Prevalence of Virulence Factors and Vancomycin-resistant Genes among Enterococcus faecalis and E. faecium Isolated from Clinical Specimens.

BACKGROUND: The aim of this study was to determine the occurrence of virulence determinants and vancomycin-resistant genes among Enterococcus faecalis and E. faecium obtained from various clinical sources.
METHODS: The study was performed on the 280 enterococcal isolated from clinical specimens in Hamadan hospitals, western Iran in 2012-14. Antibiotic susceptibility testing was performed using disk diffusion and Minimal Inhibitory Concentration (MIC) methods. The presence of vancomycin-resistant genes and virulence genes was investigated using PCR.
RESULTS: Totally 280 enterococcal isolates were identified as follows: E. faecalis (62.5%), E. faecium (24%) and Enterococcus spp (13.5%). The results of antibiotic susceptibility testing showed that resistance rates to vancomycin and teicoplanin in E. faecalis and E. faecium isolates were 5% and 73%, respectively. Of Sixty vancomycin-resistant Enterococci strains, fifty-one isolates were identified as E. faecium (VREfm) and nine as E. faecalis (VREfs). Prevalence of esp, hyl, and asa1 genes were determined as 82%, 71.6%, and 100%, respectively in E. faecium strains; and 78%, 56/6%, and 97%, respectively in E. faecalis strains.
CONCLUSION: The increased frequency of VREF, as seen with rapid rise in the number of vanA isolates should be considered in infection control practices.

Introduction

Vancomycin-resistant Enterococci (VRE) strains were reported first in United Kingdom and France in 1986, and after that in the United States (1). At present, these organisms are significantly isolated in hospitals around the world, especially in patients with hemato-oncological diseases and hospitalized in intensive care units (2). Currently, nine types of vancomycin-resistance have been described in Enterococci, eight of these types correspond to acquired resistance, i.e., vanA, vanB, vanD, vanE, vanG, vanL, vanM and vanN; one type-VanC-have been identified in species of Enterococcus gallinarum and E. casseliflavus–E. flavescens intrinsically resistant to low levels of vancomycin but remain susceptible to teicoplanin and have been found in human intestinal tract (3, 4).

Among vancomycin-resistance genotypes in Enterococci, vanA and vanB possess greatest clinical significance (5). The vanA genotype is the most commonly genotype in VRE worldwide, and is associated with the transfer of a considerable amount of vancomycin resistance from Enterococci, particularly, vancomycin-resistant E. faecium (VREF) to Staphylococcus aureus (1, 6). The vanA-type genes play an important role in inducing resistance against both teicoplanin and vancomycin, while the level of resistance to vancomycin in strains sheltering vanB-type genes are not constant but somewhat variable (MICs, 4 to 1,024 mg/l). Moreover, remain susceptible to teicoplanin (MICs, ≤ 2 mg/l) in vitro (4). The low-level resistance against such antibiotics as vancomycin vancomycin (vancomycin [MIC], 64–128 mg/ml) and susceptibility or intermediate resistance to teicoplanin (teicoplanin MIC, 8–16 mg/ml) is one of the main features of the vanD phenotype (7).

Although these organisms lacking strong virulent factors, but enterococcal infection is intricated by the intrinsic resistant / tolerant to many important antimicrobial agents including cephalosporin, lincomycin, cotrimoxazole, and low levels of penicillin and aminoglycosides, and as well as by the ability to acquire resistance to penicillins, chloramphenicol, tetracyclines, aminoglycosides (high-level) and vancomycin either by mutation, or by acquisition of plasmids or transposons (8, 9). Thus, the incidence of antimicrobial resistant Enterococci, especially VRE is a persisting clinical problem in public health care facilities in all geographical areas (9). Cytolysin (Cyl), gelatinase (GelE) and aggregation substance (Agg) are virulence factors identified in E. faecalis that can influence the relationship between parasite and host, on other hand, esp and hyl have been found in both E. faecalis and E. faecium (10, 11). “These virulence factors may causes increasing persistence of enterococci in the nosocomial environment, and consequently inter and intra-hospitals dissemination” (10).

