Literature DB >> 27597967

Identification of Dietetically Absorbed Rapeseed (Brassica campestris L.) Bee Pollen MicroRNAs in Serum of Mice.

Xuan Chen1, Guan-Hai Dai1, Ze-Ming Ren1, Ye-Ling Tong1, Feng Yang1, Yong-Qiang Zhu1.   

Abstract

MicroRNAs (miRNAs) are a class of small noncoding RNA that, through mediating posttranscriptional gene regulation, play a critical role in nearly all biological processes. Over the last decade it has become apparent that plant miRNAs may serve as a novel functional component of food with therapeutic effects including anti-influenza and antitumor. Rapeseed bee pollen has good properties in enhancing immune function as well as preventing and treating disease. In this study, we identified the exogenous miRNAs from rapeseed bee pollen in mice blood using RNA-seq technology. We found that miR-166a was the most highly enriched exogenous plant miRNAs in the blood of mice fed with rapeseed bee pollen, followed by miR-159. Subsequently, RT-qPCR results confirmed that these two miRNAs also can be detected in rapeseed bee pollen. Our results suggested that food-derived exogenous miRNAs from rapeseed bee pollen could be absorbed in mice and the abundance of exogenous miRNAs in mouse blood is dependent on their original levels in the rapeseed bee pollen.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27597967      PMCID: PMC5002473          DOI: 10.1155/2016/5413849

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

MicroRNAs (miRNAs) are a class of small noncoding RNA that mediate posttranscriptional gene regulation by promoting cleavage or inhibiting translation of the target mRNA in plants or animals and play a critical role in nearly all biological processes, including metabolism and immune functions [1-3]. Recent studies suggest that plant miRNA may serve as a novel functional component of food which makes a critical contribution to maintaining and shaping animal body structure and function [4]. In 2012, a pilot study found that plant miRNAs from the diet will be absorbed by cells of the mammalian digestive tract and then packaged into microvesicles [4]. The microvesicles protect plant miRNAs from degradation and deliver them via the bloodstream to a variety of tissues (liver, kidney, heart, and brain), in which they will regulate cell gene expression [4]. Using the next-generation sequencing technology, Wang et al. demonstrated that human plasma contains a wide range of RNA from many exogenous species, including bacteria, fungi, and foods such as corn, rice, soybean, tomato, and grape [5]. Lukasik and Zielenkiewicz performed a bioinformatics analysis of publicly available raw data from studies on miRNAs composition in human and porcine breast milk exosomes to identify the fraction of food-derived miRNAs, and 35 and 17 miRNA species were identified, respectively [6]. miR-172 is the most highly enriched miRNA in Brassica oleracea, and after feeding mice with Brassica oleracea, miR-172 was found in the stomach, intestine, serum/blood, spleen, liver, kidney, and feces of mice [7]. Studies have shown that food-derived plant miRNAs have immunomodulating effects such as anti-influenza virus and antitumor [8, 9]. Zhou et al. found the first active miRNA in traditional Chinese medicine named miR-2911, a honeysuckle- (HS-) encoded atypical miRNA, that directly targets various influenza A viruses (IAVs) [8]. Subsequently, Yang et al. reported that miR-2911 levels fluctuated among various herbs. Feeding these different herb-based diets to the mice leads to different miR-2911 levels in the sera and urine which is associated with dietary intake levels [10]. Mlotshwa and others synthesized 3 tumor suppressor miRNAs (miR-34a, miR-143, and miR-145) with a characteristic of plant miRNA [11], and they reported that oral administration of the cocktail reduced tumor burden in well-established ApcMin/+ mouse model of colon cancer [12]. Furthermore, Western donor sera contained the plant miRNA miR159, whose abundance in the serum was inversely correlated with breast cancer incidence and progression in patients, and they demonstrated for the first time that a plant miRNA can inhibit cancer growth in mammals in vivo and in vitro [9]. Rapeseed (Brassica campestris L.) pollen is microgametophytes of rape. Bee-collected rapeseed pollen is widely used in food and healthy products [13]. In vivo and in vitro experiments demonstrated that the immune modulating effects by bee pollen might be attributed to its prevention and treatment for diseases [13-15]. Besides, RNA is rich in rapeseed bee pollen [16]. Nevertheless, whether miRNAs in rapeseed bee pollen could be absorbed by animals remains unclear. In this study, ICR mice were fed with rapeseed bee pollen, and then plant miRNAs including rapeseed miRNAs in mice blood were detected using next-generation sequencing technology.

