Literature DB >> 27588694

The TamB ortholog of Borrelia burgdorferi interacts with the β-barrel assembly machine (BAM) complex protein BamA.

Henna Iqbal1, Melisha R Kenedy1, Meghan Lybecker2, Darrin R Akins1.   

Abstract

Two outer membrane protein (OMP) transport systems in diderm bacteria assist in assembly and export of OMPs. These two systems are the β-barrel assembly machine (BAM) complex and the translocation and assembly module (TAM). The BAM complex consists of the OMP component BamA along with several outer membrane associated proteins. The TAM also consists of an OMP, designated TamA, and a single inner membrane (IM) protein, TamB. Together TamA and TamB aid in the secretion of virulence-associated OMPs. In this study we characterized the hypothetical protein BB0794 in Borrelia burgdorferi. BB0794 contains a conserved DUF490 domain, which is a motif found in all TamB proteins. All spirochetes lack a TamA ortholog, but computational and physicochemical characterization of BB0794 revealed it is a TamB ortholog. Interestingly, BB0794 was observed to interact with BamA and a BB0794 regulatable mutant displayed altered cellular morphology and antibiotic sensitivity. The observation that B. burgdorferi contains a TamB ortholog that interacts with BamA and is required for proper outer membrane biogenesis not only identifies a novel role for TamB-like proteins, but also may explain why most diderms harbor a TamB-like protein while only a select group encodes TamA.
© 2016 The Authors. Molecular Microbiology Published by John Wiley & Sons Ltd.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27588694      PMCID: PMC5582053          DOI: 10.1111/mmi.13492

Source DB:  PubMed          Journal:  Mol Microbiol        ISSN: 0950-382X            Impact factor:   3.501


Introduction

Borrelia burgdorferi, the spirochete that causes Lyme disease, is classified as a diderm and is similar to Gram-negative organisms in that it contains both an inner membrane (IM) and outer membrane (OM) bilayer (Holt, 1978; Hovind-Hougen, 1984; Barbour and Hayes, 1986). Given that B. burgdorferi is an extracellular pathogen, the OM and its constituents are the major interface between the host and pathogen during infection (Fikrig ; 1992; Schaible ; Gilmore ; Ornstein ; Bunikis ). The borrelial OM is unique in many ways. For instance, the bilayer is not only composed of phosphatidylcholine and phosphatidylglycerol but it also contains free cholesterol, cholesterol esters, and three glycolipids [6-O-acylated cholesteryl β-D-galactopyranoside (ACGal), cholesteryl β-D-galactopyranoside (CGal), and mono-α-galactosyl-diacylglycerol (MGalD)] (Belisle ; Radolf ; Hossain ; Ben-Menachem ; Schroder ; Stubs ). Interestingly, the two cholesterol containing glycolipids (ACGal and CGal) along with free cholesterol have recently been shown to form ordered microdomains in the borrelial OM similar to eukaryotic lipid rafts (LaRocca ; 2013; Toledo ). Another significant feature of the B. burgdorferi OM is that, unlike Gram-negative bacteria, it lacks lipopolysaccharide (LPS) on its surface (Takayama ). Instead, the borrelial surface is decorated with lipid-modified proteins (i.e., lipoproteins) that are anchored into the outer leaflet of the OM (Fraser ; Casjens ; Brooks ; Kenedy ). The B. burgdorferi OM is also distinctive in that it contains a paucity of integral, membrane-spanning outer membrane proteins (OMPs) as compared to enteric Gram-negative organisms (Cullen ). In fact, it has been shown that there are 10-fold fewer OMPs in B. burgdorferi than in the OM of Escherichia coli (Lugtenberg and van Alphen, 1983; Radolf ). While these many distinctive aspects of the B. burgdorferi surface have been defined over the years, it is still poorly understood how biogenesis of its unique OM occurs. A major advance in the field of bacterial OM biogenesis occurred just over a decade ago when assembly and export of OMPs in Neisseria meningitidis was determined to be controlled by an essential and highly conserved OMP designated Omp85 (Voulhoux ). A similar finding by Silhavy and co-workers in E. coli identified a homolog of Omp85, designated YaeT, that was shown to be member of a large multi-protein complex required for the OM assembly process (Wu ). It has also been recognized that proteins structurally and functionally similar to Omp85 and YaeT exist not only in all diderm bacteria but they are found in double-membraned eukaryotic organelles as well, such as mitochondria and chloroplasts (Gentle ; Zeth, 2010; Schleiff ). The YaeT and Omp85 proteins along with their homologs in other diderm bacteria have since been designated BamA and the larger complex is referred to as the β-barrel assembly machine (BAM) (Kim ; Walther ; Hagan ). The BAM complex is required for proper folding, assembly and export of many OMPs as they move from the periplasm into the bacterial OM, which is crucial to OM biogenesis (Wu ; Malinverni ; Kim ; Hagan ; Lenhart and Akins, 2010; Dunn ). The E. coli BAM complex has been well-characterized and consists of five members, the central OMP BamA and four accessory lipoproteins termed BamB, C, D and E (Wu ; Onufryk ; Ruiz ; Malinverni ; Sklar ; Walther ). Previous studies by our laboratory have revealed that the BAM complex in B. burgdorferi is much more compact consisting only of BamA and two accessory lipoproteins, BamB and BamD (Lenhart and Akins, 2010; Lenhart ; Dunn ). The overall structure of BamA is comprised of a C-terminal transmembrane β-barrel domain that is embedded in the OM and a large N-terminal periplasmic component divided into five distinct polypeptide transport-associated (POTRA) domains (Sanchez-Pulido ; Gentle ; Gatzeva-Topalova ; Noinaj ). The POTRA domains are prerequisites for BamA interactions with nascent OMPs and the accessory proteins of the BAM complex (Kim ; Gatzeva-Topalova ; Anwari ; Heuck ; Workman ; Bakelar ). In addition to BamA, several other bacterial OMPs have recently been identified that also belong to the Omp85 protein family, including the TamA, TamL, patatin-Omp85, WD40-Omp85, metallo-Omp85 and noNterm-Omp85 proteins (Selkrig ; Heinz and Lithgow, 2014; Heinz ). Among these other Omp85 family members TamA has been the best characterized (Gruss ; Selkrig ; 2015; Shen ). Similar to the structure of BamA, TamA also consists of a C-terminal OM-associated β-barrel region and an N-terminal periplasmic region that contains three POTRA domains (Gruss ). TamA was first identified in the Enterobacteriaceae by Lithgow and co-workers and was shown to be part of a distinct complex termed the translocation and assembly module (TAM) (Selkrig ). The TAM consists of TamA and TamB; the OMP TamA interacts with the IM protein TamB and together they facilitate the assembly, localization, and export of many proteins, including autotransporters and other β-barrel OMPs such as fimbrial usher proteins and intimin (Selkrig ; Heinz ; Stubenrauch ). Phylogenetic analyses have indicated that a possible gene duplication of BamA in a Proteobacterial ancestor resulted in the generation of TamA (Heinz ). Thus, TamA is found only in Proteobacteria. On the other hand, TamB is ubiquitously distributed throughout all diderms with only a few rare exceptions (Heinz ). This latter point suggests that TamB plays an important but yet-to-be-identified function other than its well-characterized role in the Proteobacterial TAM. Previous studies have revealed that TamB is anchored to the IM by an uncleaved signal peptide at its N-terminus, while its C-terminal region contains a conserved domain of unknown function 490 (DUF490) (Selkrig ; 2015; Gallant ). Additionally, TamB orthologs are typically found to be encoded contiguous to or in close proximity to proteins from the Omp85 family (Heinz ). For example, TamB is found in an operon with TamA in the Proteobacteria (Heinz ; Gallant ; Milner ), downstream of TamL in Bacteroidetes spp. and Chlorobi spp. (Heinz ), and in close proximity to BamA in organisms from the early-branching phyla, such as the Fusobacteria, Dictyoglomi and Firmicutes (Heinz ). Interestingly, B. burgdorferi encodes a single protein, BB0794, containing a DUF490 motif and it is located immediately upstream of BamA. This observation led to the suggestion that BB0794 is a TamB ortholog, although there is currently no experimental proof supporting this conjecture (Selkrig ). In the present study, we performed a detailed physicochemical characterization of BB0794. Signal peptide predictions, secondary structure modeling, and cellular localization assays revealed that BB0794 is anchored to the borrelial IM by an uncleaved signal peptide, which is similar to other TamB proteins. However, unlike TamB from the Proteobacteria, BB0794 is apparently essential for B. burgdorferi viability. Thus, an IPTG-regulatable bb0794 mutant was generated. Examination of the mutant revealed that BB0794 is required to maintain normal bacterial morphology in B. burgdorferi. Moreover, co-immunoprecipitation experiments indicated that BB0794 specifically interacts with BamA. The combined data provide strong support for our conclusion that BB0794 is the TamB ortholog. Finally, the interaction observed between BB0794 and BamA leads us to speculate that TamB orthologs play an important role in OM biogenesis beyond their currently described function in the Proteobacterial TAM (Selkrig ).

