the activity of γ-H2AX12, and then triggers the initiation of cellular senescence11131415. The expression of γ-H2AX in adult and senescent mouse brain regions including cerebral cortex and hippocampus16 suggests that γ-H2AX may be involved in the regulation of brain functions. A recent study found that Wip1 gene loss promotes both premature cellular senescence and endogenous DDR signaling by increasing γ-H2AX activity in mouse embryonic fibroblasts17. These studies prompt that the upregulated vulnerability of cellular senescence and DDR signaling might contribute to neuronal dysfunction and the increased depression-like behaviors in Wip1 deficient mice. Herein, we performed experiments to investigate whether and how Wip1 phosphatase regulates hippocampal cellular senescence and γ-H2AX activity in adult mice.
Results
Wip1 gene knockout increases hippocampal cellular senescence and γ-H2AX activity
To verify the phenotype of Wip1 gene knockout (KO) on depression-like behaviors, adult Wip1 KO mice and their wildtype (WT) littermates were employed in the sucrose preference test (SPT), the forced swimming test (FST), and the tail suspension test (TST), successively. Consistent with our previous study, Wip1 KO mice showed more depression-like behaviors than their wildtype littermates did (see Supplementary Fig. S1). Immunohistochemistry (IHC) experiment revealed that there were more SABG-staining positive cells located in hippocampal CA1 and dentate gyrus (DG) subareas of Wip1 KO mice when compared to their wildtype littermates (P < 0.01 in both subareas, unpaired t-test; Fig. 1A,B). Wip1 KO significantly increased the amount of γ-H2AX positive cells in hippocampus (P < 0.01; Fig. 1C,D). Western blotting assay also showed that Wip1 KO mice exhibited increased γ-H2AX level in the hippocampus compared to the control group (P < 001; Fig. 1E,F). These data demonstrate that embryonic Wip1 deficiency leads to the upregulation of the phosphorylated H2AX (i.e., γ-H2AX), which then triggers the increase of cellular senescence in mouse hippocampus.
Figure 1
The increase of hippocampal cellular senescence and γ-H2AX activity in Wip1 KO mice.
(A) Illustration of immunochemistry samples showing SABG-staining positive cells located in hippocampal CA1 and dentate gyrus (DG) subareas. (B) Comparison of the number of SABG-staining positive cells within hippocampal CA1 and DG subareas between Wip1 KO mice and their wildtype (WT) littermates (n = 5 mice for each group). SABG-staining positive cells located in hilus were merged with those in DG and presented together. The number of SABG-staining positive cells significantly increased in Wip1 KO mice when compared to that in their WT littermates. (C) Illustration of immunochemistry samples showing hippocampal γ-H2AX positive cells. (D) There were obviously more hippocampal γ-H2AX positive cells in Wip1 KO mice than in the control group (n = 6 mice for each group). (E) The sample of Western blotting assay for the detection of γ-H2AX and the total H2AX expression in hippocampal tissues. β-action was probed as the protein loading control of samples. (F) Wip1 KO mice exhibited the increase of γ-H2AX expression when compared to the control group. The γ-H2AX expression was normalized to the total H2AX. n = 6 samples for each group. **P < 0.01.
Fluoxetine fails to rescue aberrant elevation of depression-like behaviors, cellular senescence and γ-H2AX activity in Wip1 KO mice
To rescue the aberrantly elevated depression-like behaviors in Wip1 mutants, the antidepressant fluoxetine was intraperitoneally administrated once a day for a total of 14 days before behavioral tests in Wip1 mutants and their wildtype littermates. Two-way ANOVA revealed significant main effects of genotype on the sucrose consumption in SPT (F(1,32) = 32.3, P < 0.01; Fig. 2A), the latency to immobility in FST (F(1,32) = 34.1, P < 0.01; Fig. 2B), and the immobility time in TST (F(1,32) = 43.8, P < 0.01; Fig. 2C). However, fluoxetine failed to prevent these phenotypes in Wip1 KO mice as indicated by the fact that there were no significant effects of drug treatment and the interaction between drug treatment and genotype on these measurements (all P > 0.2). It should be noted that the effects of genotype, drug treatment and their interaction on the immobility time in FST were not significant (all P > 0.05; Fig. 2B), suggesting that this measurement in FST was insensitive to genetic Wip1 loss.