Regarding the virulence determinants in clinical isolates of Enterococci that may result in promoting emergence of infections and persistence of this organism in nosocomial settings and consequently leads to increased resistance (5), this study was undertaken to determine the antimicrobial susceptibility patterns and virulence factors including esp (enterococcal surface protein), asa (aggregation substance), gelE (gelatinase), hyl (hyaluronidase) in clinical isolates of E. faecalis and E. faecium.

Materials and Methods

Identification of enterococcal isolates

One hundred and seventy-five E. faecalis and sixty-seven E. faecium isolates were collected from different clinical specimens submitted in three teaching hospitals located in Hamedan/ western Iran, from Dec 2012 to May 2014. The origins of isolates were as follows: urine 200 (82.6%), tracheal 17 (7%), blood 8 (3.3%), wound 6 (2.5%), abscess and lower respiratory tract 6 (2.5%), and body fluids 5 (2.1%). Enterococcus genus were identified using routine microbiological methods (9) then, PCR targeting D-alanine- D-alanine ligases specific for E. faecalis (ddl E. faecalis) and E. faecium (ddl E. faecium) was used to confirm phenotypic speciation (12).

DNA extraction

Enterococci chromosomal DNA was extracted by boiling method. Briefly, 3–5 clones of overnight bacterial culture was suspended in 500 μl of sterile distilled water, boiled for 10–15 min, and then centrifuging at 14000 g for 5 min to pellet cell debris (13).

Detection of E. faecalis and E. faecium species by PCR

PCR reactions of ddl E.faecalis and ddl E.faecium genes were performed with previously designed primers (Table 1), with some modification on Kariyama’s protocol (12) using Eppendorf and Biorad thermocycler (ASTEC Co., Japan) in a final volume of 20 μl containing 2 μl template DNA, 1 μl of each primer, 10 μl of Master Mix, 6 μl of sterile distilled water. The optimum conditions of PCR for both genes were as follows: an initial denaturation at 95 °C for 5 min, followed by amplification by 30 cycles of denaturation at 95 °C for 30 sec, annealing at 52.5 °C for 30 sec and elongation at 72 °C for 1 min, and a final extension at 72 °C for 10 min. The E. faecalis ATCC 29212 and E. faecium BM4147 were used as quality control strains.

Table 1:

Primers used in this study

Gene targets	Primer sequences (5′ to 3′)	amplicon / product size (bp)	Reference
asa1	F: GCACGCTATTACGAACTATGAR: TAAGAAAGAACATCACCACGA	375	13
hyl	F: ACAGAAGAGCTGCAGGAAATGR: GACTGACGTCCAAGTTTCCAA	276	13
esp	F: AGATTTCATCTTTGATTCTTGGR: AATTGATTCTTTAGCATCTGG	510	13
ddl E. faecalis	F: ATCAAGTACAGTTAGTCTTTATTAGR: ACGATTCAAAGCTAACTGAATCAGT	941	12
ddl E. faecium	F: TTGAGGCAGACCAGATTGACGR: TATGACAGCGACTCCGATTCC	658	12
vanA	F: GGGAAAACGACAATTGCR: GTACAATGCGGCCGTTA	732	12
vanB	F: ATGGGAAGCCGATAGTCR: GATTTCGTTCCTCGACC	635	12
vanD	F: TGTGGGATGCGATATTCAAR: TGCAGCCAAGTATCCGGTAA	500	14

Antibiotic susceptibility testing

Antibiotic susceptibility testing of 175 E. faecalis strains and 67 E. faecium strains was performed using Kirby-Bauer disk diffusion method on Muller-Hinton agar in according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (14). Antimicrobial agents used in this study were included: vancomycin (30 μg), teicoplanin (30 μg), tetracycline (30 μg), erythromycin (15 μg), norfloxacin (10 μg), ciprofloxacin (5 μg), nitrofurantoin (300 μg), quinopristin-dalfopristin [synercid (15 μg)] (Mast co., UK), chloramphenicol (30 μg), linezolid (30 μg), gentamicin (10 μg), and ampicillin (10 μg) (HiMedia Mumbai Co., India).