Results

Domain structure and genetic organization of bb0794

BB0794 was recently suggested to be a TamB homolog in B. burgdorferi (Selkrig ). Despite an overall lack of sequence similarity between BB0794 and TamB (11% identity and 25% similarity score) BB0794 does contain two features conserved among all TamB orthologs, an N-terminal signal peptide and a C-terminal 325 amino acid region containing a DUF490 domain (Fig. 1A) (Heinz ). The DUF490 domain of BB0794, however, is only 13% identical and 28% similar to the DUF490 domain from the E. coli TamB, but it is predicted to have a secondary structure similar to all other DUF490 members consisting of multiple β-strands separated by a region of α-helix (Fig. 1B). Additionally, TamB proteins in other organisms are typically encoded within an operon containing a member of the Omp85 family of proteins, such as TamA, TamL, or BamA (Heinz ). Upon examination of the genetic locus containing BB0794, we observed that the gene encoding BB0794 is found immediately upstream of the genes encoding BamA and the periplasmic chaperone Skp, which together could possibly constitute a three gene operon. The genetic loci comparison among the most widespread genospecies, B. burgdorferi, B. garinii and B. afzelii are shown in Fig. 1C.
Fig. 1

Domain analysis and secondary structure prediction of BB0794 and its genetic organization in B. burgdorferi sensu lato

A. Schematic of the BB0794 protein. The gray boxes from amino acids 1–34 indicate the putative N-terminal signal peptide predicted by PrediSi (Nielsen ) while amino acid 1117–1443 represent the C-terminal DUF490 domain identified by the Conserved Domain Database (CDD) algorithm (Derbyshire ).

B. Comparison of the B. burgdorferi BB0794 DUF490 domain (amino acids 1117–1443) and the E. coli TamB DUF490 domain (amino acids 923–1259). Secondary structure was predicted using PSIPRED (Jones, 1999) with β-sheet and α-helical regions equal to or greater than five amino acids designated as arrows and cylinders respectively.

C. Genetic organization of the chromosomal region surrounding the B. burgdorferi (Bb) bb0794 gene and the corresponding genomic region in B. garinii (Bg) and B. afzelii (Ba). Yellow boxes indicate the predicted DUF490 domains.

Expression of BB0794 and analysis of its physicochemical nature

The E. coli TamB protein is constitutively expressed and located in the periplasm (Selkrig ; 2015; Shen ). Interestingly, the borrelial genome deposited in the NCBI database for B. burgdorferi B31 (NCBI accession AE000783) has a missing nucleotide in bb0794 gene which is annotated as a ‘K’ at base position 2395. The comparable base is noted as a guanine (G) in the annotated B. garinii and B. afzelii genomes. Resequencing this region in B. burgdorferi revealed that base 2395 corresponds to a G nucleotide in B. burgdorferi and the entire bb0794 sequence encodes a predicted protein of 1465 amino acids. This analysis of the bb0794 sequence is also supported by a recent resequencing of the B. burgdorferi genome that also indicated this base corresponds to a G in the bb0794 gene (NCBI accession CP009656). To verify the gene sequencing results, we subsequently analyzed BB0794 expression and performed immunoblot analysis of borrelial whole cell-lysates using BB0794-specific antibodies. As expected from the corrected sequence analysis, we observed a protein of the expected size (168 kDa) expressed by B. burgdorferi, B. garinii and B. afzelii (Fig 2A).
Fig. 2

Expression and physicochemical properties of BB0794

A. Immunoblot analysis of whole-cell lysates (5 × 107 per lane) of B. burgdorferi (Bb), B. garinii (Bg) and B. afzelii (Ba) using BB0794-specific antisera. Molecular weight markers, in kDa, are shown at left.

B. Triton X-114 phase partitioning (TX-114) of B. burgdorferi with equivalent amounts of the detergent-enriched and aqueous-enriched phases separated by SDS-PAGE and stained with Coomassie Brilliant Blue (CBB) R-250. Molecular weight standards, in kDa, are shown at left.

C. Equal amounts of the detergent-enriched (D) and aqueous-enriched (A) phases were subjected to immunoblot analysis with BB0794-specific antisera. To ensure phase separation was complete, immunoblots with specific antisera against the amphiphilic membrane lipoprotein BamB and the soluble periplasmic protein Skp were included as controls.

To determine the physicochemical properties of BB0794 we performed Triton X-114 phase partitioning (TX-114 PP) to first determine if it is expressed as a soluble periplasmic protein or it has amphiphilic character similar to membrane proteins. This assay can separate membrane proteins from periplasmic or cytoplasmic proteins based on their overall solubility in Triton X-114 (Bordier, 1981; Brusca and Radolf, 1994). Membrane proteins partition into the detergent-enriched phase while soluble proteins partition into the aqueous phase (Fig. 2B). When Triton X-114 separated fractions were subjected to immunoblot using BB0794-specific antibodies, BB0794 was found exclusively in the detergent-enriched phase (Fig. 2C), which indicated BB0794 is a membrane protein. Immunoblot analyses for the membrane-associated lipoprotein BamB and the soluble periplasmic protein Skp also were included as controls for the detergent and aqueous phases respectively.

Localization of BB0794 to the IM

Since TX-114 PP indicated that BB0794 is a membrane-associated protein, we next examined the localization of BB0794 by surface immunofluorescence assays (IFA) using BB0794-specific antisera (Fig. 3A). This analysis revealed that BB0794 could only be visualized when the spirochetal OM had been permeabilized, which was similar to the staining pattern observed for the periplasmic protein FlaB. OspA antibodies were included as a control outer surface protein and, as expected, OspA could be observed on the surface of intact spirochetes.
Fig. 3

BB0794 is not surface-exposed and associates with the IM

A. Indirect immunofluorescence assays were performed in solution on intact B. burgdorferi (Surface panels) and acetone-fixed organisms (Permeabilized panels). Spirochetes were probed with BB0794-specific antisera (BB0794 panels) or antibodies directed against the surface exposed protein OspA (OspA panels) along with antibodies against the periplasmic protein FlaB (FlaB panels). FlaB antibodies were included with the BB0794 or OspA antibodies to ensure that organisms remained intact during the surface immunofluorescence assays. DAPI (4′,6-diamidino-2-phenylindole) was also included for each experiment as a counterstain to identify all spirochetes in a given field.

B. B. burgdorferi whole-cell lysates (1.25 × 107 per lane) were incubated with (+) or without (−) proteinase K before being subjected to immunoblot analysis with specific antibodies against BB0794, OspA, or OppAIV.

C. Protoplasmic cylinder (PC) or outer membrane (OM) fractions from B. burgdorferi were isolated before equivalent amounts were subjected to immunoblot analysis with antibodies specific for BB0794, BamA, or OppAIV.