Figure 2
Fluoxetine failed to rescue the increase of depression-like behaviors in Wip1 KO mice.
(A) Wip1 KO mice consumed less sucrose in the sucrose preference test (SPT) than the control mice did, but fluoxetine treatment for 2 weeks failed to prevent the decrease of sucrose consumption in Wip1 KO mice. (B) Neither Wip1 KO nor fluoxetine treatment affect the immobility time in the forced swimming test (FST). However, Wip1 KO significantly decreased the latency to be immobile in FST, though this phenotype was not successfully blocked by fluoxetine treatment. (C) Fluoxetine treatment failed to prevent Wip1 KO-induced increase of the immobility time in the tail suspension test (TST). n = 11 for each of the two KO groups; n = 7 mice for each of the two WT groups. *P < 0.05; **P < 0.01.
Although the main effects of genotype on the cellular senescence (CA1: F(1,16) = 79.7; DG: F(1,16) = 41.2, both P < 0.01; Fig. 3A,B), the γ-H2AX positive cells examined with IHC (F(1,20) = 88.1, P < 0.01; Fig. 3C,D), and the γ-H2AX expression examined with Western blotting (F(1,20) = 25.8, P < 0.01; Fig. 3E,F) remained significant, the fluoxetine treatment was ineffective to reduce the aberrantly increased cellular senescence (CA1: Treatment: F(1,16) = 0.9; Treatment × genotype: F(1, 16) = 0.2; DG: Treatment: F(1,16) = 0.01; Treatment × genotype: F(1, 16) = 0.02, all P > 0.4), the γ-H2AX positive cells (Treatment: F(1, 20) = 0.9; Treatment × genotype: F(1, 20) = 0.1, both P > 0.3), and the γ-H2AX expression (Treatment: F(1,20) = 0.01, P > 0.8; Treatment × genotype: F(1,20) = 3.6, P = 0.07) in Wip1 KO mice. The effects of fluoxetine treatment on aberrantly increased cellular senescence in amygdala were also ineffective (see supplementary Fig. S2). The failure of fluoxetine administration to rescue these phenotypes suggests that Wip1 is involved in mediating the antidepressive effects of fluoxetine.
Figure 3
Fluoxetine failed to rescue the increase of hippocampal cellular senescence and γ-H2AX activity in Wip1 KO mice.
(A) Illustration of SABG-staining positive cells located in hippocampal CA1 and DG subareas. (B) Fluoxetine treatment for 2 weeks did not prevent the increase of cellular senescence in Wip1 KO mice (n = 5 mice for each group). (C) Illustration of hippocampal γ-H2AX positive cells after fluoxetine or vehicle treatment for 2 weeks in both groups. (D) Fluoxetine treatment was unable to prevent the increase of γ-H2AX positive cells in hippocampus of Wip1 KO mice (n = 6 mice for each group). (E) The expression of γ-H2AX and the total H2AX were examined using Western blotting assay. (F) Fluoxetine treatment was unable to prevent the increase of hippocampal γ-H2AX activity in Wip1 KO mice (n = 6 samples for each group). The expression of γ-H2AX was normalized to that of the total H2AX. **P < 0.01.
CUMS increases cellular senescence and γ-H2AX activity, but suppresses Wip1 expression in hippocampus
To further verify the functions of Wip1 and γ-H2AX in depression and cellular senescence, two or four weeks of CUMS were applied to induce depression-like behaviors in healthy adult male C57BL/6 mice, in which Wip1 gene was kept intact. Mice exposed to CUMS for 2 or 4 weeks exhibited more depression-like behaviors than the control group did (see supplementary Fig. S3). After behavioral testing, mice of all groups were humanely sacrificed and then hippocampal tissues were collected for the IHC detection and Western blotting assay. CUMS exposure significantly increased cellular senescence in hippocampal CA1 (F(2, 15) = 38.2, P < 0.01; CUMS-2 weeks vs Control: P > 0.05; CUMS-4 weeks vs Control: P < 0.01) and DG (F(2,15) = 29.0, P < 0.01; CUMS-2 or 4 weeks vs Control: both P < 0.01) subareas when compared to the control mice (Fig. 4A,B). CUMS exposure also increased cellular senescence in amygdala, but not in cerebral cortex and midbrain (see supplementary Fig. S4).
