Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma.

We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21)[8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA‑sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in‑frame TBCK‑P4HA2 and the reciprocal but out‑of‑frame P4HA2‑TBCK fusion transcripts. The putative TBCK‑P4HA2 protein would contain the kinase, the rhodanese‑like domain, and the Tre‑2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4‑hydroxylase. The t(5;8;17)(p15;q13;q21) three‑way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in‑frame fusions AHRR‑NCOA2 and NCOA2‑ETV4 as well as an out‑of‑frame ETV4‑AHRR transcript. In the AHRR‑NCOA2 protein, the C‑terminal part of AHRR is replaced by the C‑terminal part of NCOA2 which contains two activation domains. The NCOA2‑ETV4 protein would contain the helix‑loop‑helix, PAS_9 and PAS_11, CITED domains, the SRC‑1 domain of NCOA2 and the ETS DNA‑binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR‑NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor.

Introduction

Angiofibroma of soft tissue is a recently described benign fibrovascular tumor of unknown cellular origin (1). It arises most commonly in the extremities of middle-aged adults but displays a broad anatomic and age distribution. Microscopically, it is characterized by bland, uniform, probably fibroblastic spindle cell set in an abundant fibromyxoid stroma, with a prominent and highly characteristic vascular pattern composed of innumerable branching, thin-walled blood vessels (1). Cytogenetic knowledge about angiofibroma of soft tissue is based on the analysis of six such tumors of which four showed a balanced t(5;8)(p15;q12) translocation and a fifth tumor showed a three-way t(5;8;8)(p15;q13;p11) (1). Molecular analysis of four tumors carrying the t(5;8)(p15;q12) showed in-frame AHRR-NCOA2 and NCOA2-AHHR fusion transcripts in all of them (2). A GTF2I-NCOA2 fusion gene was detected in a fifth tumor carrying a t(7;8;14)(q11;q13;q31) as the sole chromosome change (3). To the best of our knowledge, the above-mentioned tumors are the only angiofibromas of soft tissue which have been investigated both cytogenetically and molecularly for fusion genes. An additional angiofibroma of soft tissue with t(5;8)(p15;q12) was also reported but without molecular analysis (4). In three other studies, fluorescence in situ hybridization (FISH) was performed with probes for NCOA2 showing rearrangements of the NCOA2; however, no further investigation of fusion genes was performed (5–7).

We report here an angiofibroma of soft tissue which had the chromosome translocations t(4;5)(q24;q31) and t(5;8;17)(p15;q13;q21) and identified the fusion genes generated by the two translocations. Our data show that, in addition to the reported AHRR-NCOA2, the tumor carried also other fusion genes resulting from the chromosomal aberrations that might have contributed to tumorigenesis as well.

Materials and methods

Ethics statement

The study was approved by the regional Ethics Committee (Regional komité for medisinsk forskningsetikk Sør-Øst, Norge; http://helseforskning.etikkom.no), and written informed consent was obtained from the patient to publication of the case details. The Ethics Committee's approval included a review of the consent procedure. All patient information has been de-identified.

Case history

The patient was a 45-year-old male in whom MRI of the abdomen and pelvis showed a 53-mm tumor in the right inguinal region partially surrounding large vessels. The patient had been aware of the lesion for several years. Surgery was performed with removal of the entire tumor including part of the right deep femoral artery with immediate reconstruction of the vessel. The postoperative period was eventless and to date there is no sign of tumor relapse.

The specimen (58×45×45 mm) showed an encapsuled, well-circumscribed tumor with a homogenous gray/white cut surface. There were no signs of necrosis or bleeding. Routine microscopy showed a tumorous proliferation of small, spindled cells without atypia or mitotic activity (Fig. 1A–C). There were a lot of small, thin-walled blood vessels in the background (Fig. 1A–C). Immunohistochemical examination showed low proliferative activity (MIB1/Ki67 <5%) (Fig. 1D) and the vessels highlighted by the endothelial marker CD34 (Fig. 1E). The clinical setting as well as histopathological features fit well with a diagnosis of angiofibroma of soft tissue (1).

Figure 1

Microscopic examination of the angiofibroma of soft tissue. (A) H&E-100×. (B) H&E-200×. (C) H&E-400×. (D) Immunoexpression of MIB1-200×. (E) Immunoexpression of CD34-200×.