Although the immunofluorescence results indicated that BB0794 is not surface-exposed, to rule out the possibility that a surface-exposed domain was not accessible to antibodies by IFA, we also performed proteinase K (PK) experiments using whole B. burgdorferi cells. Consistent with the IFA result, the PK experiment revealed that BB0794 was not degraded by PK treatment (Fig. 3B). By contrast, the known surface-exposed protein OspA was found to be completely degraded by PK while the IM lipoprotein OppAIV, as expected was not degraded. Finally, when membrane fractionation was performed on B. burgdorferi to separate OM and protoplasmic cylinder (PC) fractions, BB0794 was found to be associated only with the PC fraction (Fig. 3C). For the fractionation experiments, antibodies specific for BamA were used as a control for a known OMP. BamA was observed in both the OM and PC preparations, as expected. To ensure the OM fractions were highly enriched and devoid of PC contents, we confirmed that the IM lipoprotein OppAIV was identified only in the PC fraction. The combined localization studies indicate that BB0794 is not localized to the OM and is associated only with the borrelial PC fraction.

BB0794 is anchored to the IM by an uncleaved signal peptide

The TamB protein from E. coli has a hydrophobic stretch of approximately 25 amino acids at its N-terminus that anchors it to the IM (Selkrig ; Shen ). Interestingly, the first 39 amino acids of the BB0794 sequence also is comprised of a hydrophobic domain based on Kyte-Doolittle hydrophobicity scores (Kyte and Doolittle, 1982). The PrediSi signal peptide prediction program, however, predicted that the N-terminus of BB0794 corresponds to a Sec-dependent signal peptide that is cleaved by signal peptidase I at amino acid 34 (data not shown) (Nielsen ). A more detailed analysis of BB0794 using the transmembrane domain identification algorithms TMHMM and Phobius revealed that other than the N-terminal hydrophobic region corresponding to first 34 amino acids (Krogh ; Kall ) there were no other potential transmembrane domains in BB0794 (data not shown). Therefore, to determine if the N-terminal hydrophobic region of BB0794 is a cleaved or an uncleaved signal peptide we fused the first 39 amino acids of BB0794 to the mature OspA sequence lacking its native signal peptide, which was designated OspA794N. The OspA794N construct and a full-length OspA with its native signal peptide (OspAWT) were then expressed in B. burgdorferi strain B313. Strain B313 was utilized for these experiments since it does not contain the liner plasmid 54 (lp54) element that harbors OspA in B. burgdorferi (Sadziene ). Subsequent immunoblot analysis revealed that the OspA794N chimera containing the BB0794 signal peptide migrated several kDa larger than OspAWT protein containing its native, cleaved signal peptide (Fig. 4A). This observation strongly suggested that the N-terminal region of BB0794 corresponds to an uncleaved signal peptide. To provide further support for this contention, we subjected whole-cell lysates from strain B313 expressing OspA794N to TX-114 PP. When the final Triton X-114 detergent-enriched and aqueous fractions were subjected to immunoblot with OspA antibodies, the OspA794N chimera partitioned exclusively into the detergent phase, confirming that OspA794N is a membrane-associated amphiphilic protein (Fig. 4B). However, the mature recombinant OspA, which was expressed without its signal peptide (rOspAmat), lacks the N-terminal lipidation site and therefore separates solely into the aqueous phase as a soluble protein after Triton X-114 PP (Fig. 4B). The membrane bound lipoprotein BamB and the hydrophilic protein Skp were used as whole cell-lysate controls to ensure full separation of the detergent and aqueous phases respectively. Finally, when PK surface accessibility assays were performed on OspA794N it was not degraded by PK, although the surface-exposed OspAWT protein was fully degraded by PK (Fig. 4C). As controls for the PK assays, the known PK sensitive protein P66 was shown to be partially degraded in the presence of PK while the IM-associated OppAIV was protected from PK degradation, as expected (Fig. 4C). The combined data indicated that BB0794 encodes an uncleaved signal peptide.
Fig. 4

BB0794 encodes an uncleaved signal peptide membrane anchor

A. Whole-cell lysates of B. burgdorferi strain B313 expressing either the N-terminal 39 amino acids of BB0794 fused to OspA lacking its signal peptide (OspA794N) or the wildtype OspA (OspAWT) protein were subjected to immunoblot analysis using OspA specific antisera. Whole cell-lysates of B313, which lacks the lp54 plasmid encoding OspA, was used as a negative control. Molecular weight standards, in kDa, are indicated at left.

B. Triton X-114 phase partitioning was performed on whole-cell lysates of B313 strains expressing the N-terminal 39 amino acids of BB0794 fused to the OspA protein lacking its signal peptide (OspA794N) and a recombinant form of OspA lacking its signal peptide (rOspAmat). The detergent-enriched (D) and aqueous-enriched (A) phases were separated by SDS-PAGE and subjected to immunoblot using OspA-specific antibodies. Additionally, antibodies specific to the membrane-anchored BamB lipoprotein and periplasmic protein Skp were included as controls to ensure complete phase separation of the borrelial whole-cell lysates.

C. B. burgdorferi strain B313 expressing OspA794N or OspAWT were incubated with (+) or without (−) proteinase K (PK) before whole-cell lysates (1.25 × 107 per lane) were subjected to immunoblot analysis with specific antibodies against OspA, the known outer membrane protein P66, or the inner membrane lipoprotein OppAIV.

BB0794 interacts with BamA in B. burgdorferi

The DUF490 domain of TamB has been shown to specifically interact with the POTRA1 domain of TamA (Selkrig ). A TamA ortholog, however, is not present in B. burgdorferi and the only POTRA domain-containing protein in B. burgdorferi is BamA (BB0795), which is encoded just downstream of BB0794. To examine the possibility that BB0794 might interact with the POTRA containing BamA protein in B. burgdorferi we next performed co-immunoprecipitation (co-IP) experiments using anti-BB0794 antibodies. This analysis revealed not only that BB0794 antibodies can co-immunoprecipitate BB0794 along with BamA but that BamA-specific antibodies can specifically co-immunoprecipitate BB0794 (Fig. 5). Antibodies against OppAIV were included in this experiment to confirm that the interaction between BB0794 and BamA was specific. GST antibodies also were used to ensure the BB0794/BamA interactions observed were not the result of nonspecific antibody binding.
Fig. 5

BB0794 and BamA can be co-immunoprecipitated in B. burgdorferi

Cultures of B. burgdorferi B31 (1 × 1010 organisms) were subjected to co-immunoprecipitation (co-IP) experiments with BB0794 and BamA-specific antibodies (indicated above top panel). Equal amounts of each co-IP elution were then subjected to SDS-PAGE and immunoblot analysis using antisera generated against BB0794 and BamA (indicated at left of each panel). To illustrate specificity of the BB0794-BamA interaction, elutions were also immunoblotted with antibodies against the inner membrane lipoprotein, OppAIV (bottom panel). GST-specific antibodies were included in the co-IP experiments as a nonspecific antibody control (right lane of each panel).

Generation of a regulatable BB0794 mutant strain

Prior studies on TamB have shown that its expression is not essential for bacterial viability (Gallant ; Selkrig ). After repeated attempts, however, we were unsuccessful in obtaining a bb0794 deletion mutant in B. burgdorferi. To overcome this obstacle, we generated an IPTG-regulatable bb0794 gene as shown in Fig. 6A. PCR analysis using specific primer pairs (white and black arrowheads in Fig. 6A) identified one mutant that had undergone recombination as expected (Fig. 6B). Since B. burgdorferi contains a large number of extrachromosomal linear and circular plasmids (cp), we also assessed the plasmid content of the mutant strain, designated flacp::bb0794. An analysis of all 21 endogenous plasmids in the parental and mutant strain revealed that the mutant maintained all plasmids except lp21 and cp32-7, neither of which have been implicated in borrelial physiology, virulence or the overall life-cycle of this organism in the tick or mammal (Purser and Norris, 2000; Stevenson ; Caimano ; Terekhova ; Casjens ). As expected, the expression of BB0794 in the flacp::bb0794 mutant was significantly reduced when IPTG was not included in the growth medium, although we never saw complete inhibition of BB0794 expression indicating that the regulation system is not fully repressed even when IPTG is absent. When IPTG was added, as little as 0.05 mM IPTG resulted in expression of BB0794 to a level similar to that observed with addition of 1 mM IPTG or in the parental strain (Fig. 6C). Interestingly, the expression of both BamA and Skp did not differ with the varying levels of IPTG in culture (Fig. 6C) even though it appeared that BB0794/BamA/Skp were part of a single operon and we assumed the BB0794 promoter would drive expression of these two downstream genes. As controls for the expression analyses, the level of the LacI repressor was also examined to ensure that it was expressed similarly in both the parental strain and in the mutant strain using differing levels of IPTG, and OppAIV was included to confirm that equal amounts of whole-cell lysates were loaded for all samples examined (Fig. 6C).
Fig. 6

Construction of an IPTG-regulated bb0794 gene and identification of unique transcriptional start sites for bb0794 and bamA/skp

A. The promoter region upstream of the bb0794 gene was replaced with the flacp IPTG-regulatable promotor and a streptomycin resistant cassette in B. burgdorferi strain B31-5A4 LK by homologous recombination as outlined in the Experimental Procedures.