Figure 4
CUMS experience increased cellular senescence and γ-H2AX activity, but reduced Wip1 expression in wildtype mice.
(A) Illustration of SABG-staining positive cells within CA1 and DG subareas of those wildtype mice exposed to CUMS for 2 or 4 weeks, or left undisturbed (the control group). (B) CUMS experience significantly increased cellular senescence within CA1 and DG subareas in a time-dependent manner (n = 6 mice for each group). (C) Illustration of hippocampal γ-H2AX positive cells in CUMS-exposed mice and their controls. (D) CUMS experience significantly increased the number of γ-H2AX positive cells in hippocampus compared to their controls (n = 6 mice for each group). (E) The expressions of γ-H2AX and the total H2AX in hippocampal tissues of CUMS-exposed mice and their controls were detected using Western blotting assay. (F) CUMS experience significantly increased the expression of γ-H2AX in hippocampus compared to their controls (n = 6 samples for each group). The expression of γ-H2AX was normalized to that of the total H2AX. (G) The expression of Wip1 in hippocampal tissues of CUMS-exposed mice and their controls was detected using Western blotting assay. (H) CUMS experience significantly reduced the Wip1 expression in hippocampus when compared to their controls (n = 6 samples for each group). Wip1 was normalized to β-actin. *P < 0.05; **P < 0.01.
The number of γ-H2AX positive cells in hippocampus obviously increased after CUMS exposure (F(2,15) = 56.2, P < 0.01; CUMS-2 or 4 weeks vs Control, both P < 0.01; Fig. 4C,D). Western blotting assay also found that the γ-H2AX expression significantly enhanced in CUMS-exposed mice (F(2,15) = 19.2, P < 0.01; CUMS-2 or 4 weeks vs Control: both P < 0.05; Fig. 4E,F). Differently, the Wip1 expression in hippocampus significantly decreased in CUMS-exposed mice (F (2,15) = 25.1, P < 0.001; CUMS-2 weeks vs Control: P < 0.05; CUMS-4 weeks vs Control: P < 0.01; Fig. 4G,H). These CUMS-induced behavioral and biochemical changes indicate that Wip1 expression is inversely correlated with the emergence of depression-like behaviors and cellular senescence, probably through upregulating γ-H2AX activity in mouse hippocampus.
Fluoxetine effectively reduces CUMS-evoked depression-like behaviors and cellular senescence in wildtype mice
To examine the antidepressant effects of fluoxetine on depression and cellular senescence, naive wildtype C57BL/6 mice were exposed to CUMS for 4 weeks. Fluoxetine was intraperitoneally administrated once a day from 15th to 28th day (i.e., a total of 14 days) during the 28 days of CUMS exposure. After that, depression-like behaviors and hippocampal cellular senescence were examined. Due to fluoxetine did not evoke any significant behavioral changes in untreated animals (WT + fluoxetine vs WT + vehicle; Fig. 2), the control group was not treated with fluoxetine in the CUMS experiments. We found that fluoxetine treatment significantly prevented the decrease of sucrose consumption in CUMS-exposed mice (F(2, 21) = 14.4, P < 0.01; CUMS + fluoxetine vs CUMS + vehicle: P < 0.01; Fig. 5A). Furthermore, fluoxetine treatment effectively prevented CUMS-induced increase of the immobility time (F(2, 21) = 62.9, P < 0.01; CUMS + fluoxetine vs CUMS + vehicle: P < 0.01; Fig. 5B) and the decrease of the latency to immobility (F(2, 21) = 5.9, P < 0.01; CUMS + fluoxetine vs CUMS + vehicle: P < 0.05; Fig. 5B) in FST. The CUMS-induced increase of the immobility time in TST was also prevented following the fluoxetine treatment (F(2, 21) = 19.7, P < 0.01; CUMS + fluoxetine vs CUMS + vehicle: P < 0.01; Fig. 5C).
Figure 5
Fluoxetine effectively prevented CUMS-induced increase of depression-like behaviors and cellular senescence in wildtype mice.