2. Materials and Methods

2.1. Rapeseed Bee Pollen

The rapeseed bee pollen was bought from Bee Research Institute of Anhui Agriculture University. The implementation of the standard is GB/T11758-89-bee pollen. Single pollen rates are over 95%, and the production date was November 10, 2015.

2.2. Animal Studies

All animal experiments were performed using male ICR strain mice on a 12 h light/dark cycle in a pathogen-free animal feeding facility at Zhejiang Academy of Traditional Chinese Medicine. The animal study protocols were approved by the Animal Care and Use Committee of Zhejiang Academy of Traditional Chinese Medicine. At 6 weeks of age (weighted 26.37 ± 2.7 g), each mouse was fed rapeseed bee pollen (10 g/kg) by gavage. After a fixed time interval (3 h or 6 h on d1, d4, or d8), serum about 200 μL was collected from each mouse, and then total RNA was extracted using mirVana™ PARIS™ Kit (AM1556, Ambion™).

2.3. Illumina Hiseq2500 Sequencing

The sequencing procedure was conducted according to standard steps provided by Illumina company, Inc. Briefly, a pair of adaptors were ligated to the 3′ and 5′ ends of total RNA. Reverse transcription followed by PCR is used to create cDNA constructs based on the small RNA ligated with 3′ and 5′ adapters. This process selectively enriches those fragments that have adapter molecules on both ends. Then the fragments of around 147–157 bp (22–30 nt length small RNA + adaptors) were purified by PAGE. The purified DNA was directly used for the cluster generation and sequencing using Illumina Hiseq2500 according to the manufacturer's instructions. The image files generated by the sequencer were then processed to produce digital data. The subsequent procedures included removing adapter dimers, junk, low complexity, common RNA families (rRNA, tRNA, snRNA, and snoRNA), and repeats. Subsequently, unique sequences with length in 18–26 nucleotides were mapped onto all plant miRNA precursors in miRBase 20.0 by BLAST search to identify known miRNAs and novel 3p- and 5p-derived miRNAs. Length variation at both 3′ and 5′ ends and one mismatch inside of the sequence were allowed in the alignment. The unique sequences mapping onto specific species mature miRNAs in hairpin arms were identified as known miRNAs. The unique sequences mapping onto the other arm of known specific species precursor hairpin opposite to the annotated mature miRNA-containing arm were considered to be novel 5p- or 3p-derived miRNA candidates.

2.4. Analysis of Level of miRNAs in Rapeseed Bee Pollen by RT-qPCR

Total RNA was extracted from 80 mg rapeseed bee pollen using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Quantitative RT-PCR was performed using Taqman miRNA probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. To calculate the absolute expression levels of target miRNAs, a series of synthetic miRNA oligonucleotides at known concentrations were reverse transcribed and amplified. The absolute amount of each miRNA was then calculated with reference to the standard curve. Quantitative PCR was performed using an ABI-StepOnePlus machine (Applied Biosystems).

2.5. Statistical Analysis

Differences are considered statistically significant at P < 0.05, using Student's t-test.

3. Results

3.1. Raw Data Filtering

We sequenced a small RNA library from blood RNA of mouse fed with rapeseed bee pollen using the Illumina Hiseq2500 system. We acquired a total of 11,089,480 raw sequences. Overview of these reads from raw data to cleaned sequences is shown in Table 1.
Table 1

Overview of reads.

LibTypeTotal% of totalUnique% of unique
Raw readsNuclear acid11,089,480100.000209,873100.000
3ADT & length filter320,9922.895145,80869.474
Junk reads8580.0086100.291
RfamRNA47,5890.4296,4773.086
mRNARNA3,6940.0339050.431
RepeatsRNA3690.003740.035
rRNARNA19,9010.1792,0260.965
tRNARNA15,1760.1372,5271.204
snoRNARNA5,5070.0507500.357
snRNARNA5270.0052430.116
Plant miRNARNA2210.002330.016
Another Rfam RNARNA6,4780.0589310.444
Clean reads10,716,78596.63956,13626.748
We illustrated small RNA reads with Rfam dataset; to remove rRNA, scRNA, snoRNA, snRNA, and tRNA, the pie charts were drawn for total reads and unique reads (Figure 1).
Figure 1

Pie chart of sequence category. (a) Pie chart of sequence category of total reads. (b) Pie chart of sequence category of unique reads.