B. PCR analysis of DNA from the resulting mutant flacp::bb0794 (M) and the parental strain B31-5A4 LK (WT) verified insertion of the complete recombination construct (left panel) and the orientation of the construct in the resulting mutant (right panel). Shown in the left panel are the amplicons resulting from the primer pair indicated by white arrowheads in Panel A that encompass the complete region inserted by the recombination construct. As expected, the 3 kb amplicon from the flacp::bb0794 mutant (lane M), which includes the streptomycin cassette and flacp, was 1.8 kb larger than the amplicon from the parental strain, which resulted in a 1.2 kb amplicon (lane WT). The recombination construct cloned into pBluescript-II KS+ was used as a positive control (+) while a reaction with no template DNA added was used as a negative control (−). Shown in the right panel is the amplicon generated from the primer pair shown as black arrowheads in Panel A that includes a region outside of the recombination construct to confirm the orientation of the streptomycin cassette and flacp promoter (lane M). A negative control was included lacking template DNA (−). Molecular weight standards for both panels, in kb, are shown at left.

C. Whole-cell lysates (5 × 107) of the flacp::bb0794 mutant cultivated in 0, 0.05, and 1 mM IPTG or the parental strain B31-5A4 LK (WT) were subjected to immunoblot analysis using BB0794, BamA, Skp, LacI, or OppAIV specific antibodies.

D. Identification of the mRNA start sites in the region flanking bb0794. Transcriptome data were mapped to the B. burgdorferi genome and visualized via Integrative Genomics Viewer (IGV). The genomic context of the operon is illustrated with transcriptional start sites (TSS) indicated by red arrows. The dashed box indicates the region of the gene displayed in the expanded coverage map of the transcriptome data generated. Putative promoter sequences (−10 and −35 sites) upstream of bb0794 and bamA are shown below the coverage maps and were predicted using BPROM (V. Solovyev, 2011) and virtual footprint v.3.0 (Munch ). The specific transcriptional start sites are represented by nucleotides in large, bold font for bb0794 (A) and bamA (G).

The observation that BB0794 expression was regulated by IPTG while BamA and Skp were not, indicated that these genes are not part of a single operon. To examine this issue, RNA-sequencing transcriptome data were analyzed to identify the 5′ ends of the mRNAs corresponding to bb0794, bamA and skp. As observed in previous deep-sequencing studies, sequencing reads accumulated with a pronounced peak at the 5′ end of each gene; this bias allows the relatively precise identification of transcription start sites (TSSs) based on the 5′ end of mapped reads (Perkins ; Hansen ; Raghavan , 2011b). This analysis revealed that BB0794 and BamA/Skp are encoded on distinct transcriptional units (Fig. 6D). The mRNA start site for bb0794 was identified 13 bp upstream of the bb0794 start codon and a single mRNA transcriptional start for both BamA and Skp was identified 343 bp upstream of the bamA start codon. The −10 and −35 promoter binding regions for bb0794 and bamA-skp also were mapped by BPROM and virtual footprint v.3.0 (Munch ; V. Solovyev, 2011), which correlated with the TSSs identified (Fig. 6D). No transcriptional start was identified upstream of skp, which further indicated that bamA and skp are co-transcribed. To our knowledge, a TamB or TamB-like protein has not yet been reported to be essential for survival, which makes this the first study to suggest that the expression of BB0794/TamB-like protein is essential and further underscores the indispensable requirement of BB0794 in this spirochete.

BB0794 impacts normal B. burgdorferi morphology

We next examined the growth characteristics of the flacp::bb0794 mutant with or without IPTG induction of BB0794 (Fig. 7A). While cell density between the parental and flacp::bb0794 mutant strain cultivated with 1 or 0.05 mM IPTG was similar at all time points, the mutant cultivated without IPTG had significantly fewer organisms throughout the exponential and stationary phases of growth. Although the flacp::bb0794 mutant was consistently observed to be at a lower cell density, the log phase doubling time of the mutant cultivated without IPTG (9.2 h) was similar to the parental strain (9 h) and the mutant cultivated with 0.05 or 1.0 mM IPTG (10 and 9.3 h respectively). During the growth analyses we observed that the flacp::bb0794 mutant strain cultivated without IPTG exhibited a distinct morphology with many of the spirochetes appearing to be long chains of unseparated organisms (Fig. 7B, left panel). While this phenotype can also account for the decreased total count of mutant spirochetes in growth assays, we did not observe any other alterations in bending, flexing, or overall motility of the extended length organisms. This notable and easily observable phenotypic alteration due to BB0794 depletion was fully rescued in the flacp::bb0794 mutant cultivated in the presence of either 0.05 or 1 mM IPTG (Fig. 7B).
Fig. 7

Growth and phenotypic analysis of the flacp::bb0794 mutant

A. The flacp::bb0794 mutant was grown in BSK-II complete medium in the absence of IPTG or in the presence of 0.05 mM or 1 mM IPTG along with the parental, strain B31-5A4 LK (WT). Triplicate samples for each growth condition were seeded at 3 000 organisms ml−1. Spirochetes were enumerated by dark field microscopy every 24 h for 11 days and mean number of organisms are shown. Significant differences between flacp::bb0794 grown in the absence of IPTG and all other culture conditions was assessed using t-test with Welch correction (p values < 0.05 were considered significant) and are indicated by asterisk. Error bars represent standard deviation.

B. The flacp::bb0794 mutant cultivated in complete BSK-II without IPTG or with 0.05, and 1 mM IPTG and the parental strain B31-5A4 LK (WT) were examined by dark-field microscopy at 400× magnification. Shown are representative fields of spirochetes from each condition during the mid-logarithmic phase of growth.

Deficiency of BB0794 increases the sensitivity of B. burgdorferi to antimicrobials

Previous studies have revealed that TamB plays an important role in maintaining OM integrity and morphology (Gallant ; Babu ; Selkrig ; Smith ). Given that we also observed the morphology of the BB0794 mutant to be altered, we next examined if the membrane integrity of the mutant also was impacted using antimicrobial sensitivity assays. We assessed the minimum inhibitory concentration (MIC) in the parental strain and the flacp::bb0794 mutant cultivated with or without IPTG using a group of hydrophilic antibiotics (penicillin G, carbenicillin and cefotaxime) that typically enter the cell through porins and a group of hydrophobic antibiotics that preferably enter the cell by crossing through the membrane bilayer (tetracycline, minocycline, azithromycin). As shown in Table 1, the flacp::bb0794 mutant cultivated in the absence of IPTG had a two-fold higher sensitivity to the hydrophobic antibiotic group (tetracycline, minocycline and azithromycin) as compared to the parent strain. The MIC values for the hydrophilic antibiotic group (penicillin, carbenicillin and cefotaxime) were not altered between the parental strain and mutant strain cultivated without IPTG. The combined data suggest that BB0794 plays a direct or indirect role in regulating and maintaining membrane permeability.
Table 1

BB0794 depletion alters the B. burgdorferi antibiotic sensitivity profile.

