Literature DB >> 27631008

Altered Clock and Lipid Metabolism-Related Genes in Atherosclerotic Mice Kept with Abnormal Lighting Condition.

Zhu Zhu1, Bingxuan Hua2, Zhanxian Shang1, Gongsheng Yuan1, Lirong Xu1, Ermin Li1, Xiaobo Li1, Ning Sun1, Zuoqin Yan2, Ruizhe Qian1, Chao Lu1.   

Abstract

Background. The risk of atherosclerosis is elevated in abnormal lipid metabolism and circadian rhythm disorder. We investigated whether abnormal lighting condition would have influenced the circadian expression of clock genes and clock-controlled lipid metabolism-related genes in ApoE-KO mice. Methods. A mouse model of atherosclerosis with circadian clock genes expression disorder was established using ApoE-KO mice (ApoE-KO LD/DL mice) by altering exposure to light. C57 BL/6J mice (C57 mice) and ApoE-KO mice (ApoE-KO mice) exposed to normal day and night and normal diet served as control mice. According to zeitgeber time samples were acquired, to test atheromatous plaque formation, serum lipids levels and rhythmicity, clock genes, and lipid metabolism-related genes along with Sirtuin 1 (Sirt1) levels and rhythmicity. Results. Atherosclerosis plaques were formed in the aortic arch of ApoE-KO LD/DL mice. The serum lipids levels and oscillations in ApoE-KO LD/DL mice were altered, along with the levels and diurnal oscillations of circadian genes, lipid metabolism-associated genes, and Sirt1 compared with the control mice. Conclusions. Abnormal exposure to light aggravated plaque formation and exacerbated disorders of serum lipids and clock genes, lipid metabolism genes and Sirt1 levels, and circadian oscillation.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27631008      PMCID: PMC5007349          DOI: 10.1155/2016/5438589

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

All species on the earth exhibit circadian rhythms synchronized with the environmental cycles of day and night. In mammals, the circadian pattern consists of a central clock located in the suprachiasmatic nucleus (SCN) and a peripheral clock spread over almost all of the major organ systems including liver and fat [1, 2]. The SCN senses the external light signal and releases neurotransmitters and hormones in response, which regularly influence the circadian expression of the clock genes in the peripheral tissues [3]. These peripheral oscillators play a critical tissue-specific role [4]. The circadian rhythm of animals is manifested via feedback loop formed by a number of clock genes. The main mammalian circadian clock genes include circadian locomotor output cycles kaput (Clock), brain and muscle encoding Arnt-like protein 1 (Bmal1), nuclear receptor subfamily 1, group D, member 1 (Rev-erb α), period (Per1, Per2, Per3), and cryptochrome (Cry1, Cry2). Many physiological activities are synchronized in an orderly manner by regulating the clock genes and their controlled genes. Hundreds of metabolism-related genes show circadian rhythms and most of them are controlled directly or indirectly by clock genes [5]. The peroxisome proliferator-activated receptors (PPARs), RAR-related orphan receptor α (ROR α), and retinoid X receptor α (RXR α) are associated with lipid metabolism and exhibit circadian oscillations [6-9]. Currently, atherosclerotic cardiovascular disease (ASCVD) is a major health threat [10] and the primary contributor to death worldwide. The increasing burden of atherosclerotic cardiovascular risk is attributed to the escalating incidence of obesity, hypercholesterolemia, and dyslipidemia [11]. Cholesterol is a key component of arterial plaques [12] and liver is the major seat of cholesterol metabolism. Further, abdominal visceral fat has been strongly associated with cardiovascular risk [13, 14]. Studies demonstrate that ASCVD has a close relationship with circadian clocks. Disordered circadian rhythms induce vascular impairment and aggravate atherosclerosis [15]. Humans and mice with dysfunctional circadian oscillation are more likely to manifest cardiovascular diseases, while rats with hypertension also have irregular circadian gene expression [15-17]. Shift work accelerates atherosclerosis, which is a major manifestation of the pathophysiology underlying cardiovascular disease [18]. The deleterious effects of shift work on subclinical atherosclerosis are apparent in men before the age of 40 [19]. Sirtuin 1 (Sirt1) a nuclear protein targeting histone H3 and H4 deacetylation [20] and its enzymatic activity also exhibit a circadian change [21]. Further, Sirt1 plays a significant protective role in atherosclerosis [22]. Sirt1 especially regulates hepatic lipid metabolism by inhibiting fat synthesis and promoting fat oxidation [23-25]. It increases fat mobilization in white fat tissue by inhibiting PPAR γ [26]. The circadian clock disorder of atherosclerotic mice has been found in mouse SCN, heart, and liver [27]. It is unclear whether peripheral clocks, lipid metabolism-related genes, and atheroprotective factor Sirt1 are altered in the liver and fat of atherosclerotic mice. We generated a mouse model of atherosclerotic via abnormal alteration in day and night and tested for atherosclerotic plaque formation and circadian expression in clock genes. We also examined the diurnal expression of clock genes Bmal1, Per2, and Cry1 Rev-erbα, as well as lipid metabolism-related PPARα, PPARγ, RORα, RXR α, and Sirt1.