Determination of minimum inhibitory concentration (MIC) of the glycopeptide antibiotics i.e. vancomycin and teicoplanin (Sigma-Aldrich, Poole, Co., UK) for E. faecalis and E. faecium isolates was done using microdilution broth method and Cation Adjustment Muller Hinton Broth (CAMHB) medium according to the CLSI guidelines (14). The E. faecalis ATCC 29212 (Vancomycin sensitive), E. faecalis ATCC 51299 (vanB positive), E. faecalis E206 (vanA positive) were used as quality control strains for performing antimicrobial tests.

Detection of van determinants

Isolates with a vancomycin and teicoplanin Minimum Inhibitory Concentration (MIC) of 2 μg/ml were analyzed by PCR for the presence of the genes encoding the vancomycin-resistance determinants vanA, vanB, vanD using specific primers (Table 1). The PCR reaction was performed in a volume of 20 μl and contained: 2 μl template DNA, 1 μl of each primer, 10 μl of Master Mix, 6 μl of sterile distilled water on a Eppendorf and Biorad thermocycler (ASTEC Co., Japan) with an initial denaturation at 94 °C for 3 min, 30 cycles of amplification (denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min, and extension at 72 °C for 1 min), and a final extension at 72 °C for 7 min (12).

Detection of virulence genes esp, hyl, and asa 1 by PCR

Identify of three virulence determinants in all E. faecalis and E. faecium isolates was performed by Multiplex PCR (esp, asa ) and single PCR (hyl) using specific primers for each gene (Table 1), with some modification on Vankerckhoven’s protocol. the first 25 μl of PCR mixture contained 3 μl of template DNA (1μl of plasmid DNA, 2 μl of chromosome DNA), 1μl of each primer for genes esp and asa , 12.5 μl of Master Mix, and 5.5 μl of sterile distilled water; the second 20 μl PCR mixture contained 2 μl of template DNA, 1 μl of each primer for hyl, 10 μl of Master Mix, and 6 μl of sterile distilled water. The PCR conditions included a pre-denaturation step at 95 °C for 10 min, followed by 30 cycles of 1 min at 94 °C, 1 min at 56 °C and 1 min at 72 °C. A final extension step was performed at 72 °C for 10 min (13). The E. faecalis ATCC 29212 (asa1 positive), E. faecium C68 (hyl and esp positive) were used as quality control strains.

Statistical analysis

Data were analyzed statistically using Chi-Square test and difference was considered significant at P<0.05 by SPSS software version 19 (Chicago, IL, USA).

Results

Enterococci isolates

Of 280 enterococcal isolates, 190 (67.8%) isolates were identified as E. faecalis, 75 (26.8%) as E. faecium and 15 (5.4%) as Enterococcus spp., using biochemical methods. Overall, 175 (62.5%) E. faecalis strains (5.62%) and 67 E. faecium strains (24%) were confirmed by the PCR method. A total of 38 strains (13.5%) have remained to the Enterococcus genus. The most of isolates 95 (39.3%) were collected from internal ward, followed by Outpatient ward with 72 (29.8%), Nephrology 26 (10.7%), ICU 22 (9.1%), Emergency 21 (8.7%), Burn 3 (1.2%), and Surgeryandcardiaccare 3 (1.2%).

Antimicrobial susceptibility testing

Resistance to the majority antibiotics except for chloramphenicol, tetracycline, and quinopristin-dalfopristin was higher in E. faecium isolates than E. faecalis isolates. However, they showed good rate of sensitivity to linezolid (100%), nitrofurantoin and chloramphenicol (74.6%). All isolates of E. faecalis were susceptible to nitrofurantoin. None of the Enterococcus isolates was resistant to linezolid. The susceptibility patterns of E. faecium and E. faecalis to antibiotics are presented in Table 2.