StrainMinimum inhibitory concentration (MIC) ng ml−1
TetracyclineMinocyclineAzithromycinPenicillin GCarbenicillinCefotaxime
flacp::bb0794 (0 mM IPTG)625 ()20 ()4 ()62562598
flacp::bb0794 (1 mM IPTG)125040862562598
WT125040862562598

Discussion

TamB is a protein with a DUF490 domain that was recently shown to be encoded downstream of TamA (Selkrig ; 2015). TamA is an OMP and TamB is an IM-associated protein and together they interact in the periplasm to comprise the translocation and assembly module (TAM) (Selkrig ; 2015; Shen ). Similar to the BAM complex, the TAM from Enterobacteriaceae also catalyzes the insertion of OMPs into the OM of diderm bacteria (Selkrig ). Additionally, the TAM and BAM both contain a member of the Omp85 family of OMPs (TamA and BamA). Interestingly, while most Proteobacterial organisms contain the canonical TAM, many other bacterial phyla and even some Proteobacteria do not contain TamA or a TamA-like protein (Heinz ). By contrast, almost all diderm bacteria encode a TamB-like protein with a DUF490 domain found in close proximity or contiguous to an Omp85 family member such as TamA, TamL, or BamA (Heinz ). The B. burgdorferi BB0794 protein was found to be encoded upstream of BamA and to contain a C-terminal conserved DUF490 domain with predominance of a short β-sheet secondary structure. Cellular localization and membrane fractionation studies revealed it is an IM protein and proteinfusion assays confirmed that the BB0794 N-terminus is an uncleaved signal peptide. The combined data provide multiple lines of empirical evidence indicating that BB0794 should now be designated the B. burgdorferi TamB ortholog. The region in the genome encoding BB0794/BamA/Skp is conserved not only in the Lyme disease spirochetes but among all spirochetes in the family Borreliaceae, which also includes the genera Borrelia that represents relapsing fever spirochetes. Within the bb0794-bamA-skp genetic locus in B. burgdorferi, we observed the presence of only a small intergenic 17 bp region between the bb0794 and bamA genes and a 20 bp region between the bamA and skp genes, leading to the assumption that all three genes are part of a single transcriptional unit and constitute an operon. Examination of RNA sequencing data revealed two unique 5′ ends, one upstream of bb0794 and another upstream of bamA, indicating that bb0794 and bamA are separately regulated. While it is possible that the transcript encoding BB0794 could also encode BamA and/or Skp, immunoblot analysis of the IPTG-regulatable strain indicates otherwise since the BamA and Skp levels were observed to be independent of BB0794 expression levels. This leads us to conclude that BB0794 is primarily translated by the mRNA that starts upstream of bb0794 while BamA and Skp are primarily translated from their own transcript. This raises the intriguing possibility that BB0794 and BamA/Skp expression needs to be independently regulated, which could mean that different environmental factors such as changes in temperature, host environment or physiological status of the organism requires differing levels of BB0794 and/or the BamA/Skp proteins. This notion is consistent with the finding that bb0794 but not bamA-skp is regulated by the two-component system Hk1/Rrp1, which controls cyclic-di-GMP levels in B. burgdorferi (Rogers ; Caimano ). The recent study by Caimano and co-workers also indicates that bb0794 transcription is up-regulated during the tick phase of the spirochetal enzootic cycle independent of bamA or skp expression (Caimano ), which would be consistent with BB0794 expression needing to be tightly regulated during the borrelial enzootic cycle while BamA and Skp can be constitutively expressed in this spirochete. Given the role of the TAM in OMP export and secretion, it is not surprising that TamB mutants in E. coli and Citrobacter rodentium have been shown to have diminished translocation and secretion of the autotransporter proteins Ag43 and p1121, respectively (Selkrig ). Deletion of TamB also has been shown to increase serum sensitivity of Salmonella enterica, suggesting TamB helps to regulate OM composition in this organism at some level (Selkrig ). Furthermore, recent studies on MorC, a TamB ortholog from Aggregatibacter actinomycetemcomitans, have shown that this protein regulates the secretion of leukotoxin LtxA and also is required to maintain normal membrane morphology (Gallant ; Kachlany, 2010; Smith ). These combined studies suggest that TamB and TamB-like proteins in other organisms are not only involved in the proper export of various groups of OMPs, but they also are important for sustaining membrane integrity. Consistent with this observation, we also found that when BB0794 expression was depleted there were obvious defects in cellular morphology and in the overall sensitivity of B. burgdorferi to selected antibiotics, especially outer membrane traversing antibiotics. Along these lines, it is interesting to note that a mutant in SSG4 (substandard starch grain 4), which is a eukaryotic DUF490 domain-containing protein found in the amyloplasts of the rice plant Oryza sativa (Matsushima ), is observed to form enlarged starch granules due to defective septum formation in dividing plastids (Matsushima ). The ssg4 mutant identified was found to contain a single mutation (Gly substitution for Ser) in its DUF490 domain (Matsushima ). This specific Gly residue was found not only to be conserved in eukaryotic DUF490 domains but also among DUF490 domains of Enterobacteriaceae (Matsushima ). Interestingly, the conserved Gly residue also was identified in the DUF490 domain proteins of all Lyme disease causing Borrelia genospecies as well as in all relapsing fever Borrelia spp. and in Treponemes such as T. pallidum and T. denticola (data not shown). The role of this conserved DUF490 Gly residue found among not only pathogenic spirochetes but also in other diderms and eukaryotic organelles suggests it could be an important region to examine in future functional studies. The most intriguing observation of the current study was the finding that BB0794 specifically interacts with BamA, indicating that TamB-like proteins form a previously unrecognized and distinct export system with the BAM complex. A possible explanation for the morphological defect observed in the BB0794 mutant could be the result of inhibiting this BB0794-BamA interaction. Since it has been established that the BAM complex is essential and required for OM biogenesis, it is tempting to speculate that the interaction between an inner and outer membrane-associated protein such as BB0794 and BamA is vital for coordinating the membrane syntheses and cell division process in this spirochete. Failure to meticulously coordinate these important physiological parameters could result in improper cell division, which was observed when BB0794 expression was depleted in the regulatable mutant. Antibiotic sensitivity studies in E. coli have revealed that deletion of TamB results in increased sensitivity to vancomycin (Babu ). Additionally, MorC mutants in A. actinomycetemcomitans have significantly higher sensitivity to bile salts (Smith ). Similarly, we observed the BB0794 mutant to be more sensitive to lipid bilayer-permeating antibiotics such as tetracycline, minocycline and azithromycin, which could result from altered membrane permeability or biogenesis of the OM. It is also possible that the selective antibiotic sensitivities observed are the direct result of decreased efflux of the hydrophobic antibiotics after they enter the cell. It is known that bacterial efflux pumps, such as the one associated with TolC in E. coli, are responsible for resistance to multiple groups of antibiotics (Fralick, 1996; Zgurskaya and Nikaido, 2000; Sulavik ; Nikaido and Takatsuka, 2009). Along these lines, it is interesting that the TolC ortholog in B. burgdorferi, designated BesC, also has been shown to regulate sensitivity to many antimicrobials (Bunikis ). BesC forms the OM channel of the multi-drug efflux system in B. burgdorferi (Bunikis ) and BesC deletion mutants have been noted to be highly sensitive to hydrophobic antibiotics such as tetracycline and azithromycin (Bunikis ), which is consistent with what we observed in the BB0794 mutant strain. We have previously shown that the B. burgdorferi BAM complex is required for appropriate transport and OM integration of BesC into the borrelial OM (Lenhart and Akins, 2010; Dunn ). The observation that BB0794 and BamA interact, raises the intriguing possibility that BesC export or function is also altered in some fashion when BB0794/BamA interaction is diminished, which may result in decreased antibiotic efflux. Determining whether BB0794 is needed for appropriate export of a subset of OMPs or if BB0794 plays a role in regulating trafficking of lipid or protein components of the OM will be important questions to examine in future studies. Although the TamA protein is found exclusively in Proteobacteria, TamB and TamB-like proteins are much more ubiquitous and are found in almost all diderms (Heinz ). TamA is typically encoded upstream of TamB in an operon (Gallant ; Selkrig ; Milner ; Heinz ); however, TamB-like proteins that neighbor BamA also have been identified in other diderms, such as the spirochete B. burgdorferi (Heinz ). The interaction between BB0794 and BamA is a novel observation suggesting that the TamA-TamB interaction in Proteobacteria is not the only significant role played by TamB-like proteins in diderms (Selkrig ; 2015; Shen ). The observation that BB0794 and BamA interact also could provide an explanation as to why so many diderms lacking TamA or autotransporter-like substrate OMPs, such as B. burgdorferi, contain a TamB-like protein. Interestingly, prior studies have also indicated that the substrate autotransporters of the TAM also require the BAM complex for complete autotransporter biogenesis (Jain and Goldberg, 2007; Sauri ; Rossiter ). Furthermore, it has recently been shown that the usher protein FimD from E. coli requires both the BAM complex and the TAM for efficient assembly of this protein into the outer membrane (Stubenrauch ). This previously reported dependence of substrate OMPs on both TAM and BAM also support our current model of a BB0794-BamA complex in ancestral spirochetal species that lack TamA. This also raises the important question as to whether TamB and TamB-like proteins from an organism that contains a TamA might also interact with BamA. Future studies to better define the interaction of TamB and TamB-like proteins with the BAM complex in diverse organisms should shed important light on the overall role of TamB in OM biogenesis beyond its interaction with TamA and OMP secretion in only a select group of Proteobacterial organisms. Given that the DUF490 domain of TamB has been shown to interact with the POTRA domain of TamA (Selkrig ; 2015), we would propose that BB0794 in B. burgdorferi interacts with BamA through one or more of its POTRA domains. Lithgow and co-workers have reported that the β-barrel like strands of the DUF490 domain in TamB impart the interaction observed between TamB and the TamA POTRA domain (Heinz ; Selkrig ). They also proposed that this TamB interaction with TamA could help to regulate the activity of the TAM (Heinz ). Along similar lines of reasoning, it is tempting to speculate that BB0794 also maintains similar β-barrel like strand conformation in its DUF490 domain and this is responsible for the interaction between the BamA POTRA domain(s) and BB0794 in B. burgdorferi. An enhanced acknowledgment of the interaction between BB0794 and BamA and how it regulates the activities of the BAM complex will not only help us to better understand the concepts of spirochete physiology but it also could help to explain the paradoxical observation that while almost all diderms contain a TamB-like protein only a subset of organisms contain TamA.