2. Materials and Methods

2.1. Animal Model

We selected 10-week-old male C57BL/6J mice (Laboratory Animal Research Center of Chinese Academy of Sciences, Shanghai, China) and the age and gender were matched to ApoE-KO mice (Beijing Laboratory Animal Research Center, Beijing, China). ApoE-KO mouse is an ideal model of atherosclerosis [28, 29]. And the abnormal light stimulation leads to circadian disorder [30]. Therefore, the atherosclerosis model manifesting circadian clock genes expression disorder was built by altering exposure to environmental light. The ApoE-KO mice were randomly divided into two groups: (1) mice (ApoE-KO group) exposed to normal day-night pattern and (2) mice (ApoE-KO LD/DL group) maintained on a light-dark (LD) cycle (12 h light/12 h dark) for 2 weeks, followed by a dark-light (DL) cycle for 2 weeks, and then transferred to another LD cycle for 2 weeks. All mice were free to obtain regular diet and water. All the samples were obtained from mice at the end of the six weeks. According to external cues called zeitgeber times (ZT stands for standardized notation for the time during an entrained circadian cycle, ZT0 represents the start of the light phase, and ZT12 is the beginning of the dark phase, during a 24-hour light-dark cycle), we controlled light on at 08:00 which was designated as zeitgeber time 0 (ZT0) and light off at 20:00 (ZT12). The liver and fat tissues were obtained at different time points including ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20 (four mice per time point). The samples were immediately frozen in liquid nitrogen and stored at −80°C. All the animal experiments were performed according to the criteria of the Medical Laboratory Animal Administrative Committee of Shanghai. This study was approved by the Medical Ethics Committee of Fudan University, Shanghai, China.

2.2. Analysis of Mouse Serum Lipids

The serum was used for lipid detection. The mice were generally anesthetized by administering chloral hydrate at ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20. Blood was immediately collected after removing the whole eye ball. Subsequently, mice were euthanized with pentobarbital sodium through intraperitoneal injection. The serum was collected by centrifugation for 30 min at 4°C followed by serum lipid detection. The levels of glucose, triglyceride, total cholesterol, and low-density lipoprotein (LDL) in serum were measured by enzymatic methods [14]. The kits were purchased from Rongsheng Biotechnology Company Ltd. (Shanghai, China). We tested the samples according to the manufacturer's instruction.

2.3. Tissue Staining

To investigate the effect of abnormal light stimulation on atheromatous plaque formation in mice, we used Oil Red O staining to determine vulnerable plaque formation as previously described [30]. The arterial arcades were carefully dissected and fixed in 4% paraformaldehyde for 24 h at room temperature. The fixed samples were rinsed three times, each time for 15 minutes. The aortic segments were dehydrated in 20% sugar solution for 24 h and 30% sucrose solution for 24 h. Subsequently, the samples were embedded in Tissue-Tek OCT compound. Serial sections of 10 μm cross-section were prepared and fixed at 4°C using 70% ethanol solution and staining for 1 min in Oil Red O (Sigma-Aldrich, O0625, USA) to identify atherosclerotic plaques. Oil Red O was dissolved in isopropanol and mixed in 3 : 2 (v/v) (water to Oil Red O) and the plaques were stained for 30 min. Then the samples were carefully washed for three times, each time for 5 minutes and stained for 3~5 min in hematoxylin (Beyotime, C0107, China).

2.4. Total RNA Extraction and Reverse Transcription

Total RNA from liver and fat were isolated with TRIzol reagent (Invitrogen Life Technologies), according to the manufacturer's instructions. The quantity of total RNA was determined using UV spectrophotometry. RNA integrity was assessed using agarose gel electrophoresis, followed by reverse transcription of 1 μg of total RNA. The amplified first-strand cDNA was prepared with oligo-dT primers using a commercial cDNA synthesis kit (ReverTra Ace qPCR RT kit, Toyobo, Osaka, Japan). The cDNA was subsequently amplified for 35 cycles using specific primers (Table 1).
Table 1

Primer pairs used to amplify PCR products.

Gene nameAnnealing temperatureGeneBankaccession numberForward primer (5′-3′)
Bmal160°CNM_007489Forward: CACTGACTACCAAGAAAGTATGReverse: ATCCATCTGCTGCCCTGAGA
Per258°CNM_011066Forward: CAGACTCATGATGACAGAGGReverse: GAGATGTACAGGATCTTCCC
Rev-erb α 60°CNM_145434Forward: TACATTGGCTCTAGTGGCTCCReverse: CAGTAGGTGATGGTGGGAAGTA
Cry158°CNM_007771Forward: CACTGGTTCCGAAAGGGACTCReverse: CTGAAGCAAAAATCGCCACCT
PPAR α 61°CNM_011144Forward: TCGGCGAACTATTCGGCTGReverse: GCACTTGTGAAAACGGCAGT
ROR α 61°CNM_013646Forward: GGGGACAATTTCTACTTCACTGGReverse: GCAAACGGTAGTAAGGGCTG
GAPDH60°CBC_083149Forward: ACAGCCGCATCTTCTTGTGCAGTReverse: GGCCTTGACTGTGCCGTGAATTT