Table 2:

Antibiotic resistance behavior of Enterococci isolates with disk diffusion

Antimicrobial agent	Percent of E. faecalis isolates (n=175)			Percent of E. faecium isolates (n=67)			Total
	S	I	R	S	I	R	S	I	R
Vancomycin	95	0	5	24	0	76	75.2	0	24.8
Teicoplanin	95	0	5	27	0	73	76	0	24
Ampicillin	96.6	0	3.4	39.3	0	62.7	80.2	0	19.8
Tetracycline	9.7	2.3	88	21	6	73	12.8	3.3	83.9
Ciprofloxacin	36.6	24	39.4	0	19.4	80.6	26.5	22.7	50.8
Norfloxacin	63	4	33	0	16.4	83.6	45.5	7.4	47.1
Erythromycin	26.3	11.4	62.3	0	13.4	86.6	19	12	69
Synercid	4.6	0	95.4	24	6	70	10	1.6	88.4
Chloramphenicol	54.3	13.1	32.6	74.6	15	10.4	60	13.6	26.4
Gentamicin	56	8	36	1.5	6	92.5	41	734	51.6
Nitrofurantoin	100	0	0	74.6	0	25.4	93	0	7
Linezolid	100	0	0	100	0	0	100	0	0

Of 175 isolates of E. faecalis, resistance of 9 and sensitivity of 166 isolates to vancomycin and teicoplanin were confirmed by microdilution broth method.

Of 67 isolates of E. faecium, 51 strains were resistant to vancomycin by disk diffusion method, but resistance of 49 strains to vancomycin was confirmed by Microdilution Broth. Two strains of E. faecium determined as resistant strains by disk diffusion using Microdilution Broth were identified as intermediate strains, corresponded with identification vanB gene in these two strains (Table 3).

Table 3:

Results of MIC for glycopeptides antibiotics of vancomycin and teicoplanin in E. faecium and E. faecalis strains

Antimicrobial agent	E. faecium					E. faecalis
	Teicoplanin		Vancomycin			Teicoplanin		Vancomycin
Sensitivity Status	S	R	S	I	R	S	R	S	R
MIC (μg/ml)	8≤	32≥	4≤	8–16	32≥	8≤	32≥	4≤	32≥
Number	18	49	16	2	49	166	6	166	9
Percent (%)	26.9	73.1	24	3	73	95	5	95	5

Analysis of vanA-vanB-vanD types vancomycin resistance genes

All VRE and 49 of VRE strains (96.7%) had high-level resistance to vancomycin and teicoplanin carried the vanA gene. Two VRE isolates (3.3%) had moderate-Level resistant to vancomycin with MIC=8 μg /ml and were insensitive to teicoplanin, carried the vanB gene, vanD gene was identified in none of VRE strain.

Prevalence of virulence genes in E. faecalis and E. faecium strains

Among the E. faecalis strains, the asa gene was the most prevalent factor, followed by the esp and hyl genes; additionally, in E. faecium strains, the asa gene was the highest prevalence and hyl gene has the lowest frequency, followed by the esp gene.

Results of statistical analysis

Using SPSS software, there were significant correlations between the disk diffusion agar and broth microdilution methods for vancomycin and teicoplanin antibiotics (P≤0.001); and between PCR and MIC Vanco and MIC Teico results (P≤0.001) in strains of E. faecalis and E. faecium.

Discussion

In the present study, of 280 enterococcal isolates, 175 isolates were identified as E. faecalis, 67 as E. faecium and 38 as Enterococcus spp. The prevalence of E. faecalis strains were reported 76% and 55.5% respectively (15, 9). In Iran, the prevalence of E. faecalis and E. faecium strains were reported 77.5% and 22.5%, 70.4% and 18.5%, 85.3% and 10.8%, 28% and 71%, respectively (8, 16–18). VRE strains are resistant to different classes of antibiotics simultaneously. Rising high-level resistance to penicillin, ampicillin and aminoglycosides has been demonstrated in recent years, especially in vancomycin-resistant E. faecium strains. Multidrug-resistant strains of Enterococci, especially E. faecalis and E. faecium are serious problems in treatment patients with enterococcal infections due to improper use of antibiotics (19). In the current study, 85% of strains of E. faecalis and all E. faecium strains had multidrug resistance, but strains of vancomycin-resistant compared to susceptible strains were resistant to greater number of antibiotic classes.