G-banding and karyotyping

Fresh tissue from the tumor was processed for cytogenetic analysis as part of our diagnostic routine. The sample was disaggregated mechanically and enzymatically with collagenase II (Worthington Biochemical Corp., Freehold, NJ, USA). The resulting cells were cultured and harvested using standard techniques. Chromosome preparations were G-banded with Wright stain and examined. The karyotype was written according to the International System for Human Cytogenetic Nomenclature (ISCN) 2013 guidelines (8).

High-throughput paired-end RNA-sequencing

Total RNA was extracted using miRNeasy Mini Kit according to the manufacturer's instructions (Qiagen, Hilden, Germany). Tumor tissue was disrupted and homogenized in QIAzol Lysis Reagent (Qiagen) using a 5-mm stainless steel bead and TissueLyser II (Qiagen). Subsequently, total RNA was purified using QIAcube (Qiagen). The RNA quality was evaluated using the Experion Automated Electrophoresis System (Bio-Rad Laboratories, Oslo, Norway). The RNA quality indicator (RQI) was 8.5. Total RNA (3 µg) was sent for high-throughput paired-end RNA-sequencing at the Norwegian Sequencing Centre, Ullevål Hospital (http://www.sequencing.uio.no/). Detailed information about the high-throughput paired-end RNA-sequencing was given elsewhere (9). The software FusionCatcher (10) (https://github.com/ndaniel/fusioncatcher) was used for the discovery of fusion transcripts.

Molecular genetic analyses

The primers used for PCR amplification and sequencing are listed in Table I. The primer combinations, target fusion transcripts, and results of PCR amplifications are shown in Table II. cDNA was synthesized from 2 µg of total RNA in a 20-µl reaction volume using iScript Advanced cDNA Synthesis Kit for RT-qPCR according to the manufacturer's instructions (Bio-Rad Laboratories). cDNA was diluted to 100 µl and 2 µl were used as template in subsequent PCR assays. The 25-µl PCR volumes contained 12.5 µl of Premix Taq (Takara Bio Europe SAS, Saint-Germain-en-laye, France), 1 µl of diluted cDNA, and 0.4 µM of each of the forward and reverse primers (Table II). The quality of the cDNA synthesis was examined by amplification of a cDNA fragment of the TBCK gene using the primers TBCK-2558F1 and TBCK-2908R1. The PCRs were run on a C1000 Thermal cycler (Bio-Rad Laboratories) with the following cycling for the amplifications: an initial denaturation at 94°C for 30 sec, 35 cycles of 7 sec at 98°C, 7 sec at 60°C, 1 min at 72°C, and a final extension for 5 min at 72°C.

Table I

Primers used for PCR amplification and Sanger sequencing analyses.

Name	Sequence (5′→3′)	Position	Reference sequence	Gene
TBCK-2908R1	TGGCGTGGATATGAAGAACTGTGC	2931–2908	NM_033115.4	TBCK
TBCK-2558F1	CCTGGTGGTTGACATCCGGAATAG	2558–2581	NM_033115.4	TBCK
P4HA2-785R1	AGCCAGGTAGCCCTCAGCATCAG	807–785	NM_004199.2	P4HA2
P4HA2-33F1	CCGCGGGAGGTTCTGGAAAC	33–52	NM_001142598.1	P4HA2
NCOA2-intr14-R1	CACCATGTCGAGACTGCTGGCTC	71106777–71106799	NC_018919.2	NCOA2
NCOA2-3364R1	TCACTCGGAGACTCAGCTGCAGG	3386–3364	NM_006540.2	NCOA2
NCOA2-2858F1	CTGGACCTTTCCCACCAATCAGAA	2858–2881	NM_006540.2	NCOA2
ETV4-1496R1	GGGGCTCTCATCCAAGTGGGAC	1517–1496	NM_001986.2	ETV4
ETV4-863F1	TGGGGTCAATGGGCACAGGTAC	863–884	NM_001986.2	ETV4
AHRR-1932R1	TGCAGGGTGGAAAGGGGTCAG	1952–1932	NM_020731.4	AHRR
AHRR-1503F1	AGCAGACCCATGCGGGATGTC	1503–1523	NM_020731.4	AHRR
AHRR-1425F1	TGTGTCCAGGGCACTTTCAGGAA	1425–1447	NM_020731.4	AHRR
EGFL7-353F1	ACCCCAAAGCCACATCTGTAGCC	353–375	NM_016215.4	EGFL7
MCF2l-3271R1	CGCCACGACCGTGTATTTACCTG	3293–3271	NM_024979.4	MCF2L
CYP1B1-132F1	TCAACGCTGTGAGGAAACCTCGA	132–154	NM_000104.3	CYP1B1
CLU-1164R1	GACCTGGAGGGATTCGTCGAGC	1185–1164	NM_001831.3	CLU

Table II

Primer combinations, target fusion transcripts and results of PCR amplification.