2.5. Real-Time PCR

The cDNA was diluted to 10 ng/μL and PCR reactions were amplified on a real-time PCR machine (Bio-Rad, Hercules, CA, USA). The PCR reaction mixture included 2.5 μL of 10 ng/μL cDNA, 1 μL of 10 μM primers (0.5 μL of upstream primers, 0.5 μL of downstream primers), 10 μL SYBR Green real-time PCR Master mix (Bio-Rad, Hercules, CA, USA), and 7.5 μL of H2O, in a final volume of 20 μL. The samples were subjected to 35 cycles of amplification. The amplification protocol included denaturation at 94°C for 15 sec, primer annealing for 30 sec, and extension at 72°C for 30 sec. Melting profiles were performed following each PCR reaction. The relative quantification of gene expression was analyzed from the measured threshold cycles (CT) using the 2−ΔΔCT method. The CT value represents the number of cycles at the cross-point of ΔRn versus threshold. The higher the CT value, the greater the number of steady cycles and the lower the gene expression. As the amplification efficiencies of the target genes and the internal control were equal, the relative changes in the target gene expression of the altered clock genes in the mice compared with normal mice (ΔCT calibrator value) were calculated using the equation 2−ΔΔCT. The ΔCT values were determined by subtracting the average GAPDH CT value from the average target gene CT value.

2.6. Statistical Analysis

Each value represents mean ± SD. The values for mRNA levels are presented as relative values in all experiments. We employed single cosinor method to analyze circadian rhythm [17, 31], and the equation used for stating cosine function was shown as follows: Y(t) = M + A∗cos⁡(x∗t + u). The mesors, amplitudes, and acrophases were rhythm characteristics and estimated by this method. The mesor represents middle value of the fitted cosine. The amplitude is from half of the biggest differences (Valuemax − Valuemin) in the fitted cosine function. And the acrophase means the peak value time. A probability value determined by one-way analysis of variance (ANOVA) of ≤ 0.05 indicated a statistically significant difference. Primer sequences of the target genes in the present study were found in GeneBank as shown in Table 1.

3. Results

3.1. Atheromatous Plaque Formation in the Arterial Arch

To investigate the effect of abnormal light stimulation on atheromatous plaque formation in mice, Oil Red O staining was used to determine vulnerable plaque formation. 10-week-old ApoE-KO mice were divided into two groups randomly. The wild type C57 BL/6J (C57) mice and one group of ApoE knockout (ApoE-KO) mice were exposed to regular light-dark conditions. The other group of ApoE-KO mice (ApoE-KO LD/DL) was exposed to abnormal light stimulation. Thus, three experimental groups were created. The arterial arch of C57 mice, ApoE-KO mice, and ApoE-KO LD/DL mice was dyed with Oil Red O (Figure 1). No pathological change was observed in C57 mice (Figure 1(a)). Compared with C57 mice, the ApoE-KO mice showed endothelial lipid deposition and foam cell formation (Figure 1(b)). In ApoE-KO LD/DL mice, lipid core and thicker cap were detected (Figure 1(c)).
Figure 1

Oil Red O staining of the aortic arch of mice. We used Oil Red O staining to evaluate vulnerable plaques in the wild type C57 BL/6J (C57) mice, the ApoE knockout (ApoE-KO) mice treated with regular light-dark conditions, and the ApoE-KO (ApoE-KO LD/DL) mice with abnormal light stimulation. The arterial arch of C57, ApoE-KO, and ApoE-KO LD/DL mice was dyed with Oil Red O. No obvious changes were found in the C57 group (a). Endothelial lipid deposition and foam cell formation were seen in ApoE-KO group (b). However, exposure to abnormal day and night for 6 weeks resulted in lipid core and thicker caps were detected in ApoE-KO LD/DL mice (c). Arrowheads indicate lipid deposition. Original magnification ×200 (n = 4).

3.2. Serum Lipid Level and Rhythm

We evaluated the serum lipid levels in mouse samples every 4 h in the C57, ApoE-KO, and ApoE-KO LD/DL mice at ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20 (ZT0 corresponds to “lights on” and ZT12 to “light off”) (Table 2).
Table 2

Circadian rhythmic parameters of triglyceride, total cholesterol, HDL cholesterol, and LDL cholesterol levels in serum.