(A) CUMS-induced decrease of sucrose consumption in SPT was significantly prevented following fluoxetine treatment for 2 weeks. (B) Fluoxetine treatment effectively prevented CUMS-induced increase of the immobility time, and the reduction of the latency to immobility in FST. (C) Fluoxetine treatment effectively prevented CUMS-induced increase of the immobility time in TST. n = 8 mice for each group. (D) Illustration of SABG-staining positive cells within CA1 and DG subareas of CUMS-exposed mice and their controls treated with fluoxetine or vehicle. (E) Fluoxetine treatment effectively prevented the increase of cellular senescence within CA1 and DG subareas of CUMS-exposed mice (n = 6 mice for each group). *P < 0.05; **P < 0.01.
The number of SABG-staining positive cells within hippocampal CA1 and DG subareas of CUMS-exposed mice were significantly reduced following fluoxetine treatment (CA1: F(2,15) = 29.0; DG: F(2,15) = 31.0, both P < 0.01; CUMS + fluoxetine vs CUMS + vehicle: P < 0.01 for both subareas; Fig. 5D,E). Therefore, when wildtype C57BL/6 mice were employed, fluoxetine treatment was effective to prevent CUMS-induced increase of depression-like behaviors and hippocampal cellular senescence.
Fluoxetine prevents CUMS-induced γ-H2AX elevation and Wip1 reduction in wildtype mice
Immunohistochemistry experiments detected that fluoxetine treatment effectively reduced hippocampal γ-H2AX foci in wildtype C57BL/6 mice exposed to CUMS for 4 weeks (F(2,12) = 126.3, P < 0.001; CUMS + fluoxetine vs CUMS + vehicle: P < 0.01; Fig. 6A,B). Western blotting assays also revealed that fluoxetine effectively prevented the elevation of hippocampal γ-H2AX expression in CUMS-exposed wildtype mice (F(2,15) = 9.6, P = 0.002; CUMS + fluoxetine vs CUMS + vehicle: P < 0.01; Fig. 6C,D). Meanwhile, Western blotting assays revealed that fluoxetine effectively prevented the reduction of hippocampal Wip1 expression in CUMS-exposed wildtype mice (see Supplementary Fig. S5). Taken together, our data demonstrate that fluoxetine treatment was effective to prevent CUMS-evoked changes of depression-like behaviors, hippocampal cellular senescence, γ-H2AX and Wip1 activities in wildtype mice.
Figure 6
Fluoxetine effectively prevented CUMS-induced abnormal increase of γ-H2AX activity in wildtype mice.
(A) Illustration of hippocampal γ-H2AX positive cells in CUMS-exposed mice and their controls treated with fluoxetine or vehicle. (B) The increase of the number of hippocampal γ-H2AX positive cells was successfully prevented following fluoxetine treatment for 2 weeks (n = 5 mice for each group). (C) The expression of γ-H2AX and the total H2AX in hippocampal tissue was detected using Western blotting assay in CUMS-exposed mice and their controls treated with fluoxetine or vehicle. (D) The increased γ-H2AX expression was effectively prevented following fluoxetine treatment (n = 6 samples for each group). The expression of γ-H2AX was normalized to that of the total H2AX. **P < 0.01.