Experimental procedures

Bacterial strains and growth conditions

All borrelial strains utilized in this study were cultivated at 34°C in BSK-II liquid medium containing 6% heat inactivated rabbit serum (complete BSK-II) with the addition of appropriate antibiotic(s) or isopropyl-β-D-thiogalactopyranoside (IPTG) as indicated. B. burgdorferi B31 strain was used to perform cellular localization assays and co-immunoprecipitation experiments. B. afzelii Pko and B. garinii PBi (recently named B. bavariensis sp. nov. by Margos ) strains were for BB0794 expression immunoblot. The non-infectious B. burgdorferi B313 strain was used for expression of the OspAWT and OspA794N proteins from the shuttle vector pBSV2G (Elias ), which confers gentamicin resistance (40 µg ml−1). The B. burgdorferi B31-5A4 LK strain expresses the LacI repressor and kanamycin resistance cassette from the endogenous plasmid lp25 (Gilbert ), and was used to generate the flacp::bb0794 mutant. All shuttle vectors and constructs used for cloning were propagated using E. coli strain DH5α grown in lysogeny broth (LB) or on agar plates supplemented with the appropriate antibiotic(s).

Protein secondary structure and nucleotide sequence analyses of BB0794

The BB0794 signal peptide was predicted using PrediSi server (http://www.predisi.de/) (Nielsen ). Transmembrane α-helices in the BB0794 protein sequence were predicted with Phobius (http://phobius.sbc.su.se/) and TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM//) (Krogh ; Kall ). The secondary structure of BB0794 and E. coli TamB were predicted using PSIPRED v3.3 server (http://bioinf.cs.ucl.ac.uk/psipred/) (Jones, 1999). The promoter regions for bb0794 and bamA were identified using BPROM (http://linux1.softberry.com/berry.phtml) and virtual footprint software v.3.0 (http://prodoric.tu-bs.de/vfp/vfp_promoter.php) (Munch ; V. Solovyev, 2011). Nucleotide sequence analysis of bb0794 was determined from B. burgdorferi B31 genomic DNA using primers BB0794-2221F and BB0794-3297R (Table 2).
Table 2

Oligonucleotides used in this study.

Primer namePrimer sequence (5′ to 3′)aPrimer details
BB0794-2221FTTAGGGGTTAATTCCGATGAATATGGBB0794 nucleotides 2221–2246; Sequence verification of BB0794
BB0794-3297RGCGCTCGAGTCCCGTTCTACCAGTCACATComplementary to BB0794 nucleotides 3278–3297 plus XhoI restriction site; Sequence verification of BB0794
flacp::bb0794-831046FGCGGGTACCTCTAGTTTTTTAAATATTTTTAAATATTTTCorresponding to nucleotides 831,046-831,075 of B. burgdorferi chromosomal genome plus KpnI restriction site
flacp::bb0794-831645RCGCCTCGAGACACTCTATCGATAATTATTATTATATCorresponding to nucleotides 831, 619–831,645 of B. burgdorferi chromosomal genome plus XhoI restriction site
flacp::bb0794-4FGCGGTCGACCATATGAATTTGTTGTTTTTGAGAAGTAAGBB0794 nucleotides 4–27 plus SalI and NdeI restriction sites
flacp::bb0794–600RCGCGGATCCATTTTTAACAGCACTAAAATCAACComplementary to BB0794 nucleotides 577–600 plus BamHI restriction site
aadA1-766FGCGGAGATCACCAAGGTAGTCGGCAAANucleotides 766–789 of aadA1 gene; PCR verification of flacp::bb0794
BB0794-927RATAAATTTCAAAGCCTTTGTTTAGCTTAATCCAATCComplementary to BB0794 nucleotides 892–927; PCR verification of flacp::bb0794
FlgB-1FGCGGGTACCTACCCGAGCTTCAAGGAAGATflgB nucleotides 1–21 plus KpnI restriction site
FlgB-407RCGCGGATCCATGGAAACCTCCCTCATTTAAAATTComplementary to flgB nucleotides 383–407 plus BamHI restriction site
BB0794-1FGCGGGATCCATGAATTTGTTGTTTTTGAGAAGTAAGBB0794 nucleotides 1–27 plus BamHI restriction site
BB0794-117RCGCTCTAGATGCAGAATAAATTTGAGCTTGAACComplementary to BB0794 nucleotides 94–117 plus XbaI restriction site
OspA-1FGCGGGATCCATGAAAAAATATTTATTGGGAATAGGTOspA nucleotides 1–27 plus BamHI restriction site
OspA-822RCGCGTCGACTTATTTTAAAGCGTTTTTAATTTCATCAAGComplementary to OspA nucleotides 793–822 plus SalI restriction site
OspA-49FGCGTCTAGATGTAAGCAAAATGTTAGCAGCCTTOspA nucleotides 49–72 plus XbaI restriction site

Restriction sites shown in bold.