Primer combination	Target fusion transcripts	Results
P4HA2-33F1/TBCK-2908R1	P4HA2-TBCK	Positive
TBCK-2558F1/P4HA2-785R1	TBCK-P4HA2	Positive
AHRR-1503F1/NCOA2-intr14-R1	AHRR-NCOA2	Positive
AHRR-1425F1/NCOA2-3364R1	AHRR-NCOA2	Positive
ETV4-863F1/AHRR-1932R1	ETV4-AHRR	Positive
NCOA2-2858F1/ETV4-1496R1	NCOA2-ETV4	Positive
EGFL7-353F1/MCF2L-3271R1	EGFL7-MCF2L	Negative
CYP1B1-132F1/CLU-1164R1	CYP1B1-CLU	Negative

The PCR products were analyzed on a QIAxcel Advanced System according to the manufacturer's instructions (Qiagen). The remaining PCR products were purified using the QIAquick PCR Purification Kit or the QIAquick Gel Extraction Kit (both from Qiagen) and direct sequenced using the dideoxy procedure with the ABI Prism BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on the Applied Biosystems 3500 Genetic Analyzer sequencing system. The BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/) was used for computer analysis of the sequence data.

Results

Cytogenetic analysis

The G-banding analysis showed that the tumor had two cytogenetically unrelated clones. The first clone, found in eight metaphases, had the t(4;5)(q24;q31) and t(5;8;17)(p15;q13;q21) chromosome aberrations (Fig. 2A). The second, found in two metaphases, had the t(1;14)(p31;q32) abnormality (Fig. 2B). This yielded the following karyotype: 46,XY,t(4;5)(q24;q31),t(5;8;17) (p15;q13;q21)[8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3].

Figure 2

Cytogenetic analysis of the angiofibroma of soft tissue. (A) Partial karyotype showing from left to right the chromosomes 4, der(4)t(4;5) (q24;q31), der(5)t(4;5)(q24;q31), der(5)t(5;8;17)(p15;q13;q21), 8, der(8)t(5;8;17) (p15;q13;q21), der(17)t(5;8;17)(p15;q13;q21), and 17. (B) Partial karyotype showing the der(1)t(1;14)(p31;q32) and der(14)t(1;14)(p31;q32) together with the corresponding normal chromosome homologs. Breakpoint positions are indicated by arrows.

High-throughput paired-end RNA-sequencing analysis

Using the FusionCatcher software with the FASTQ files obtained from the Norwegian Sequencing Centre, Ullevål Hospital (http://www.sequencing.uio.no/), 39 potential fusions were found: 28 fusions were described as readthrough short-distance fusions and 5 as pseudogenes (Table III). Among the other fusions, the program detected the P4HA2-TBCK and the reciprocal TBCK-P4HA2. According to the UCSC genome Browser on Human, Feb. 2009, (GRCh37/hg19) assembly (http://genome-euro.ucsc.edu/cgi-bin/hggateway), P4HA2 maps on chromosome subband 5q31.1 and TBCK on band 4q24. Thus, the two fusions P4HA2-TBCK and the reciprocal TBCK-P4HA2 most probably were the result of the balanced chromosome translocation t(4;5)(q24;q31). FusionCatcher also detected AHRR-NCOA2 and ETV4-AHRR which correspond to the three-way t(5;8;17)(p15;q13;q21) found in the tumor. The three genes AHRR, NCOA2, and ETV4 map to chromosome subbands 5p15.33, 8q13.3, and 17q21.31, respectively (https://genome.ucsc.edu/). In the three-way t(5;8;17), the moving of 5p15 to 8q13 generated the AHRR-NCOA2 fusion whereas the translocation of 17q21 to 5p15 generated the ETV4-AHRR. We assume that the moving of 8q13 to 17q21 would have generated an NCOA2-ETV4 fusion but no such fusion was, for unknown reasons, detected by FusionCatcher. The fusion transcrips EGFL7-MCF2L and a CYP1B1-CLU were also detected by the analysis with FusionCatcher, in all likelihood generated by t(9;13)(q34;q34) and t(2;8)(p22.2;p21.1), respectively. No fusion gene corresponding to the cytogenetically detected t(1;14)(p31;q32) was found.