Serum lipidMesorAmplitudeAcrophase ZT (h)
C57 ND
Triglyceride0.81 ± 0.120.10 ± 0.0411.95 ± 0.90
Total cholesterol1.93 ± 0.120.12 ± 0.0613.37 ± 0.72
HDL cholesterol1.50 ± 0.180.14 ± 0.0413.75 ± 0.07
LDL cholesterol0.11 ± 0.020.04 ± 0.0113.33 ± 0.13

ApoE-KO
Triglyceride1.61 ± 0.16∗∗ 0.43 ± 0.06∗∗ 8.17 ± 0.17
Total cholesterol10.05 ± 0.81∗∗ 1.27 ± 0.31 10.12 ± 0.25
HDL cholesterol1.87 ± 0.11 0.21 ± 0.0412.34 ± 0.27
LDL cholesterol6.63 ± 0.71∗∗ 0.73 ± 0.27 10.81 ± 0.13∗∗

ApoE-KO LD/DL
Triglyceride2.81 ± 0.16∗∗## 0.91 ± 0.02∗∗## 11.15 ± 0.11
Total cholesterol20.27 ± 1.82∗∗## 7.26 ± 0.42∗∗## 8.48 ± 0.08∗∗
HDL cholesterol3.28 ± 0.22∗∗## 0.63 ± 0.13∗∗## 12.80 ± 0.15
LDL cholesterol27.13 ± 2.08∗∗## 4.79 ± 0.49∗∗## 13.21 ± 0.05##

n = 4. P < 0.05, P < 0.01 versus C57 mice; ## P < 0.01 versus ApoE-KO mice.

As shown in Figure 2, the total triglyceride (TG), total cholesterol (TC), and low-density lipoprotein (LDL) levels in ApoE-KO LD/DL mice were significantly increased compared with the C57 and ApoE-KO mice. Further, the mesors and amplitudes of TG, TC, HDL, and LDL were enhanced in ApoE-KO LD/DL mice compared with C57 mice and ApoE-KO mice. These results indicated that irregular light-dark interval aggravated the changes of lipid levels and oscillation patterns in ApoE-KO LD/DL mice.
Figure 2

Serum total triglyceride, cholesterol, HDL-CHO, and LDL-CHO of blood in mice. We collected the blood of mice in three groups at ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20. The total triglyceride (TG), total cholesterol (TC), and low-density lipoprotein (LDL) levels in ApoE-KO LD/DL mice were significantly increased compared with the C57 and ApoE-KO mice. Further, the mesors and amplitudes of TG, TC, HDL, and LDL were enhanced in ApoE-KO LD/DL mice compared with C57 mice and ApoE-KO mice (n = 4 for each group at every time point).

3.3. Diurnal Expression Patterns of Circadian Genes in Liver and Fat

Liver and fat play an important role in energy metabolism. Abnormal energy metabolism increases the risk for atherosclerosis. Most of the clock genes exhibit circadian expression not only in SCN but also in peripheral tissues including liver and fat. To explore the possible changes in clock gene expression in atherosclerotic liver and fat, we performed real-time PCR analysis and compared the expression levels of the core clock genes in liver and fat, including Bmal1, Cry1, Per2, and Rev-erbα, in the three groups (C57, ApoE-KO, and ApoE-KO LD/DL) of mice at ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20 as shown in Figures 3 and 4.
Figure 3

Circadian expression of clock genes in liver of C57, ApoE-KO, and ApoE-KO LD/DL mice. We obtained the liver tissues of mice at time points of ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20. Levels of mRNA were determined by quantitative real-time PCR. In the liver tissue, the four clock genes Bmal1, Per2, Cry1, and Rev-erb α exhibit significant 24 h circadian expression pattern in C57, ApoE-KO, and ApoE-KO LD/DL mice. The mesors of Bmal1 and Per2 were reduced in ApoE-KO LD/DL mice compared with those in C57 and ApoE-KO mice. The amplitudes of Cry1 in ApoE-KO mice and ApoE-KO LD/DL mice were decreased compared with those in C57 mice, and the amplitudes of Per2 and Rev-erb α in ApoE-KO LD/DL mice were attenuated compared with those in ApoE-KO mice. The acrophases of Bmal1, Cry1, and Per2 in ApoE-KO LD/DL mice were altered compared with those in C57 and ApoE-KO mice. The mRNA levels of clock genes were normalized to GAPDH mRNA (n = 4 for each group at every time point).

Figure 4

Circadian expression of clock genes in fat of C57, ApoE-KO, and ApoE-KO LD/DL mice. We obtained the epididymal fat tissues of mice at time points of ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20. Levels of mRNA were determined by quantitative real-time PCR. In the epididymal fat tissue, circadian rhythm was lost in Bmal1 of ApoE-KO LD/DL mice and Cry1 of both ApoE-KO and ApoE-KO LD mice. The mesors were reduced of those four clock genes in ApoE-KO LD/DL mice compared with C57 mice. The amplitude of Per2 in ApoE-KO LD/DL mice was significantly decreased compared with C57 and ApoE-KO LD/DL mice. The acrophases of Rev-erbα were delayed in ApoE-KO LD/DL mice compared with those in C57. The mRNA levels of clock genes were normalized to GAPDH mRNA (n = 4 for each group at every time point).