Discussion
In the present study, we focused on the role of Wip1 in regulating depression-related cellular senescence and γ-H2AX activity in mouse hippocampus. Our results showed that there was significant elevation of hippocampal cellular senescence and γ-H2AX activity in adult Wip1 KO mice and in CUMS-exposed wildtype mice. The increase of cellular senescence also happened in amygdala, but not in cerebral cortex and midbrain, as shown in Supplementary Figs S2 and S4, supporting the concept that hippocampus and amygdala are two key brain areas involved in the response to environmental and emotional stimuli18. It has been reviewed that the decline of Wip1 and p53 activity promotes cellular senescence and organism aging by up-regulating p38MAPK and NF-κB signaling19. The down-regulated expression of Wip1 was also found to be required for G2 phase arrest during the development of drug release-induced senescence in carcinoma cells20, at some extent accounting for the phenotype of tumor suppression in Wip1 null mice21. Since depressive illness and stress are closely linked to cellular senescence2223, our findings that Wip1 deficiency either in Wip1 null mice or in CUMS-exposed mice increased cellular senescence in hippocampus, a key brain structure in the pathophysiology of depression2425, extend our knowledge to understand the regulatory role of Wip1 in mediating brain cellular senescence and depression.DNA damage response (DDR) signaling is critical for telomere shortening and DNA damage-induced human cellular senescence14. The activity of γ-H2AX plays a crucial role in maintaining chromatin-dependent genome integrity by recruiting other DDR factors to double-stranded DNA break foci for accurate DNA repair262728. At the end of DNA repair process, dephosphorylation of γ-H2AX by phosphatases (e.g., PP2A, PP4, and PP6) is required for the recovery from DNA damage checkpoint293031. Under the situation that PP2A is inhibited or silenced, the unsuccessful removal of γ-H2AX from chromatin may lead to inefficient DNA repair and cellular high sensitivity to DNA damage29. It is also reported that ectopic expression of Wip1 effectively inhibits γ-H2AX activity after ionizing and UV radiation32, whereas Wip1 deletion increases γ-H2AX expression in oncogene-transformed mouse embryonic fibroblasts1732. Although multiple phosphatases may target at the same protein or even the same phosphorylated residues, they might exert very different and specific functions depending on the DNA damage type and the specific tissue33. Therefore, Wip1 deletion and CUMS-induced chronic elevation of γ-H2AX activity might be a crucial signal to trigger hippocampal cellular senescence, which then leads to the increase of depression-like behaviors in both Wip1 KO and CUMS-exposed mice.In the present study, Wip1 KO mice showed reduced sucrose consumption in SPT and increased immobility time in TST, but there was only a tendency to be significant when comparing the immobility time in FST between Wip1 KO and wildtype mice as shown in Supplemental Fig. S1B (KO vs WT) and in Fig. 2 (KO + vehicle vs WT + vehicle). This phenomenon that Wip1 KO increased their immobility time in TST but not in FST was also reported in our previous study7, in which behavioral tests were performed by different experimenters from the present study. Although both TST and FST are widely used to test despair behaviors in rodents, the two types of animal model might have different pathophysiological mechanisms. It was reported previously that FST showed less sensitive than the TST model to test the antidepressant effects of serotonin uptake inhibitors34, implying that FST involves less serotonergic functions than the TST model does. Therefore, our finding that Wip1 KO mice increased their immobility time in TST but not in FST suggests that the loss of Wip1 leads to the dysfunction of serotonergic system. Another possible explanation is the measurement of the immobility time in FST is not sensitive enough to reveal the increase of depressed behaviors in Wip1 KO mice. It has been reported that the parameter of the latency to immobility improves the sensitivity of FST to screen some antidepressants in mouse35. Consistent with this speculation, our data showed that Wip1 KO induced decreased latency to immobility in FST (Supplemental Fig. S1C and Fig. 2B).Fluoxetine is now prescribed as a selective serotonin reuptake inhibitor to alleviate symptoms of depressive disorder36. This drug can also be used as a positive control to reveal pharmacological effects of novel components (e.g., cordycepin) on CUMS-induced depressive behaviors37. To further identify the role of Wip1 in the development of depression, we investigated whether Wip1 is involved in therapeutic effects of fluoxetine on depression. Firstly, we need to explain why fluoxetine had no obvious effects on depressive behaviors of the control group as shown in Fig. 2 and in our previous study7. This result suggests that fluoxetine does not consistently exert