Generation of antibodies, immunoblot analyses, and triton X-114 phase partitioning

Antibodies specific to B. burgdorferi BB0794 were generated in rabbits against a synthetic peptide DTIGKEVQGLQ-LEIKGDDR (amino acids 345–363) by Thermo Fisher Scientific antibody production services (Thermo Scientific, Rockford, IL). Polyclonal antibodies against OspA, FlaB, P66, BamA, BamB, Skp, OppAIV or GST were generated in rats or rabbits as described previously (Radolf ; Brooks ; Brooks ; Lenhart and Akins, 2010; Kenedy ). A monoclonal antibody specific to LacI was used according to manufacturer’s instructions (US Biological, Swampscott, MA). For all immunoblots, samples were subjected to separation by 10% SDS-PAGE before being transferred to polyvinylidene difluoride (PVDF) membranes. Membranes with transferred proteins were subsequently blocked for 45 min in milk buffer comprised of phosphate buffered saline (PBS), 5% nonfat dried milk, and 0.5% Tween. After incubation with the primary antibody for 1–2 h, membranes were washed three times with milk buffer and subsequently incubated with HRP-conjugated goat anti-rat or goat anti-rabbit antibodies (Invitrogen, Carlsbad, CA) at 1:10 000 dilution for one hour. Following incubation, membranes were washed three times with milk buffer and twice with PBS before being developed using SuperSignal West Pico enhanced chemiluminescent reagent according to the manufacturer’s instructions (Thermo Scientific). The images were captured using a Fluor Chem Q instrument with associated AlphaView analysis software (Alpha Innotech, San Leandro, CA) Triton X-114 phase partitioning was performed on whole cells from B. burgdorferi strain B31 or strain B313 expressing the OspA794N fusion or on the purified recombinant OspA protein lacking its signal peptide (Weigel ; Radolf ). All phase partitioning experiments were performed as previously described (Bordier, 1981; Brusca and Radolf, 1994; Brooks ).

BB0794 surface localization assays

Indirect immunofluorescence assays (IFA) were performed as described previously (Dunn ). Briefly, B. burgdorferi B31 cultures were diluted to 5 × 106 organisms ml−1 in complete BSK-II medium before cells were either incubated in solution with antibodies or spotted onto glass slides and fixed with acetone. Organisms in solution or fixed on slides were then incubated with a mixture of either rat anti-FlaB (1:500) with rabbit anti-BB0794 (1:100) antibodies or a mixture of rabbit anti-FlaB (1:500) with rat anti-OspA (1:500) antibodies. Organisms in solution were then washed, spotted on slides, and allowed to dry before secondary antibodies were added. For the BB0794 experiments a combination of Alexa-Fluor 488-conjugated goat anti-rabbit and Alexa-Fluor 568-conjugated goat anti-rat antibodies secondary antibody (Life Technologies, Grand Island, NY) was added at a 1:500 dilution and for the OspA experiments a combination of Alexa-Fluor 488-conjugated goat anti-rat and Alexa-Fluor 568-conjugated goat anti-rabbit antibodies was used at a 1:500 dilution. The spirochetes were visualized at 1000× magnification using an Olympus BX60 fluorescent microscope (Olympus America, Inc., Center Valley, PA). Proteinase K (PK) surface accessibility assays were performed on B31 strain and B313 strain expressing OspA794N and OspAWT as described previously (Brooks ).

Membrane fractionation

Highly enriched outer membrane (OM) and protoplasmic cylinder (PC) fractions of B. burgdorferi strain B31 were obtained using sucrose density gradient separation as described (Skare ; Mulay ; Lenhart and Akins, 2010; Dunn ). All fractionations were performed on a starting amount of 5 × 1010 mid-log phase organisms (1 L of 5 × 107 ml−1).

Generation of the BB0794/OspA fusion protein (OspA794N)

To examine the physicochemical properties of the predicted N-terminal signal peptide of BB0794, a chimeric protein encoding the first 39 amino acids of BB0794 was fused to the mature portion of OspA lacking its signal peptide. The resulting chimera, designated OspA794N, included nucleotides 1–117 of bb0794, which was amplified using B. burgdorferi genomic DNA and primers BB0794-1F and BB0794-117R (Table 2). The resulting amplicon was digested using restriction enzymes BamHI and XbaI and ligated into the borrelial shuttle vector pBSV2G (Elias ). Next, nucleotides 49–822 of the ospA gene were PCR amplified using primers OspA-49F and OspA-822R (Table 2) and the amplicon was digested with restriction enzymes XbaI and SalI before being ligated downstream of bb0794 insert in pBSV2G. The flgB promotor was then amplified using primers FlgB-1F and FlgB-407R (Table 2), digested with KpnI and BamHI before being cloned immediately upstream of the bb0794/ospA chimera. The resulting construct expresses the N-terminal 39 amino acids from BB0794 fused to the mature portion of OspA corresponding to amino acids 17–274. The construct OspAWT was generated by amplifying the entire ospA gene (nucleotides 1–822) using primers OspA-1F and OspA-822R (Table 2). The amplicon was digested and ligated into pBSV2G downstream of the flgB promotor that was inserted into pBSV2G as outlined above. The final OspA794N and OspAWT constructs were verified by sequence analysis to contain no mutations and electroporated into B. burgdorferi strain B313 to further examine the properties of the BB0794 N-terminus.

Co-immunoprecipitation (co-IP) assays

Co-IP experiments were performed using the Pierce Direct IP Kit (Thermo Scientific, Rockford, IL). Briefly, B. burgdorferi B31 cells were grown to mid-log phase (5 × 107 organisms ml−1) in complete BSK-II medium before whole-cell lysates were prepared as previously described (Lenhart ). 500 µl of final lysates were then mixed with AminoLink resin with conjugated BB0794, BamA, or GST antibodies following the manufacturer’s instructions (Thermo Scientific). The lysate and resin mixture was rotated end over end at 4°C overnight before being washed. Proteins bound to the resin were eluted by adding 50 µl of final sample buffer containing β-mercaptoethanol and boiled for seven minutes before SDS-PAGE and immunoblot analysis.

Generation of a BB0794 IPTG regulatable mutant

The BB0794 regulatable mutant, designated flacp::bb0794, was generated in the B. burgdorferi B31-5A4 LK strain generously provided by Dr. D. Scott Samuels (University of Montana) (Gilbert ). B. burgdorferi genomic DNA was first used as template to amplify 600 bp regions upstream and downstream of the start codon of the bb0794 gene using primers flacp::bb0794-831046F and flacp::bb0794-831645R (upstream region) and flacp::bb0794-4F and flacp::bb0794–600R (downstream region) as indicated in Table 2. The two 600 bp amplicons were directionally cloned into the pBluescript-II KS+ vector (Stratagene, La Jolla, CA) using the restriction sites added into the amplification primers. Subsequently, the streptomycin resistance cassette and hybrid flacp promotor were digested as a unit from the previously described flacp::BB0028 plasmid construct (Dunn ) using restriction enzymes XhoI and NdeI before it was ligated between the two 600 bp amplicons that flank the BB0794 start site. The resulting recombination construct was then electroporated into the B31-5A4 LK strain and incubated in complete BSK-II supplemented with kanamycin (200 µg ml−1), streptomycin (100 µg ml−1) and IPTG (1 mM). Two weeks later, electroporated cultures in 96-well plates were screened for presence of antibiotic-resistant transformants. One clone identified, designated flacp::bb0794, was confirmed by PCR analysis to have undergone homologous recombination using the primers indicated in Table 2. The mutant was subsequently subjected to a complete plasmid analysis as previously described (Elias ; Lenhart and Akins, 2010) before IPTG dose-dependent regulation of BB0794 was examined and confirmed by immunoblot analysis (see Fig. 6C).

Transcriptome analysis

Total RNA was isolated from B. burgdorferi strain B31-5A4 using a hot phenol protocol as described (Lybecker ). The isolated RNA was DNase I treated (Roche, Indianapolis, IN) and depleted of ribosomal RNA using the Ribo-Zero RNA removal kit for Gram-negative bacteria following the manufacturer’s protocol (Epicentre, Madison, WI). RNA integrity was measured using an Agilent 2100 Bioanalyzer and RNA with an RNA Integrity Number (RIN) above 9.0 was used for subsequent cDNA library construction. Directional (strand-specific) RNA-seq cDNA libraries were constructed with a ligation-based protocol as previously described, but with an initial size-selection (Lybecker ). Briefly, the fragmented RNAs were treated to remove 5′ and 3′ phosphates and 2′-3′ cyclic-phosphates and subsequently 3′ and 5′ RNA adapters were ligated at both ends as described (Lybecker ). A size selection of total RNA correlating to 50–500 nucleotides was conducted before fractionation on an 8% TBE-UREA gel. The di-tagged RNA libraries were then gel-purified and reverse transcribed for PCR analysis and Solexa sequencing as described (Lybecker ). Sequences have been deposited at the NCBI Sequence Read Archive under study accession number SRP078488 and experiment accession numbers SRX1948239 and SRX1948242.