3.2. Plant miRNAs Spectrum in Serum of Mice Fed with Rapeseed Bee Pollen

After removing the junk reads, the clean reads yield 34 plant miRNAs (Table 2). Plant miRNAs are 2′-O-methyl modified on their terminal nucleotide; in contrast, mammalian miRNAs with free 2′ and 3′ hydroxyls render plant miRNAs more difficult to be ligated to the cloning adapter compared with mammalian miRNAs. As a result, in the 11,089,480 raw reads, there were only 132 reads of plant miRNAs. However, some plant miRNAs can be detected even though the mammalian miRNAs caused a strong disturbance; in turn this proves that the content of plant miRNAs in mouse blood was not low. Among the plant miRNAs, miR-166a and miR-159 were with the highest levels in mouse blood; besides, these two miRNAs were both mapped onto rapeseed genome.
Table 2

Plant miRNAs in mice fed with rapeseed bee pollen.

miRNA IDmiRNA sequenceLength (nt)Frequency
bna-miR-166aTCGGACCAGGCTTCATTCCCC2135
bna-miR-159TTTGGATTGAAGGGAGCTCTA2122
gma-miR6300GTCGTTGTAGTATAGTGGT198
nta-miR6145eATTGTTACATGTAGCACTGGCT227
nta-miR6146bTTTGTCCAATGAAATACTTATC226
nta-miR6020bAAATGTTCTTCGAGTATCTTC215
nta-miR6149aTTGATACGCACCTGAATCGGC215
ath-miR-166aTTCGGACCAGGCTTCATTCCCC223
osa-miR530TGCATTTGCACCTGCACCTCC213
ahy-miR408TGCACTGCCTCTTCCCTGGCT213
mdm-miR408aTGCACTGCCTCTTCCCTGGCT213
bna-miR397aATTGAGTGCAGCGTTGATG192
peu-MIR2916CAACCATAAACGATGCCGACCAGG242
nta-miR168aTCGCTTGGTGCAGGTCGGGAC212
gma-miR482bTCTTCCCTACACCTCCCATACC222
nta-miR482aTTTCCAATTCCACCCATTCCTA222
nta-miR827TTAGATGAACATCAACAAACA212
ppt-miR894TTCACGTCGGGTTCACCA182
gma-miR3522TGAGACCAAATGAGCAGCTGA212
gma-miR4996TAGAAGCTCCCCATGTTCTCA212
bna-miR403TTAGATTCACGCACAAACTCG211
peu-MIR2916ACCGTCCTAGTCTCAACCATA211
aau-miR162TCGATAAACCTCTGCATCCAG211
bdi-miR398aTATGTTCTCAGGTCGCCCCTGT221
gma-miR403aTTAGATTCACGCACAAACTT201
gma-miR1507aTCTCATTCCATACATCGTCTGA221
nta-miR6159TAGCATAGAATTCTCGCACCTA221
hbr-miR6173GCTGTAAACGATGGATACT191
ptc-miR6478CCGACCTTAGCTCAGTTGGT201
stu-miR7997cTTGCTCGGATTCTTCAAAAAT211
bna-miR156bTTGACAGAAGATAGAGAGCAC211
gma-miR166mGCGGACCAGGCTTCATTCCCC211
stu-miR399aGGGCTACTCTCTATTGGCATG211
bna-miR156aTGACAGAAGAGAGTGAGCAC201

3.3. Comparison of Abundance Levels of miR-166a and miR-159 in Rapeseed Bee Pollen

Based on the predominant two miRNAs (miR-166a and miR-159) in the blood, we assumed that miR-166a and miR-159 can be found in rapeseed bee pollen, and the content of miRNAs in the rapeseed pollen also will follow the trend in the serum. To confirm this, the levels of miR-166a and miR-159 in rapeseed bee pollen were assessed by stem-loop quantitative reverse transcription polymerase chain reaction (RT-qPCR) assay. As a result, miR-166a and miR-159 can be detected in RNA of rapeseed bee pollen (Additional Figure 1 in Supplementary Material available online at http://dx.doi.org/10.1155/2016/5413849). Moreover, the CT values of miR-166a and miR-159 were 23.8 ± 0.23 and 31.22 ± 0.33, respectively, suggesting that the abundance level of miR-166a was higher than miR-159. These results suggested that food-derived exogenous miRNA from rapeseed bee pollen could be absorbed by mouse, and the abundance of specific miRNAs is dependent on their origins from the rapeseed bee pollen.