In the liver tissues, these four clock genes exhibited a significant 24 h circadian expression pattern (Figure 3). The mesors of Bmal1 and Per2 were reduced in ApoE-KO LD/DL mice compared with those in C57 and ApoE-KO mice. The amplitudes of Cry1 in ApoE-KO mice and ApoE-KO LD/DL mice were decreased compared with those in C57 mice, and the amplitudes of Per2 and Rev-erb α in ApoE-KO LD/DL mice were attenuated compared with those in ApoE-KO mice. The acrophases of Bmal1, Cry1, and Per2 in ApoE-KO LD/DL mice were altered compared with those in C57 and ApoE-KO mice (Table 3).
Table 3

Circadian rhythmic parameters of clock genes, PPAR α, PPAR γ, ROR α, RXR α, and Sirt1 in mouse liver.

GeneMesorAmplitudeAcrophase ZT (h)
C57 ND
Bmal10.38 ± 0.020.37 ± 0.050.69 ± 0.06
Cry10.49 ± 0.030.41 ± 0.0421.98 ± 0.15
Per21.63 ± 0.080.61 ± 0.2014.20 ± 0.25
Rev-erb α 19.78 ± 5.6520.12 ± 7.89.09 ± 0.49
PPAR α 1.45 ± 0.090.77 ± 0.0611.00 ± 0.07
PPAR γ 1.75 ± 0.360.97 ± 0.3613.90 ± 0.17
ROR α 1.28 ± 0.100.48 ± 0.0412.42 ± 0.12
RXR α 1.77 ± 0.150.53 ± 0.056.38 ± 1.42
Sirt10.79 ± 0.040.39 ± 0.0523.16 ± 0.06

ApoE-KO
Bmal10.32 ± 0.030.29 ± 0.060.38 ± 0.04
Cry10.40 ± 0.070.19 ± 0.02∗∗ 21.32 ± 0.06
Per21.36 ± 0.13∗∗ 0.75 ± 0.1213.31 ± 0.10
Rev-erb α 27.15 ± 3.92 25.33 ± 6.634.98 ± 0.10∗∗
PPAR α 2.00 ± 0.16∗∗ 1.67 ± 0.10∗∗ 15.20 ± 0.06∗∗
PPAR γ 9.02 ± 0.36∗∗ 5.01 ± 0.66∗∗ 12.80 ± 0.05
ROR α 0.63 ± 0.05∗∗ 0.21 ± 0.03∗∗ 11.99 ± 0.11
RXR α 1.95 ± 0.110.69 ± 0.237.22 ± 0.08
Sirt1

ApoE-KO LD/DL
Bmal10.26 ± 0.04∗∗## 0.25 ± 0.0919.87 ± 0.03∗∗##
Cry10.29 ± 0.02∗∗ 0.24 ± 0.04∗∗ 16.27 ± 0.10∗∗##
Per20.71 ± 0.06∗∗## 0.46 ± 0.08# 10.77 ± 0.08##
Rev-erb α 23.15 ± 2.4215.7 ± 2.30# 4.78 ± 0.07∗∗
PPAR α 2.06 ± 0.06∗∗ 1.61 ± 0.02∗∗ 7.87 ± 0.02∗∗##
PPAR γ 6.72 ± 0.10∗∗## 4.89 ± 0.07∗∗ 7.64 ± 0.02∗∗##
ROR α 0.66 ± 0.02∗∗ 0.19 ± 0.02∗∗ 14.17 ± 0.02##
RXR α 1.96 ± 0.050.44 ± 0.019.13 ± 0.05∗∗#
Sirt1

n = 4. P < 0.05, P < 0.01 versus C57 mice; # P < 0.05, ## P < 0.01 versus ApoE-KO mice.

In fat tissue, the circadian rhythmicity was lost in Bmal1 of ApoE-KO LD/DL mice and in Cry1 of ApoE-KO and ApoE-KO LD/DL mice (Figure 4). The mesors were reduced of those four clock genes in ApoE-KO LD/DL mice compared with C57 mice. The amplitude of Per2 in ApoE-KO LD/DL mice was significantly decreased compared with C57 and ApoE-KO mice. Further, the acrophases of Rev-erb α were delayed in ApoE-KO LD/DL mice compared with those in C57 mice. Generally, the expression of Bmal1 and Per2 in ApoE-KO LD/DL mice was significantly decreased compared with that in C57 mice and in ApoE-KO mice (Table 4). Overall, our data indicated that the abnormal day-night exposure aggravated the circadian genes expression disorder in liver and fat tissues of ApoE-KO LD/DL mice.
Table 4

Circadian rhythmic parameters of clock genes, PPAR α, PPAR γ, ROR α, RXR α, and Sirt1 in mouse fat.