Table III

Fusion transcripts detected using FusionCatcher.

5′-Partner gene	3′-Partner gene	Fusion description	Fusion sequence
PCDP1	TMEM177	Readthrough	ATTCTAGAATGAAAGTCACCAGTAG*gaaagggaacatcacagaaaggtga
MIR155HG	JAM2	Readthrough	CAAGGAGACGCTCCTGGCACTGCAG*atcataaggcctatgggttttctgc
GOLT1A	KISS1	Readthrough	ATGATCTCCATCACCGAATGGCAGA*cctcaaggcacttctaggacctgcc
SHISA9	U91319.1	Readthrough	AAGTACGCCTCCTTAAAGGCAGTCG*agctggaacacccttcttctcctgc
VPS45	PLEKHO1	Readthrough	GCACCACAGTGCACAACACGAAAAG*ggacctcaggatggaaaccagcagc
P4HA2	TBCK		AACGCCGGGAGCTGCGAGTGTCCAG*tttgcagctcaccttgtgaagatga
TBCK	P4HA2		GCATGTGGCAAAACACACAGCTGAG*acacttccctctgtgaccatgaaac
ADCK4	NUMBL	Readthrough	TCCAGCCTCTCAGTGTGTTGGAGAG*acggggcgggcaccatgaacaagtt
ETV4	AHRR		AAGGTCAGAGAAGTGACTGTTGATG*ggggacctgtgtggtccgacgctgc
FOSB	PPM1N	Readthrough	TCCACCCACCGCCGCCGCCTCCCAG*aaggggcaggatggggctgggaagt
MFSD7	ATP5I	Readthrough	GGGGAGGATCCACTTGACTGGACAG*attacctaaaacctcgggcagaaga
DPY19L2	DPY19L2P2	Pseudogene	TTCTTCATCTTTGTTAATGACGTGG*ctaattcaaggtagtgcctggtggt
DPY19L2P2	DPY19L2	Pseudogene	TTCTTCATCTTTGTTAATGACATGG*ctaattcaaggtagtgcctggtggt
MATR3	PAIP2	Readthrough	CCGCGTCCCGCTCGCTGGGAGAGAG*gttaaaaacgacaaccaacatcagc
LINC00893	LINC00894	Antisense	AGGAAGCAGGAATGCTGGAGATGAG*acggagttttgctcttgttgcccag
PTPRG	C3ORF14	Readthrough	GAGGCCTGGAGTATTCACAGACATT*ggcaagcactttaaccttttaagcc
SIX3	AC012354.6	Readthrough	AGACACCGGCACCTCCATCCTCTCG*acaaggccacctacatcccaagcca
CTBS	GNG5	Readthrough	GCGGGCTCCTTATTATAACTATAAA*gtttcccaggcagctgcagacttga
CYP1B1	CLU	Readthrough	CGAGTGGGAGTTAAAGCTTCCAGTG*aaggcgacgatgaccggactgtgtg
ZBTB16	NNMT	Readthrough	CGGGACCCCCTCAGCCTCATTTCTG*aagggctgaactgatggaaggaatg
KB-1507C5.4	ATP6V1C1	Readthrough	TCCATGTCGTAAGTTACACAAGAAG*aatctctcttgatttttgaggaaat
PPP1R21	STON1	Readthrough	TGACACACTAAAGATGTCCAGTAAg*gagggagcgctctcccctcctctgg
SUZ12	SUZ12P	Pseudogene	GAAACTCCAGAACAAACATCAAAAG*cttgtcagctcatttgcagcttaca
SUZ12P	SUZ12	Pseudogene	AAATGACAGTATTTGATAAAAACAG*aggctgcctccattcgaaacatttt
TREM2	TREML1	Readthrough	CTGCTCATCTTACTCTTTGTCACAG*catccccttgatctggggtgctgtg
TRIM2	MND1	Readthrough	CGACTGGGGAAACAGCAGGATCCAG*tcaaagaaaaaaggactgagtgcag
AC015977.6	CIB4	Readthrough	GGTTCTGCCCAGAAGCCAGCTGCAG*gccctgaccttcctgaccagaaatga
AHRR	NCOA2		GCAAGGTGTACCGATGCCTCCGGGG*ttcaacagaaaattatcttttggaa
CHD4	NOP2	Readthrough	GGCACCCGAACCTACCCCACAGCAG*taccatggggcgcaagttggaccct
EGFL7	MCF2L		GGGATGACTGATTCTCCTCCGCCAG*gttggagcaaaacgtcccactcact
GPR65	LINC01146	Readthrough	AAACACATCACCGGAAGAAATATGG*atgatgcatatcataaattattact
HERC3	FAM13A-AS1	Readthrough	AATTCTACATGATTAAAGAATCCAT*ccctttacagaaaacaactgaccaa
KB-1572G7.2	AP000347.4	Readthrough	ACACCACTCTTCCTGTTGGCCCAAG*gtcagcccaagactaccccgtcggt
LCAT	PSMB10	Readthrough	TGAATAAAGACCTTCCTTTGCTACC*agtacccagtgagcagcacagaggg
LSP1	TNNT3	Short-distance	CCGGCTCCCTAGGCGTCCCATCTCG*aaaccacccaccttcaccatgtctg
LTBP2	NPC2	Readthrough	GATGCGGCCCACATGGCCTGCGTAG*gttctgtggatggagttataaagga
OSBPL2	ADRM1	Readthrough	GGTTGCAAGCTGAGAACATCCAGAG*gaacccaagacagaccaggatgagg
PARL	MAP6D1	Readthrough	ATCTTGGGGGAGCTCTTTTTGGAAT*acaggaattccaggcttggactgga
PTPN22	RSBN1	Readthrough	AACTCCAGCTCATTTCTGAATTTTG*aaacaccagatgaaaatggtaaaac