3.4. Comparison of Abundance Levels of miR-166a between Mice Fed with Rapeseed Bee Pollen and Control

Given that miR-166a is the highest abundance rape-encoded miRNA in mice fed with rapeseed bee pollen, and it is rich in rapeseed bee pollen, we speculate that the miR-166a in mouse serum are mainly absorbed from rapeseed bee pollen. To test this speculation, we compared the abundance level of miR-166a in serum of mice fed with rapeseed bee pollen and control. As it is reported that the levels of plant-based miRNAs were elevated in serum of mice for 6 h [4], we compared the levels of miR-166a in serum of mice fed with rapeseed bee pollen after 6 h and control. As shown in Figure 2 and additional Figure 2, the levels of miR-166a were elevated in serum of mice fed with rapeseed bee pollen for 6 h compared with control by RT-qPCR.
Figure 2

The abundance levels of miR-166a in mouse serum after feeding with rapeseed bee pollen or chow diet for 6 h (n = 5). p < 0.05.

4. Discussion

An estimated 60% of all protein-coding genes are targeted by miRNAs in human [17]. In addition, many miRNAs are deregulated in immune system, inducing diseases like autoimmune diseases, inflammation, and tumors [3]. Food-derived miRNAs have the potential to restore the downregulated miRNAs in diseases. For example, immune-related miRNAs are abundant in breast milk, and they might play a critical role in the development of the infant immune system [18]. Furthermore, Western donor sera contained the plant miRNA miR159, whose abundance in the serum was inversely correlated with breast cancer incidence and progression in patients [9]. These studies raise the intriguing prospect of using edible plants miRNAs to prevent and treat mammal diseases. Bee pollen is rich in nutrition and medicinal composition, which ensued a wide use of bee pollen in food, health products, medicine, cosmetics, and other fields [13, 19, 20]. In the field of medicals, bee pollen is used for prevention and treatment of prostate diseases [14], cardiovascular and cerebrovascular diseases, immune diseases, and so forth [15]. Besides, bee pollen is rich in RNA with a range of 0.6%–1% (w/w) [16]. In this study, we confirmed that miRNAs from rapeseed bee pollen can be absorbed by mice, and the abundance of exogenous miRNAs in mouse blood is dependent on their original levels in pollen. Moreover, the detailed functions of these exogenous miRNAs in mammals should be investigated to help clarify the immune function or medical efficacy of bee pollen. Nevertheless, the present study provided first hand evidence for the potential usages of rapeseed bee pollen as a supplement of plant miRNAs. The amplification curve of miR-159 (red) and miR-166a (green) by qPCR
  15 in total

1.  Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA.

Authors:  Lin Zhang; Dongxia Hou; Xi Chen; Donghai Li; Lingyun Zhu; Yujing Zhang; Jing Li; Zhen Bian; Xiangying Liang; Xing Cai; Yuan Yin; Cheng Wang; Tianfu Zhang; Dihan Zhu; Dianmu Zhang; Jie Xu; Qun Chen; Yi Ba; Jing Liu; Qiang Wang; Jianqun Chen; Jin Wang; Meng Wang; Qipeng Zhang; Junfeng Zhang; Ke Zen; Chen-Yu Zhang
Journal:  Cell Res       Date:  2011-09-20       Impact factor: 25.617

Review 2.  MicroRNAs: genomics, biogenesis, mechanism, and function.

Authors:  David P Bartel
Journal:  Cell       Date:  2004-01-23       Impact factor: 41.582

Review 3.  The functions of animal microRNAs.

Authors:  Victor Ambros
Journal:  Nature       Date:  2004-09-16       Impact factor: 49.962

Review 4.  Regulation of mRNA translation and stability by microRNAs.

Authors:  Marc Robert Fabian; Nahum Sonenberg; Witold Filipowicz
Journal:  Annu Rev Biochem       Date:  2010       Impact factor: 23.643

5.  Immune-related microRNAs are abundant in breast milk exosomes.

Authors:  Qi Zhou; Mingzhou Li; Xiaoyan Wang; Qingzhi Li; Tao Wang; Qi Zhu; Xiaochuan Zhou; Xin Wang; Xiaolian Gao; Xuewei Li
Journal:  Int J Biol Sci       Date:  2011-11-29       Impact factor: 6.580

6.  Assessing the survival of exogenous plant microRNA in mice.

Authors:  GaoFeng Liang; YanLiang Zhu; Bo Sun; YouHua Shao; AiHua Jing; JunHua Wang; ZhongDang Xiao
Journal:  Food Sci Nutr       Date:  2014-05-15       Impact factor: 2.863

7.  A novel chemopreventive strategy based on therapeutic microRNAs produced in plants.

Authors:  Sizolwenkosi Mlotshwa; Gail J Pruss; John L MacArthur; Matthew W Endres; Celestia Davis; Lorne J Hofseth; Maria Marjorette Peña; Vicki Vance
Journal:  Cell Res       Date:  2015-02-27       Impact factor: 25.617