obvious effects on behaviors of untreated wildtype mice. Some factors including the applied dosage of fluoxetine, treatment duration, and mouse/rat strain affect the effects of fluoxetine. For example, administration of fluoxetine (5 or 10 mg/kg) twice daily for 21 days effectively reduced novelty-induced hypophagia in MRL/MpJ mice but not in C57Bl/6J mice38. It was also reported previously that fluoxetine (20 mg/kg, the same dosage as the present study) administrated once a day over a four-week period had no obvious effects on behaviors of untreated wildtype mice, but effectively reversed CUMS-induced depressive symptoms in ICR mice39. Secondly, we found that fluoxetine failed to rescue Wip1 KO-induced defects in depressive behaviors, hippocampal cellular senescence and γ-H2AX activity, whereas the application of fluoxetine effectively prevented these symptoms in CUMS-exposed C57BL/6 wildtype mice, indicating that the loss of Wip1 gene blocks the therapeutic effects of fluoxetine on depressive disorder. Moreover, fluoxetine exerts protective effect on hippocampal expression of Wip1 in CUMS-exposed mice. This finding is consistent with our previous study7 and further supports that Wip1 contributes to the beneficial effects of fluoxetine.The different effects of fluoxetine on Wip1 KO mice and CUMS-exposed wildtype mice were not due to the discrepancy of drug application under the situation that Wip1 KO and CUMS-exposed mice were administrated with fluoxetine at the same dosage (20 mg/kg) and duration (once a day for 14 days) before behavioral testing. One possible explanation is that Wip1 might act at a critical node (e.g., dephosphorylation of γ-H2AX) of DDR signaling pathway. Thus, when Wip1 is completely missing, the elevated γ-H2AX activity at DNA damage foci can not be recovered by fluoxetine (as shown in Fig. 3). Whereas, fluoxetine may stimulate the expression of Wip1 to reduce γ-H2AX activity in CUMS-exposed wildtype mice, and then prevent cellular senescence and depressive behaviors. Another possibility is that fluoxetine treatment upregulates brain-derived neurotropic factor (BDNF) or nerve growth factor (NGF) levels in mouse brain to provide neurotrophic support against CUMS-induced changes3740. It is likely that the damaged cellular senescence and subsequent neurobehavioral changes have already occurred in 2–3 month old Wip1 KO mice, and therefore fluoxetine is unable to provide neurotrophic support and then fails to rescue the depressive phenotype.In conclusion, our results show that depression-like behaviors are negatively correlated with Wip1 expression in mouse hippocampus. Wip1-mediated γ-H2AX dephosphorylation plays an important role in the occurrence of cellular senescence and depression, and for the therapeutic effect of fluoxetine on depressive disorder.
Methods
Animals
All animals were kept under a 12 h/12 h light/dark cycle with the light on at 07:00 AM. They were fed with standard chow and water ad libitum. Ambient temperature and relative humidity were maintained at 22 ± 2 °C and 50 ± 5%, respectively. Wip1 gene knockout mice with C57BL/6 background were generously provided from Dr. Lawrence A. Donehower at Baylor College of Medicine, USA. Primers applied for genotyping mouse tail genomic DNA were based on a previous study5 as the following: BD1: GACAGTCCTGTGCCAAAATGCT; BD2: GGTGACTTG ATTGGTGGTGTAGA; BD3: GCAGGGCTGTTTGTGGTGCT; and BD4: GCATGCT CCAGACTGCCTT. Two to three month-old male C57BL/6 wildtype mice, Wip1 KO mice and their wildtype littermates were employed in this study. All the experiments reported here were approved by the Animal Ethics Committee of Kunming Medical University. All the animal experiments were carried out in accordance with the approved guidelines.
Chronic unpredictable mild stress (CUMS)
Chronic unpredictable mild stress has been thought to be a reliable animal model for depressive mood disorder41. In this study, the procedure of CUMS was slightly modified according to a previous report by our lab7. Initially, animals were socially housed (less than 5 animals per cage) for one week to familiarize with the testing circumstance. After that, animals of CUMS groups were individually housed for handling convenience by experimenters. Animals of the control group were housed with 3–5 mice in one cage. A total of 10 mild stressors were introduced in the CUMS procedure, including cold water swimming (13 ± 1 °C, 5 min) (A), warm water swimming (37 ± 2 °C, 5 min) (B), moist bedding (8 h) (C), cage tilt (45°, 8 h) (D), cage shaking (180 rpm, 10 min) (E), tail pinch (approximately 1 cm from the tail end, 1 min) (F), food deprivation (12 h) (G), water deprivation (12 h) (H), overnight illumination (12 h) (I), and no stress (24 h) (J). Only one of the stressors was randomly applied each day for the CUMS group(s), while the control animals were left uninterrupted unless some necessary regular cage cleaning. The stress period lasted for 2 or 4 weeks for an animal to develop depression-like behaviors.