Growth curve analysis

Growth curves were performed in triplicate as previously described (Lenhart and Akins, 2010). The parental B31-5A4 LK strain was passed into 14 ml tubes of prewarmed BSK-II complete media containing kanamycin (200 µg ml−1) and seeded at 3000 organisms ml−1. The flacp::bb0794 mutant was first washed with complete BSK-II to remove residual IPTG before seeding 3,000 organisms ml−1 in BSK-II complete media containing kanamycin (200 µg ml−1), streptomycin (100 µg ml−1) and a final IPTG concentration of 0 mM, 0.05 mM or 1.0 mM. Spirochetes were enumerated using dark-field microscope every 24 h for 11 days. Statistical significance was determined using unpaired t test (two-tailed) with Welch’s correction.

Antimicrobial susceptibility assays

Antimicrobial susceptibility of the parental strain B31-5A4 LK (WT) was compared to the flacp::bb0794 mutant cultivated with or without IPTG as previously described (Bunikis ; Dunn ) using the following antibiotics and ranges (ng ml−1): penicillin (10–20,000), carbenicillin (2–5,000), cefotaxime (25–50,000), tetracycline (5–10,000), minocycline (5–10,000), and azithromycin (1–2,000). B. burgdorferi growth was assessed in differing concentrations of all antibiotics at 0, 24, 48 and 72 h by measuring the absorbance of each well at 562 and 630 nm using a Molecular Devices SpectraMax 340 plate reader (Molecular Devices, Sunnyvale, CA). Each assay was repeated four times in duplicate and the mean 562/630 nm ratio, which corresponds with the amount of borrelial growth per well, for all concentrations of each antibiotic was plotted with respect to time to determine the minimum inhibitory concentration (MIC) of each antibiotic.
  102 in total

1.  Protein secondary structure prediction based on position-specific scoring matrices.

Authors:  D T Jones
Journal:  J Mol Biol       Date:  1999-09-17       Impact factor: 5.469

2.  Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes.

Authors:  A Krogh; B Larsson; G von Heijne; E L Sonnhammer
Journal:  J Mol Biol       Date:  2001-01-19       Impact factor: 5.469

3.  POTRA: a conserved domain in the FtsQ family and a class of beta-barrel outer membrane proteins.

Authors:  Luis Sánchez-Pulido; Damien Devos; Stéphanie Genevrois; Miguel Vicente; Alfonso Valencia
Journal:  Trends Biochem Sci       Date:  2003-10       Impact factor: 13.807

4.  Phase separation of integral membrane proteins in Triton X-114 solution.

Authors:  C Bordier
Journal:  J Biol Chem       Date:  1981-02-25       Impact factor: 5.157

5.  A simple method for displaying the hydropathic character of a protein.

Authors:  J Kyte; R F Doolittle
Journal:  J Mol Biol       Date:  1982-05-05       Impact factor: 5.469

Review 6.  The role of Borrelia burgdorferi outer surface proteins.

Authors:  Melisha R Kenedy; Tiffany R Lenhart; Darrin R Akins
Journal:  FEMS Immunol Med Microbiol       Date:  2012-05-21

7.  Cholesterol lipids of Borrelia burgdorferi form lipid rafts and are required for the bactericidal activity of a complement-independent antibody.

Authors:  Timothy J LaRocca; Jameson T Crowley; Brian J Cusack; Priyadarshini Pathak; Jordi Benach; Erwin London; Juan C Garcia-Monco; Jorge L Benach
Journal:  Cell Host Microbe       Date:  2010-10-21       Impact factor: 21.023

8.  Biases in Illumina transcriptome sequencing caused by random hexamer priming.

Authors:  Kasper D Hansen; Steven E Brenner; Sandrine Dudoit
Journal:  Nucleic Acids Res       Date:  2010-04-14       Impact factor: 16.971

9.  Crystal structure of YaeT: conformational flexibility and substrate recognition.

Authors:  Petia Z Gatzeva-Topalova; Troy A Walton; Marcelo C Sousa
Journal:  Structure       Date:  2008-12-10       Impact factor: 5.006

10.  Acylated cholesteryl galactosides are specific antigens of borrelia causing lyme disease and frequently induce antibodies in late stages of disease.

Authors:  Gunthard Stübs; Volker Fingerle; Bettina Wilske; Ulf B Göbel; Ulrich Zähringer; Ralf R Schumann; Nicolas W J Schröder
Journal:  J Biol Chem       Date:  2009-03-23       Impact factor: 5.157

View more
  16 in total

Review 1.  The β-barrel assembly machinery in motion.

Authors:  Nicholas Noinaj; James C Gumbart; Susan K Buchanan
Journal:  Nat Rev Microbiol       Date:  2017-02-20       Impact factor: 60.633

Review 2.  Evolution of protein transport to the chloroplast envelope membranes.

Authors:  Philip M Day; Steven M Theg
Journal:  Photosynth Res       Date:  2018-10-05       Impact factor: 3.573

3.  Comprehensive Spatial Analysis of the Borrelia burgdorferi Lipoproteome Reveals a Compartmentalization Bias toward the Bacterial Surface.

Authors:  Alexander S Dowdell; Maxwell D Murphy; Christina Azodi; Selene K Swanson; Laurence Florens; Shiyong Chen; Wolfram R Zückert
Journal:  J Bacteriol       Date:  2017-02-28       Impact factor: 3.490

4.  Structural basis for substrate selection by the translocation and assembly module of the β-barrel assembly machinery.

Authors:  Rebecca S Bamert; Karl Lundquist; Hyea Hwang; Chaille T Webb; Takoya Shiota; Christopher J Stubenrauch; Mathew J Belousoff; Robert J A Goode; Ralf B Schittenhelm; Richard Zimmerman; Martin Jung; James C Gumbart; Trevor Lithgow
Journal:  Mol Microbiol       Date:  2017-08-09       Impact factor: 3.501

Review 5.  Genetic Manipulation of Borrelia Spp.

Authors:  Dan Drecktrah; D Scott Samuels
Journal:  Curr Top Microbiol Immunol       Date:  2018       Impact factor: 4.291

Review 6.  The Treponema pallidum Outer Membrane.

Authors:  Justin D Radolf; Sanjiv Kumar
Journal:  Curr Top Microbiol Immunol       Date:  2018       Impact factor: 4.291

7.  Protein Secretion in Spirochetes.

Authors:  Wolfram R Zückert
Journal:  Microbiol Spectr       Date:  2019-05

8.  RNA-Seq of Borrelia burgdorferi in Multiple Phases of Growth Reveals Insights into the Dynamics of Gene Expression, Transcriptome Architecture, and Noncoding RNAs.

Authors:  William K Arnold; Christina R Savage; Catherine A Brissette; Janakiram Seshu; Jonathan Livny; Brian Stevenson
Journal:  PLoS One       Date:  2016-10-05       Impact factor: 3.240

9.  The Structure of a Conserved Domain of TamB Reveals a Hydrophobic β Taco Fold.

Authors:  Inokentijs Josts; Christopher James Stubenrauch; Grishma Vadlamani; Khedidja Mosbahi; Daniel Walker; Trevor Lithgow; Rhys Grinter
Journal:  Structure       Date:  2017-11-09       Impact factor: 5.006

10.  Outer Membrane Proteome of Veillonella parvula: A Diderm Firmicute of the Human Microbiome.

Authors:  Daniel I Poppleton; Magalie Duchateau; Véronique Hourdel; Mariette Matondo; Jennifer Flechsler; Andreas Klingl; Christophe Beloin; Simonetta Gribaldo
Journal:  Front Microbiol       Date:  2017-06-30       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.