8.  Methylation as a crucial step in plant microRNA biogenesis.

Authors:  Bin Yu; Zhiyong Yang; Junjie Li; Svetlana Minakhina; Maocheng Yang; Richard W Padgett; Ruth Steward; Xuemei Chen
Journal:  Science       Date:  2005-02-11       Impact factor: 47.728

9.  Honeysuckle-encoded atypical microRNA2911 directly targets influenza A viruses.

Authors:  Zhen Zhou; Xihan Li; Jinxiong Liu; Lei Dong; Qun Chen; Jialing Liu; Huihui Kong; Qianyi Zhang; Xian Qi; Dongxia Hou; Lin Zhang; Guoquan Zhang; Yuchen Liu; Yujing Zhang; Jing Li; Jin Wang; Xi Chen; Hua Wang; Junfeng Zhang; Hualan Chen; Ke Zen; Chen-Yu Zhang
Journal:  Cell Res       Date:  2014-10-07       Impact factor: 25.617

10.  In silico identification of plant miRNAs in mammalian breast milk exosomes--a small step forward?

Authors:  Anna Lukasik; Piotr Zielenkiewicz
Journal:  PLoS One       Date:  2014-06-16       Impact factor: 3.240

View more
  13 in total

Review 1.  Dietary microRNA-A Novel Functional Component of Food.

Authors:  Lin Zhang; Ting Chen; Yulong Yin; Chen-Yu Zhang; Yong-Liang Zhang
Journal:  Adv Nutr       Date:  2019-07-01       Impact factor: 8.701

Review 2.  Dietary plant miRNAs as an augmented therapy: cross-kingdom gene regulation.

Authors:  Ritu Trivedi; Mehar Hasan Asif; Prabodh Kumar Trivedi
Journal:  RNA Biol       Date:  2018-12-10       Impact factor: 4.652

Review 3.  Biological Activities of Extracellular Vesicles and Their Cargos from Bovine and Human Milk in Humans and Implications for Infants.

Authors:  Janos Zempleni; Ana Aguilar-Lozano; Mahrou Sadri; Sonal Sukreet; Sonia Manca; Di Wu; Fang Zhou; Ezra Mutai
Journal:  J Nutr       Date:  2016-11-16       Impact factor: 4.798

4.  RNase H2-Dependent Polymerase Chain Reaction and Elimination of Confounders in Sample Collection, Storage, and Analysis Strengthen Evidence That microRNAs in Bovine Milk Are Bioavailable in Humans.

Authors:  Lanfang Wang; Mahrou Sadri; David Giraud; Janos Zempleni
Journal:  J Nutr       Date:  2018-01-01       Impact factor: 4.798

Review 5.  Formidable challenges to the notion of biologically important roles for dietary small RNAs in ingesting mammals.

Authors:  Stephen Y Chan; Jonathan W Snow
Journal:  Genes Nutr       Date:  2017-07-07       Impact factor: 5.523

6.  Milk exosomes: beyond dietary microRNAs.

Authors:  Janos Zempleni
Journal:  Genes Nutr       Date:  2017-06-22       Impact factor: 5.523

Review 7.  New Insight into Inter-kingdom Communication: Horizontal Transfer of Mobile Small RNAs.

Authors:  Geyu Zhou; Yu Zhou; Xi Chen
Journal:  Front Microbiol       Date:  2017-05-01       Impact factor: 5.640

8.  Dietary miR-451 protects erythroid cells from oxidative stress via increasing the activity of Foxo3 pathway.

Authors:  Wanchen Wang; Chengwen Hang; Yanqing Zhang; Mingshi Chen; Xinyu Meng; Qing Cao; Nana Song; Jacobi Itkow; Feiyang Shen; Duonan Yu
Journal:  Oncotarget       Date:  2017-11-10

Review 9.  Nutrimiromics: Role of microRNAs and Nutrition in Modulating Inflammation and Chronic Diseases.

Authors:  Bruna J Quintanilha; Bruna Z Reis; Graziela B Silva Duarte; Silvia M F Cozzolino; Marcelo M Rogero
Journal:  Nutrients       Date:  2017-10-27       Impact factor: 5.717

10.  Study on the inhibition of Mfn1 by plant-derived miR5338 mediating the treatment of BPH with rape bee pollen.

Authors:  Xuan Chen; Ren-Zhao Wu; Yong-Qiang Zhu; Ze-Ming Ren; Ye-Ling Tong; Feng Yang; Guan-Hai Dai
Journal:  BMC Complement Altern Med       Date:  2018-01-30       Impact factor: 3.659

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.