In the current study, the prevalence of vancomycin resistance was found 24%, which was consistent with some previous (9, 20). The prevalence of vancomycin resistance in Enterococcus strains were reported 23.3% and 29%, respectively. Similar studies in Iran reported the prevalence of vancomycin resistance in Enterococcus strains as 24.10%, 16.9%, 14.6%, 25%, 22%, respectively (16, 18, 21–23). According to typing results of genotypes for resistance to vancomycin, vanA-type was the most common genotype seen among VRE strains obtained in Hamadan and vanB is the second. Majority of the VRE isolates (96.8%) have the vanA gene, 3.3% of VRE isolates with vanC, and vanB genotype was identified in any VRE strains (24). All VRE strains (100%) carrying the vanA gene; but vanB-C-D-E-G genotypes were not reported (25). The frequency of genes vanA and vanB among VRE strains were identified 85% and 15%, 62.5% and 37.5%, 69.23% and 15.38% respectively (16). Increase in the prevalence of VRE, especially E. faecium, in different countries has been attributed mainly to the incidence and diffusion of vanA and vanB positive VRE, which exhibited some virulence factors such as Esp (esp), cytolysin (cyl), and hyaluronidase (hyl). The extracellular surface protein (esp), encoded by the chromosomal esp gene, found on pathogenicity island in multidrug-resistant pathogenic lineages of both E. faecalis and E. faecium strains. Esp is a cell wall-associated protein which contribute to the colonization and persistence of E. faecalis strains in ascending infections of the urinary tract. In addition, Esp may participate in biofilm formation, and may also be involved in antimicrobial resistance (26, 27). Blood and wound infections caused by Enterococci strains are mediated by Esp protein (28). In a study, the gene esp was detected only in E. faecalis strains (29). However, incidence of the gene esp in clinical E. faecium are increasing compared to clinical E. faecalis isolates (30).

In the present study, prevalence of the genes esp and hyl were significantly higher among ampicillin-resistant VRE isolates (53.7%, 37.3%) compared to ampicillin-susceptible VRE isolates (19.4%, 22.4%). This finding is in accordance with the reported results of other related studies (32–34). In our study, the frequency of the gene asa, (which encodes aggregation substance) among E. faecalis was as high as 97 percent and among E. faecium strains was as high as 100 percent. This gene has a high incidence in E. faecalis, as well. Results of studies on clinical E. faecium isolates are contradictory. Previous studies detected this virulence factor among 5%, 65% of VRE and 2.7%, 60% of VRE strains (26, 35). S Jahangiri et al. (11) did not found gene asa in either 49 of VRE strains or 17 of VSE strains.

Hyaluronidase, coded by the chromosomal gene hyl, is a degradative enzyme associated with tissue damage that influence on the hyaluronic acid (hyaluronate, HA) (33). We found the hyl gene among 49.3% of VRE isolates and 22.4% of VSE isolates, which is in accordance to Rice et al. results (36), who detected the hyl gene among 71% of the United Kingdom VRE isolates; but it was in contrast to another study (11), who detected gene hyl among 80% of VSE isolates and in 28.5% of VRE isolates. Most of esp-positive isolates were resistant to more than 3 antibiotics (11, 37). Laud B et al. (38) demonstrated that the strong correlation between the carriage of gene esp and antimicrobial resistance could be due to the higher conjugation frequencies in strains carrying the esp gene than strains lacking this gene. E. faecium strains carrying the gene esp were resistant to more than 90% of the antibiotics tested and 64% of E. faecium strains were resistant to vancomycin (5).

Considering these results, the gene esp facilitates E. faecium isolates ability to acquire antibiotic resistance genes. The expression level of gene esp depending on growth conditions constantly vary between strains of E. faecium and is associated with initial connection and biofilm formation (39).

Conclusion

Due to increasing resistance rate of Enterococci to most common antibiotics, applying the preventive and control measures are required.

Ethical considerations

Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.