We decided to investigate with molecular methods the described fusion transcripts. No other fusions were examined.

Molecular genetic confirmation of fusions

PCR with the primers TBCK-2558F1 and TBCK-2908R1 amplified a cDNA of the TBCK gene indicating that the synthesized cDNA was of good quality.

RT-PCR using cDNA from the tumor and subsequent direct Sanger sequencing verified the presence of the P4HA2-TBCK, TBCK-P4HA2, AHRR-NCOA2, ETV4-AHRR, and NCOA2-ETV4 fusion transcripts (Table II and Fig. 3). TBCK-P4HA2, AHRR-NCOA2, and NCOA2-ETV4 were in-frame fusions which would code for chimeric proteins. The detected ETV4-AHRR fusion, on the other hand, was out-of-frame and would not produce a chimeric protein, nor would the P4HA2-TBCK code for any functional protein. No EGFL7-MCF2L or CYP1B1-CLU fusion transcript was found by RT-PCR amplification (Table II).

Figure 3

Partial sequence chromatogram of the amplified cDNA fragment showing the junction points of the fusion transcripts. (A) P4HA2-TBCK, (B) TBCK-P4HA2, (C) exon 12 of AHRR with sequence of intron 14 of NCOA2, (D) exon 12 of AHRR with exon 14 of NCOA2, (E) ETV4-AHRR, and (F) NCOA2-ETV4.

Discussion

The examined angiofibroma of soft tissue carried the recurrent AHRR-NCOA2 fusion transcript but lacked the reciprocal NCOA2-AHRR. This finding supports the initial suggestion that AHRR-NCOA2 is the pathogenetically significant fusion transcript in tumors carrying a t(5;8)(p15;q12) (2,3). While we were examining the current tumor, a report was published describing 13 cases of angiofibroma of soft tissue with an AHRR-NCOA2 but with only eight of them carrying the reciprocal NCOA2-AHRR (11). Current data therefore agree that the AHRR-NCOA2 fusion gene is recurrent in angiofibroma of soft tissue [(2,3,11), present case] and indicate that this is the pathogenetically crucial outcome of the t(5;8).