GeneMesorAmplitudeAcrophase ZT (h)
C57 ND
Bmal10.61 ± 0.040.44 ± 0.0523.58 ± 0.09
Cry10.93 ± 0.010.51 ± 0.0419.22 ± 0.12
Per21.39 ± 0.080.64 ± 0.0810.77 ± 0.08
Rev-erb α 2.23 ± 0.142.08 ± 0.197.75 ± 0.01
PPAR α 7.34 ± 0.166.83 ± 0.2912.1 ± 0.03
PPAR γ 1.25 ± 0.050.68 ± 0.0515.55 ± 0.03
ROR α
RXR X
Sirt17.24 ± 0.247.18 ± 0.286.33 ± 0.01

ApoE-KO
Bmal10.30 ± 0.03∗∗ 0.13 ± 0.03∗∗ 23.27 ± 0.15
Cry1
Per20.66 ± 0.01∗∗ 0.57 ± 0.0913.41 ± 0.06∗∗
Rev-erb α 2.99 ± 0.08∗∗ 2.58 ± 0.22 10.96 ± 0.02∗∗
PPAR α 11.27 ± 0.20∗∗ 7.71 ± 0.10∗∗ 12.68 ± 0.01
PPAR γ
ROR α
RXR α
Sirt115.27 ± 0.73∗∗ 9.60 ± 0.97∗∗ 6.10 ± 0.02

ApoE-KO LD/DL
Bmal1
Cry1
Per20.42 ± 0.05∗∗## 0.18 ± 0.03∗∗## 10.28 ± 0.09##
Rev-erb α 2.16 ± 0.18## 2.01 ± 0.36# 11.12 ± 0.03∗∗
PPAR α 13.81 ± 0.33∗∗## 6.70 ± 0.0512.03 ± 0.02
PPAR γ
ROR α 2.01 ± 0.040.84 ± 0.054.79 ± 0.02
RXR α 1.52 ± 0.040.44 ± 0.022.29 ± 0.07
Sirt113.12 ± 0.10∗∗# 7.47 ± 0.185.84 ± 0.01

n = 4. P < 0.05, P < 0.01 versus C57 mice; # P < 0.05, ## P < 0.01 versus ApoE-KO mice.

3.4. Diurnal Expression Pattern of PPAR α, PPAR γ, ROR α, and RXR α in Liver and Fat

Altered circadian gene expression contributed to changes in expression patterns of a series of downstream clock-controlled genes. Therefore, using quantitative RT-PCR, we examined the expression of PPAR α, PPAR γ, ROR α, and RXR α in liver and fat of atherosclerotic mice. As shown in Figure 5, in the liver tissue, the mesors of PPAR α and PPAR γ in ApoE-KO mice and ApoE-KO LD/DL mice were improved compared with those in C57 mice. The amplitudes of PPAR α and PPAR γ were enhanced while the amplitudes of ROR α were attenuated in ApoE-KO mice and ApoE-KO LD/DL mice compared with C57 mice. The acrophases of PPAR α and PPAR γ were advanced and the acrophase of RXR α was delayed in ApoE-KO LD/DL mice compared with C57 and ApoE-KO mice. The expression levels of PPAR α and PPAR γ in ApoE-KO LD/DL mice were increased compared with C57 mice (Table 3).
Figure 5

Circadian expression of PPAR α, PPAR γ, ROR α, and RXR α in mouse liver tissues. We also identified the diurnal expression of lipid metabolism-associated genes (PPAR α, PPAR γ, ROR α, and RXR α) in liver at specific time points. Levels of mRNA were determined by quantitative real-time PCR. The mesors of PPAR α and PPAR γ in ApoE-KO mice and ApoE-KO LD/DL mice were improved compared with those in C57 mice. The amplitudes of PPAR α and PPAR γ were enhanced and the amplitudes of ROR α were attenuated in ApoE-KO mice and ApoE-KO LD/DL mice compared with C57 mice. The acrophases of PPAR α and PPAR γ were advanced and the acrophase of RXR α was delayed in ApoE-KO LD/DL mice compared with C57 and ApoE-KO mice. The expression levels of PPAR α and PPAR γ in ApoE-KO LD/DL mice were increased compared with C57 mice. The mRNA levels of clock genes were normalized to GAPDH mRNA (n = 4 for each group at every time point).

In the fat tissue, PPAR γ in ApoE-KO LD/DL mice and RXR α in C57 mice exhibited circadian oscillation not in accordance with 24 hours, and PPAR γ in ApoE-KO mice, ROR α in C57 and ApoE-KO mice, and RXR α in ApoE-KO mice did not well fit the cosine curves (Figure 6). The mesor of PPARα was enhanced in ApoE-KO LD/DL mice compared with those in C57 and ApoE-KO mice (Table 4). These results indicated that the oscillation of lipid metabolism-associated genes PPAR α, PPAR γ, ROR α, and RXR α was altered.
Figure 6

Circadian expression of PPAR α, PPAR γ, ROR α, and RXR α in mouse fat tissues. We also identified the diurnal expression of lipid metabolism-associated genes (PPAR α, PPAR γ, ROR α, and RXR α) in fat tissue at specific time points. Levels of mRNA were determined by quantitative real-time PCR. In the fat tissue, PPAR γ in ApoE-KO LD/DL mice and RXR α in C57 mice exhibited circadian oscillation not in accordance with 24 hours, and PPAR γ in ApoE-KO mice, ROR α in C57 and ApoE-KO mice, and RXR α in ApoE-KO mice did not well fit the cosine curves. The mesor of PPARα was enhanced in ApoE-KO LD/DL mice compared with those in C57 and ApoE-KO mice. The mRNA levels of clock genes were normalized to GAPDH mRNA (n = 4 for each group at every time point).