Behavioral measurements
Sucrose preference test (SPT)
SPT was used to assess the declining response to incentive stimuli42, a key symptom of depressive disorder. Food and water were deprived from the animals 24 hours before the testing. After that, two bottles were placed back with one bottle loading 1% sucrose and another loading water. All animals were individually housed, and allow freely drink water or sucrose for 10 h, starting from 8:30 AM. The amount of consumed liquid was weight by an electronic balance. The percentage of sucrose intake was calculated by the formula (sucrose intake / (sucrose intake + water intake) × 100).
Forced swimming test (FST)
Mouse was individually placed in transparent Plexiglas cylinder (25 cm high; 16 cm diameter) containing fresh water (23–25 °C) with 15 cm depth. The immobility duration was recorded for the final 4 minutes during a total of 6 minutes testing duration. A mouse was judged to be immobile when it remained floating on the water, without struggling, making only very slight movements necessary to keep its head above the water.
Tail suspension test (TST)
A mouse was suspended 35 cm above the floor by adhesive tape placed approximately 1 cm from the tip of the tail on the center of a 50-cm-long rod. The immobility duration was recorded for a total of 6 minutes testing period. Mouse was considered immobile when it hung passively and completely motionless. The observers were blind to the genotype or group of the tested animals.
Immunohistochemistry
Mouse brain was fixed by cardiac perfusion with 40–50 ml of PFA solution. Brain tissue was dehydrated in 50 ml of 15% sucrose solution for 1 day, moved to 30% sucrose solution for 1 day, carefully dissected in OCT embedding compound, and then frozen at −20 °C. After cutting the tissue by using a cryostat (CM3050S, Leica, German), tissue sections with 16 μm thick were dried overnight at room temperature. Five coronal slices (spaced by 150 μm) containing the hippocampus were immunostained. For IHC staining, immunoperoxidase secondary detection system (IHC select, DAB500, Millipore, German) was applied. Sections were washed and streamed for antigen repair (Target Retrieval Solution, DAKO, Japan). Then, sections were incubated with 3% hydrogen peroxide for 10 minutes. Blocking reagent was applied at room temperate and then the first antibody was incubated at 22 °C over night. After washing-out and incubating streptavidin HRP, chromogen reagent was applied for 1 minute and washed-out. For nuclear staining, hematoxylin counter stain solution was applied for 1 minute. After dehydrated through a graded series of alcohol and immersed in xylenes, slides were covered with mounting media and coverslip. Tissue sections were photographed under reflected light by using a 40X objective of the DM4000M digital high fidelity microscope (Leica, German). The number of γ-H2AX positive cells was counted and then the mean number of positive cells per slice was calculated.
Positive senescent cells were stained by incubating brain sections with blue-dyed SABG, a widely used biomarker specifically for senescent cells4344. SABG staining Kit (CST, United States) was used to define cellular senescence in mouse brain according to the manufacturer’s recommendations. Five coronal brain sections (spaced by 150 μm) containing the interested brain area were stained. Briefly, brain sections were incubated with the chromogenic β-gal substrate X-gal in a buffer at pH 6.0. A blue color develops in some cells within 2 h. After the staining, the sections were washed with phosphate-buffered saline (PBS). Brain sections were then stained with Nissl staining solution for 30 minutes and washed three times with PBS. Photographs were made under the reflected light by using a DM4000M digital high fidelity microscope (Leica, German). The number of SA-β-gal positive cells on each section was counted and then averaged across all selected sections for each animal. Data of each animal were pooled into their own group for statistical analyses.
Western blotting assays
Western blotting assays were carried out as previously described by our lab45. Briefly, hippocampal samples were homogenized in RIPA buffer (150 mM NaCl, 1.0% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCL, pH 8.0) containing protease and phosphatase inhibitors (Thermo, United States). Lysates were then dissolved in 2X laemmli sample buffer (Bio-rad, United States), and boiled at 95 °C for 5 minutes. Each sample of lysates (20 μl) was added into SDS-PAGE and electroblotted onto PVDF membranes. The membranes were blocked with 5% skim milk in TBS-T, and then probed with desired antibodies. Primary antibodies against Wip1 (CST, United States), H2AX (CST), γ-H2AX (CST) and β-actin (Sigma, United States) were used. Super Signal West Dura Extended Duration Substrate (Pierce, German) was used to detect antibody-antigen complexes.
