| Literature DB >> 27597967 |
Xuan Chen1, Guan-Hai Dai1, Ze-Ming Ren1, Ye-Ling Tong1, Feng Yang1, Yong-Qiang Zhu1.
Abstract
MicroRNAs (miRNAs) are a class of small noncoding RNA that, through mediating posttranscriptional gene regulation, play a critical role in nearly all biological processes. Over the last decade it has become apparent that plant miRNAs may serve as a novel functional component of food with therapeutic effects including anti-influenza and antitumor. Rapeseed bee pollen has good properties in enhancing immune function as well as preventing and treating disease. In this study, we identified the exogenous miRNAs from rapeseed bee pollen in mice blood using RNA-seq technology. We found that miR-166a was the most highly enriched exogenous plant miRNAs in the blood of mice fed with rapeseed bee pollen, followed by miR-159. Subsequently, RT-qPCR results confirmed that these two miRNAs also can be detected in rapeseed bee pollen. Our results suggested that food-derived exogenous miRNAs from rapeseed bee pollen could be absorbed in mice and the abundance of exogenous miRNAs in mouse blood is dependent on their original levels in the rapeseed bee pollen.Entities:
Mesh:
Substances:
Year: 2016 PMID: 27597967 PMCID: PMC5002473 DOI: 10.1155/2016/5413849
Source DB: PubMed Journal: Biomed Res Int Impact factor: 3.411
Overview of reads.
| Lib | Type | Total | % of total | Unique | % of unique |
|---|---|---|---|---|---|
| Raw reads | Nuclear acid | 11,089,480 | 100.000 | 209,873 | 100.000 |
| 3ADT & length filter | 320,992 | 2.895 | 145,808 | 69.474 | |
| Junk reads | 858 | 0.008 | 610 | 0.291 | |
| Rfam | RNA | 47,589 | 0.429 | 6,477 | 3.086 |
| mRNA | RNA | 3,694 | 0.033 | 905 | 0.431 |
| Repeats | RNA | 369 | 0.003 | 74 | 0.035 |
| rRNA | RNA | 19,901 | 0.179 | 2,026 | 0.965 |
| tRNA | RNA | 15,176 | 0.137 | 2,527 | 1.204 |
| snoRNA | RNA | 5,507 | 0.050 | 750 | 0.357 |
| snRNA | RNA | 527 | 0.005 | 243 | 0.116 |
| Plant miRNA | RNA | 221 | 0.002 | 33 | 0.016 |
| Another Rfam RNA | RNA | 6,478 | 0.058 | 931 | 0.444 |
| Clean reads | 10,716,785 | 96.639 | 56,136 | 26.748 |
Figure 1Pie chart of sequence category. (a) Pie chart of sequence category of total reads. (b) Pie chart of sequence category of unique reads.
Plant miRNAs in mice fed with rapeseed bee pollen.
| miRNA ID | miRNA sequence | Length (nt) | Frequency |
|---|---|---|---|
| bna-miR-166a | TCGGACCAGGCTTCATTCCCC | 21 | 35 |
| bna-miR-159 | TTTGGATTGAAGGGAGCTCTA | 21 | 22 |
| gma-miR6300 | GTCGTTGTAGTATAGTGGT | 19 | 8 |
| nta-miR6145e | ATTGTTACATGTAGCACTGGCT | 22 | 7 |
| nta-miR6146b | TTTGTCCAATGAAATACTTATC | 22 | 6 |
| nta-miR6020b | AAATGTTCTTCGAGTATCTTC | 21 | 5 |
| nta-miR6149a | TTGATACGCACCTGAATCGGC | 21 | 5 |
| ath-miR-166a | TTCGGACCAGGCTTCATTCCCC | 22 | 3 |
| osa-miR530 | TGCATTTGCACCTGCACCTCC | 21 | 3 |
| ahy-miR408 | TGCACTGCCTCTTCCCTGGCT | 21 | 3 |
| mdm-miR408a | TGCACTGCCTCTTCCCTGGCT | 21 | 3 |
| bna-miR397a | ATTGAGTGCAGCGTTGATG | 19 | 2 |
| peu-MIR2916 | CAACCATAAACGATGCCGACCAGG | 24 | 2 |
| nta-miR168a | TCGCTTGGTGCAGGTCGGGAC | 21 | 2 |
| gma-miR482b | TCTTCCCTACACCTCCCATACC | 22 | 2 |
| nta-miR482a | TTTCCAATTCCACCCATTCCTA | 22 | 2 |
| nta-miR827 | TTAGATGAACATCAACAAACA | 21 | 2 |
| ppt-miR894 | TTCACGTCGGGTTCACCA | 18 | 2 |
| gma-miR3522 | TGAGACCAAATGAGCAGCTGA | 21 | 2 |
| gma-miR4996 | TAGAAGCTCCCCATGTTCTCA | 21 | 2 |
| bna-miR403 | TTAGATTCACGCACAAACTCG | 21 | 1 |
| peu-MIR2916 | ACCGTCCTAGTCTCAACCATA | 21 | 1 |
| aau-miR162 | TCGATAAACCTCTGCATCCAG | 21 | 1 |
| bdi-miR398a | TATGTTCTCAGGTCGCCCCTGT | 22 | 1 |
| gma-miR403a | TTAGATTCACGCACAAACTT | 20 | 1 |
| gma-miR1507a | TCTCATTCCATACATCGTCTGA | 22 | 1 |
| nta-miR6159 | TAGCATAGAATTCTCGCACCTA | 22 | 1 |
| hbr-miR6173 | GCTGTAAACGATGGATACT | 19 | 1 |
| ptc-miR6478 | CCGACCTTAGCTCAGTTGGT | 20 | 1 |
| stu-miR7997c | TTGCTCGGATTCTTCAAAAAT | 21 | 1 |
| bna-miR156b | TTGACAGAAGATAGAGAGCAC | 21 | 1 |
| gma-miR166m | GCGGACCAGGCTTCATTCCCC | 21 | 1 |
| stu-miR399a | GGGCTACTCTCTATTGGCATG | 21 | 1 |
| bna-miR156a | TGACAGAAGAGAGTGAGCAC | 20 | 1 |
Figure 2The abundance levels of miR-166a in mouse serum after feeding with rapeseed bee pollen or chow diet for 6 h (n = 5). p < 0.05.