Using FISH on formalin-fixed, paraffin-embedded specimens, Sugita et al (5) found that 16–36% of the tumor cells showed NCOA2 rearrangement. A fairly small proportion of NCOA2 gene rearrangement-positive cells (4–12 split signals per 50 tumor cell nuclei) was recently reported also by Yamada et al (11). The split signals were mostly detected in relatively large, spindle-shaped nuclei, indicating that these were the ones belonging to the neoplastic parenchyma (11).

The present tumor had two cytogenetically unrelated clones: one (eight metaphases) with the translocations t(4;5)(q24;q31) and t(5;8;17)(p15;q13;q21) and another (2 cells) with t(1;14)(p31;q32) as the sole chromosome abnormality. Thus, our data not only are in agreement with previous observations that only a fraction of tumor cells carry the NCOA2 gene rearrangement, but also demonstrate genetic heterogeneity of uncertain pathogenetic significance within the tumor. Although no fusion gene was found corresponding to t(1;14)(p31;q32), this should not lead us to conclude that the translocation was pathogenetically unimportant. The t(1;14)(p31;q32) chromosome aberration may exert its influence through a position effect causing deregulation of a gene in the proximity of the breakpoints. Alternatively, the current methodology may be unable to detect a fusion gene as has been demonstrated (9).

So far, three types of AHRR-NCOA2 fusion transcripts have been described: in the first type, exon 9 of AHRR is joined with exon 16 of NCOA2, the second type shows exon 10 of AHRR being joined to exon 14 of NCOA2, and in the third type there is an insertion of an intronic sequence from the NCOA2 gene between exon 9 of AHRR and exon 14 of NCOA2 (2,11). In the present angiofibroma of soft tissue, two novel fusion transcripts were found with different fusion positions from those previously described: a fusion transcript in which nt 1670 (sequence with accession no. NM_020731) from exon 12 of the AHRR gene was fused with a sequence from intron 14 of NCOA2 and a transcript in which nt 1533 (also from exon 12) of AHRR was fused to exon 15 of NCOA2 (sequence with accession no. NM_006540.2). The resulting putative AHRR-NCOA2 protein would be similar to those reported (2) in as much as the C-terminal part of AHRR is replaced by the C-terminal part of NCOA2.

The involvement of NCOA2 in neoplasia was first reported in acute myeloid leukemia with the cytogenetic inversion inv(8)(p11q13) which resulted in a KAT6A-NCOA2, also known as MOZ-TIF2 fusion gene (12,13). Since then, NCOA2 has been implicated also in other malignancies. A fusion between ETV6 (TEL) and NCOA2 was reported in childhood leukemia with the recurrent t(8;12)(q13;p13) (14). A PAX3-NCOA2 gene was found as a rare variant fusion in alveolar rhabdomyosarcoma; it was brought about by a t(2;8)(q35;q13) translocation (15). A HEY1-NCOA2 fusion gene was described in mesenchymal chondrosarcomas (16,17). Recently, SRF-NCOA2, TEAD1-NCOA2, and VGLL2-NCOA2 fusions were reported in rhabdomyosarcomas (18,19). In all the above-mentioned fusions, NCOA2 is the 3′-partner gene and all fusion proteins contain the two C-terminal activation domains AD1/CID (activation domain 1/CREB-binding protein interacting domain) and AD2 (2,3,12–19). The transforming activities of KAT6A-NCOA2 and PAX3-NCOA2 have been demonstrated experimentally (15,20). In addition, KAT6A-NCOA2 was shown to induce acute myeloid leukemia in transgenic fish (21). Deguchi et al (20) showed that the KAT6A-NCOA2 interaction with CREBBP through AD1/CID is essential for transformation. Similarly, Sumegi et al (15) showed that while deletion of the AD2 portion of PAX3-NCOA2 fusion protein reduced the transforming activity, deletion of the AD1/CID domain fully abrogated the transforming activity of the chimeric protein. Thus, the AD1/CID and AD2 domains of NCOA2 seem to be essential for the transformation ability of the various fusion proteins.