Drug administration
To intervene the progression of depression-like behaviors, the common used antidepressant, fluoxetine (H20110442, Lilly, Fegersheim, France), at the dose of 20 mg/kg was intraperitoneally injected into CUMS-treated wildtype C57BL/6 mice and their controls 30 min before a stressor was applied. The fluoxetine administration was once a day lasting from 15th to 28th day during the CUMS procedure. For Wip1 KO mice and their wildtype littermates, fluoxetine (20 mg/kg) was administrated once a day for 14 days at the time of 9 AM per day. On the day of behavioral testing, fluoxetine was applied to each animal 30 min before the testing.
Data analysis
One-way or two-way analysis of variance (ANOVA) was used to analyze genotype or treatment difference among multiple groups. Post hoc Tukey’s tests were applied when needed. Unpaired t-test was used for comparison of the difference between two groups. All values were expressed as mean ± SEM.
Additional Information
How to cite this article: He, Z.-Y. et al. Gamma-H2AX upregulation caused by Wip1 deficiency increases depression-related cellular senescence in hippocampus. Sci. Rep.
6, 34558; doi: 10.1038/srep34558 (2016).
Authors: Bo Yun Lee; Jung A Han; Jun Sub Im; Amelia Morrone; Kimberly Johung; Edward C Goodwin; Wim J Kleijer; Daniel DiMaio; Eun Seong Hwang Journal: Aging Cell Date: 2006-04 Impact factor: 9.304
Authors: G P Dimri; X Lee; G Basile; M Acosta; G Scott; C Roskelley; E E Medrano; M Linskens; I Rubelj; O Pereira-Smith Journal: Proc Natl Acad Sci U S A Date: 1995-09-26 Impact factor: 11.205
Authors: C B Filho; C R Jesse; F Donato; R Giacomeli; L Del Fabbro; M da Silva Antunes; M G de Gomes; A T R Goes; S P Boeira; M Prigol; L C Souza Journal: Neuroscience Date: 2015-01-12 Impact factor: 3.590
Authors: Anders Jorgensen; Jesper Krogh; Kamilla Miskowiak; Tom G Bolwig; Lars V Kessing; Anders Fink-Jensen; Merete Nordentoft; Trine Henriksen; Allan Weimann; Henrik E Poulsen; Martin B Jorgensen Journal: J Affect Disord Date: 2013-03-13 Impact factor: 4.839
Authors: Bart Cornelissen; Veerle Kersemans; Sonali Darbar; James Thompson; Ketan Shah; Kate Sleeth; Mark A Hill; Katherine A Vallis Journal: Cancer Res Date: 2011-05-17 Impact factor: 12.701
Authors: Brendan D Hare; Tina M Thornton; Mercedes Rincon; Borivoj Golijanin; S Bradley King; Diane M Jaworski; William A Falls Journal: Neuroscience Date: 2018-01-17 Impact factor: 3.590
Authors: Alana Gomes de Souza; Iardja Stéfane Lopes; Adriano José Maia Chaves Filho; Talita Matias Barbosa Cavalcante; João Victor Souza Oliveira; Michele Albuquerque Jales de Carvalho; Klistenes Alves de Lima; Paloma Marinho Jucá; Sabrina Silva Mendonça; Melina Mottin; Carolina Horta Andrade; Francisca Cléa Florenço de Sousa; Danielle S Macedo; Marta Maria de França Fonteles Journal: Naunyn Schmiedebergs Arch Pharmacol Date: 2022-06-04 Impact factor: 3.195
Authors: Cory M Dungan; Bailey D Peck; R Grace Walton; Zhengyan Huang; Marcas M Bamman; Philip A Kern; Charlotte A Peterson Journal: FASEB J Date: 2020-04-04 Impact factor: 5.191
Authors: Daniel Esteve; María Micaela Molina-Navarro; Esther Giraldo; Noelia Martínez-Varea; Mari-Carmen Blanco-Gandia; Marta Rodríguez-Arias; José Manuel García-Verdugo; José Viña; Ana Lloret Journal: Mol Neurobiol Date: 2021-12-11 Impact factor: 5.590