3.5. Diurnal Expression Pattern of Sirt1 in Liver and Fat

Sirtuin 1 (Sirt1), a nuclear protein, regulates liver and fat metabolism, and its HDAC activity also exhibits circadian oscillation in liver tissue [21]. We detected the Sirt1 expression patterns in liver and fat as shown in Figure 7. In the liver tissue, Sirt1 in ApoE-KO and ApoE-KO LD/DL mice exhibited circadian oscillation not in accordance with 24 hours. Further, in the fat tissue, the mesors of ApoE-KO mice and ApoE-KO LD/DL mice were increased compared with those in C57 mice. Concurrently, the expression of ZT0, ZT4, and ZT12 was promoted compared with C57 and ApoE-KO mice. Overall, the circadian oscillation of Sirt1 was lost in liver and altered in adipose tissues in ApoE-KO LD/DL mice.
Figure 7

Circadian expression of Sirt1 in liver and fat tissue of mice. Levels of Sirt1 were determined by quantitative real-time PCR. In the liver tissue, Sirt1 in ApoE-KO and ApoE-KO LD/DL mice exhibited circadian oscillation not in accordance with 24 hours. Further, in the fat tissue, the mesors of ApoE-KO mice and ApoE-KO LD/DL mice were increased compared with those in C57 mice. The expression of ZT0, ZT4, and ZT12 was promoted compared with C57 and ApoE-KO mice. The mRNA levels of clock genes were normalized to GAPDH mRNA (n = 4 for each group at every time point).

4. Discussion

In this study, we investigated the role of abnormal day-night exposure in inducing atherosclerotic plaques in the aortic arch of ApoE-KO LD/DL mice. We also monitored the serum concentration and circadian changes in total triglyceride, total cholesterol, and low-density lipoprotein in ApoE-KO LD/DL mice compared with C57 mice and ApoE-KO mice. Further, the circadian oscillations of clock genes (Bmal1, Per2, Cry1, and Rev-erbα), lipid metabolism-associated genes (PPAR α, PPAR γ, RXR α, and ROR α), and Sirt1 were modified extensively in ApoE-KO LD/DL mice compared with those in C57 mice and ApoE-KO mice. Atherosclerosis is a chronic disease caused by multiple factors. The risk factors include hyperlipidemia, hypertension, smoking, diabetes, vascular inflammation, and autoimmune disease. High lipid levels, especially LDL, increase the risk of atherosclerosis [32, 33]. Therefore, we sought to identify the circadian alteration in clock genes and lipid metabolism-related genes altered in the liver and fat of atherosclerotic mice. ApoE-KO mouse is an ideal model of atherosclerosis, in which total serum cholesterol and low-density lipoprotein levels are significantly higher than in C57 mice of the same sex. Further, ApoE-KO mice displayed significant atherosclerotic plaques in the aorta at six months [34]. Our preliminary studies also showed that, in 10-week-old male ApoE-KO mice fed with Western diet and exposed to chaotic light for six weeks, significant atherosclerotic plaques formed [30]. Further, the amplitudes of circadian oscillations in serum lipids were increased significantly with higher lipid levels. However, under similar conditions no obvious pathological changes in aorta were observed in C57 mice of the same sex and age [30]. All those results agreed with our research. Atherosclerosis is an inflammatory disease involved in accumulating of lipid in the arterial wall. PPAR α and PPAR γ control almost all phases of atherosclerosis formation. PPAR α decreased the density of LDL in patients with dyslipidemia [35], and its activation repressed the accumulation of oxidized-LDL in atherosclerotic plaques of insulin-resistant mice [36]. In this study, the total expression level of PPARα was increased dramatically compared to both in liver and in fat tissue of C57 mice. In addition, the amplitudes of PPARα were advanced in liver of ApoE-KO LD/DL mice compared with the control groups. PPAR γ agonist inhibited phosphorylation of NF-κB to repress the inflammatory response [37, 38]. In atherosclerotic mice, the amplitudes of PPARγ in liver were significantly changed compared with the control groups, and the acrophase was delayed compared with control mice. ROR α has been reported to play important roles in circadian system, adipocyte glyceroneogenesis, and liver gluconeogenesis [39]. It could inhibit NF-κB activation to attenuate the inflammatory response, which might act as a potent object in the treatment of atherosclerosis [40]. And ROR α was positively correlated with HDL levels [41]. In our study the amplitudes of ROR α in liver were attenuated in ApoE-KO mice and ApoE-KO LD/DL mice compared with C57 mice. Diabetes promotes oxidative stress to aggravate atherosclerosis [42], and RXR agonists postponed the atherosclerosis progression [43]. In liver tissue, the acrophase of RXR α was delayed in ApoE-KO LD/DL mice compared with C57 and ApoE-KO mice. The results indicated that the expression patterns of PPAR α, PPAR γ, ROR α, and RXR α in mice were altered in ApoE-KO mice, which would promote atherosclerosis progression. Sirt1 plays a critical role in circadian rhythm and in atherosclerosis. In liver tissue, the rhythms of ApoE-KO and ApoE-KO LD/DL mice were lost. And the mesors of Sirt1 were changed in ApoE-KO LD/DL mice compared with C57. Sirt1 may serve as a link between the clock genes controlling circadian alteration and lipid-related gene oscillation, and its expression disorder might aggravate atherosclerosis. On the other hand, shifted food intake time induced by light at night could eventually lead to obesity in mice [44] and the timing of food intake affected the rhythm of clock genes in liver and other peripheral organs [45]. The timing of feed might be the mechanism of light shifts inducing circadian genes expression disorder and contributing to atherosclerosis.