The three-way translocation t(5;8;17)(p15;q13;q21) of the present case not only generated an AHRR-NCOA2 resulting from the translocation of 5p15 to 8q13, but also two additional fusion genes: an NCOA2-ETV4, stemming from the moving of 8q13 to 17q21, and an ETV4-AHRR, generated by the moving of 17q21 to 5p15. The detected ETV4-AHRR fusion transcript is out-of-frame and so cannot produce a chimeric protein. The NCOA2-ETV4 fusion transcript is in-frame coding for a chimeric NCOA2-ETV4 protein, the oncogenetic potential of which cannot be ruled out. Based on the NCOA2 and ETV4 proteins with accession nos. NP_006531.1 and NM_001986.2, respectively, the chimeric NCOA2-ETV4 would contain 1,175 amino acids. The NCOA2 N-terminal part of the protein would contain the helix-loop-helix, PAS_9 and PAS_11, the CITED, and the SRC-1 domains. The ETV4 C-terminal part would contain the ETS DNA-binding domain of ETV4 (Fig. 4).

Figure 4

Illustration of the proteins AHRR, NCOA2, AHRR-NCOA2, NCOA2-ETV4, and TBCK-P4H2A. The domains, their accession nos., and intervals are also shown. Arrows in the AHRR protein indicate the known fusion points for the published AHRR-NCOA2 proteins. Arrows in the AHRR-NCOA2, NCOA2-ETV4, and TBCK-P4H2A show the fusion points in the present angiofibroma of soft tissue.

ETV4 was reported to contribute the 3′-part of the oncogenic protein in the subset of Ewing's sarcomas characterized by a t(17;22)(q12;q12) translocation (22,23). The EWSR1-ETV4 protein, in which the N-terminal part of EWSR1 is fused to the ETS DNA-binding domain of ETV4, has an oncogenetic potential similar to that of the EWSR1-FLI1, EWSR1-ERg, EWSR1-FEV, and EWSR1-ETV1 fusion proteins which may also be found in Ewing's sarcoma (24). The ETV4 gene was also described as the 3′-partner in fusion genes found in prostate carcinoma (25–27). ETV4 was found to fuse with the TMPRSS2, KLK2, CANT1, and DDX5 (25–27). All these fusions genes, TMPRSS2-ETV4, KLK2-ETV4, CANT1-ETV4, and DDX5-ETV4, contain (like the present NCOA2-ETV4) the part of ETV4 coding for the ETS DNA-binding domain.

The chromosome translocation t(4;5)(q24;q31) generated the P4HA2-TBCK and TBCK-P4HA2 fusion transcripts. P4HA2-TBCK does not encode any functional protein, whereas TBCK-P4HA2 encodes a chimeric 1,335-amino acid protein. TBCK-P4HA2 would contain the first 794 out of 830 amino acids of the TBCK protein (accession no. NP_149106.2), 6 amino acids from the untranslated region of exon 2 of P4HA2 (accession no. NM_004199.2), and the entire 535 amino acid-P4HA2 protein (NP_004190.1). The function of this putative chimeric protein is difficult to predict since it would contain both the protein kinase domain, the Rhodanese-like domain, and the Tre-2/Bub2/Cdc16 (TBC) domain of TBCK together with the P4HA2 protein which is a component of the prolyl 4-hydroxylase. The TBCK protein is thought to play a role in actin organization, cell growth, and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex (http://www.ncbi.nlm.nih.gov/gene/93627). Depletion of TBCK significantly inhibits cell proliferation, reduces cell size, and disrupts the organization of actin but not microtubule. Knockdown of TBCK induces a significant decrease in the protein levels of components of mTOR complex (mTORC) and suppresses the activity of mTOR signaling, but not the MAPK or PDK1/Akt pathway (28).

The protein encoded by the P4HA2 gene is one of several different types of α subunit of the prolyl 4-hydroxylase and provides the major part of the catalytic site of the active enzyme (http://www.ncbi.nlm.nih.gov/gene/8974). In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. In breast cancer, P4HA2 was shown to promote progression and metastasis by regulating collagen deposition (29). In squamous cell carcinoma of the oral cavity, P4HA2 was identified as a metastasis associated protein (30).

In spite of the now repeatedly documented recurrence of AHRR-NCOA2 in angiofibroma of soft tissue [present case, (2,11)], our findings indicate that also additional genetic events, some of which lead to fusion genes, may be important in tumor development. Worthy of mention is that of the eight hitherto cytogenetically reported tumors, including the present case, three had three-way translocations (1–3). What lies behind this highly unusual feature is unknown. Obviously, more such tumors must be studied cytogenetically and molecularly before all important aspects of their pathogenesis are laid bare.