5. Conclusion

We detected altered expression of the circadian clock genes and lipid metabolism-related genes in liver and fat tissues of atherosclerotic mice manifesting circadian genes expression disorder for the first time. We also observed normal circadian rhythm in Sirt1 expression and its changes in liver and fat tissues of atherosclerotic mice with disordered circadian genes expression. Specific mechanisms underlying the phenomenon remain to be further studied. Our findings provide new research directions and lay a theoretical foundation for further study of the relationship between circadian clock, lipid metabolism disorders, and atherosclerosis.
  44 in total

1.  Shiftwork and metabolic risk factors of cardiovascular disease.

Authors:  Mina Ha; Jungsun Park
Journal:  J Occup Health       Date:  2005-03       Impact factor: 2.708

2.  Status of cardiovascular health in US adolescents: prevalence estimates from the National Health and Nutrition Examination Surveys (NHANES) 2005-2010.

Authors:  Christina M Shay; Hongyan Ning; Stephen R Daniels; Cherie R Rooks; Samuel S Gidding; Donald M Lloyd-Jones
Journal:  Circulation       Date:  2013-04-01       Impact factor: 29.690

3.  The orphan nuclear receptor ROR alpha is a negative regulator of the inflammatory response.

Authors:  P Delerive; D Monté; G Dubois; F Trottein; J Fruchart-Najib; J Mariani; J C Fruchart; B Staels
Journal:  EMBO Rep       Date:  2001-01       Impact factor: 8.807

4.  A 16-week fenofibrate treatment increases LDL particle size in type IIA dyslipidemic patients.

Authors:  Isabelle Lemieux; Luc Laperrière; Vladimir Dzavik; Gérald Tremblay; Joanne Bourgeois; Jean Pierre Després
Journal:  Atherosclerosis       Date:  2002-06       Impact factor: 5.162

5.  Light at night increases body mass by shifting the time of food intake.

Authors:  Laura K Fonken; Joanna L Workman; James C Walton; Zachary M Weil; John S Morris; Abraham Haim; Randy J Nelson
Journal:  Proc Natl Acad Sci U S A       Date:  2010-10-11       Impact factor: 11.205

Review 6.  Cross-talk between nuclear receptors and nuclear factor kappaB.

Authors:  K De Bosscher; W Vanden Berghe; G Haegeman
Journal:  Oncogene       Date:  2006-10-30       Impact factor: 9.867

7.  The NAD+-dependent deacetylase SIRT1 modulates CLOCK-mediated chromatin remodeling and circadian control.

Authors:  Yasukazu Nakahata; Milota Kaluzova; Benedetto Grimaldi; Saurabh Sahar; Jun Hirayama; Danica Chen; Leonard P Guarente; Paolo Sassone-Corsi
Journal:  Cell       Date:  2008-07-25       Impact factor: 41.582

8.  Coadministration of VDR and RXR agonists synergistically alleviates atherosclerosis through inhibition of oxidative stress: An in vivo and in vitro study.

Authors:  L M Lin; F Peng; Y P Liu; D J Chai; R B Ning; C S Xu; J X Lin
Journal:  Atherosclerosis       Date:  2016-06-03       Impact factor: 5.162

9.  Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E.

Authors:  S H Zhang; R L Reddick; J A Piedrahita; N Maeda
Journal:  Science       Date:  1992-10-16       Impact factor: 47.728

Review 10.  Circadian integration of metabolism and energetics.

Authors:  Joseph Bass; Joseph S Takahashi
Journal:  Science       Date:  2010-12-03       Impact factor: 47.728

View more
  3 in total

1.  Association between rotating night shift work and carotid atherosclerosis among Chinese steelworkers: a cross-sectional survey.

Authors:  Lihua Wang; Shengkui Zhang; Miao Yu; Juxiang Yuan
Journal:  Hypertens Res       Date:  2022-02-10       Impact factor: 5.528

2.  Identification of Featured Metabolism-Related Genes in Patients with Acute Myocardial Infarction.

Authors:  Hang Xie; Enfa Zha; Yushun Zhang
Journal:  Dis Markers       Date:  2020-11-28       Impact factor: 3.434

Review 3.  Circadian Rhythm: Potential Therapeutic Target for Atherosclerosis and Thrombosis.

Authors:  Andy W C Man; Huige Li; Ning Xia
Journal:  Int J Mol Sci       Date:  2021-01-12       Impact factor: 5.923

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.