| Literature DB >> 27581876 |
Krista K Ingram1, Deborah M Gordon2, Daniel A Friedman2, Michael Greene3, John Kahler4, Swetha Peteru5.
Abstract
Task allocation among social insect workers is an ideal framework for studying the molecular mechanisms underlying behavioural plasticity because workers of similar genotype adopt different behavioural phenotypes. Elegant laboratory studies have pioneered this effort, but field studies involving the genetic regulation of task allocation are rare. Here, we investigate the expression of the foraging gene in harvester ant workers from five age- and task-related groups in a natural population, and we experimentally test how exposure to light affects foraging expression in brood workers and foragers. Results from our field study show that the regulation of the foraging gene in harvester ants occurs at two time scales: levels of foraging mRNA are associated with ontogenetic changes over weeks in worker age, location and task, and there are significant daily oscillations in foraging expression in foragers. The temporal dissection of foraging expression reveals that gene expression changes in foragers occur across a scale of hours and the level of expression is predicted by activity rhythms: foragers have high levels of foraging mRNA during daylight hours when they are most active outside the nests. In the experimental study, we find complex interactions in foraging expression between task behaviour and light exposure. Oscillations occur in foragers following experimental exposure to 13 L : 11 D (LD) conditions, but not in brood workers under similar conditions. No significant differences were seen in foraging expression over time in either task in 24 h dark (DD) conditions. Interestingly, the expression of foraging in both undisturbed field and experimentally treated foragers is also significantly correlated with the expression of the circadian clock gene, cycle Our results provide evidence that the regulation of this gene is context-dependent and associated with both ontogenetic and daily behavioural plasticity in field colonies of harvester ants. Our results underscore the importance of assaying temporal patterns in behavioural gene expression and suggest that gene regulation is an integral mechanism associated with behavioural plasticity in harvester ants.Entities:
Keywords: division of labour; foraging gene; social insect; task allocation
Mesh:
Substances:
Year: 2016 PMID: 27581876 PMCID: PMC5013789 DOI: 10.1098/rspb.2016.0841
Source DB: PubMed Journal: Proc Biol Sci ISSN: 0962-8452 Impact factor: 5.349
qPCR primers designed for study.
| gene | forward primer | reverse primer | probe |
|---|---|---|---|
| TGGTGGTGACCCAATGAAGACGTA | GTTCCGCGGGATTATCTCTG | TCCATCACGCGTAACGCAATGGCT | |
| GCGATATGCAGGTGAAAGAAGA | ATCACGCAATACTTCCAATCTATGTT | CGACACCACCATTGGCTGTCACAGA | |
| GGCTCTGAGGGAGGCTTT | CGGAGATGTTCTTCACGTTGAA | CTCGCGATAACGTCG |
Figure 1.Relative gene expression levels of foraging across time (hours) from field-collected workers of five behavioural tasks. Relative expression values for each data point represent the average expression level across colonies (n = 4 colonies, ±s.e.). Data were normalized to account for differences in the amplitude of gene expression between colonies using a z-score transformation; thus, relative expression values are plotted as the number of standard deviations above and below the mean value for all data points (across task and time). Standard error bars are calculated from variation across four colonies. The open stripe in the horizontal bar at base of the plot represents the daylight phase (13 h) and the solid stripe represents the dark phase (11 h) during the night. Overall differences in foraging gene expression among tasks are significant; only foragers have significantly different levels of Pbfor mRNA over time. *p < 0.05. (Online version in colour.)
Mixed-model ANOVA results for field study. We tested three hypotheses: the effect of task, location or age and time of day on foraging expression in workers.
| d.f. | |||||
|---|---|---|---|---|---|
| task | task | 4,98 | 3.732 | 0.021* | 0.132 |
| time | 6,98 | 0.699 | 0.651 | 0.041 | |
| task × time | 24,98 | 2.521 | 0.003** | 0.090 | |
| location | location | 1,118 | 7.895 | 0.006** | 0.062 |
| time | 6,118 | 1.010 | 0.422 | 0.049 | |
| location × time | 6,118 | 4.943 | 0.000* | 0.201 | |
| age | age | 2,62 | 14.277 | 0.000** | 0.315 |
| time | 6,62 | 1.475 | 0.201 | 0.125 | |
| age × time | 6,62 | 9.899 | 0.000** | 0.489 |
aBonferroni-corrected p-values; *p < 0.05, **p < 0.01.
Figure 2.Results from the light exposure experiment. Gene expression data were measured across all samples and were transformed using a z-score analysis across colonies (n = 6) to control for differences in expression levels between colonies. Bars represent the number of standard deviations above or below the mean colony expression value (±s.e.). Differences between tasks are significant; there is no significant effect of light condition or task × light interaction on expression levels. BC = brood care workers; FOR = foragers; LD = 13 h ambient light exposure, 11 h dark; DD = continuous 24 h dark.
Mixed-model ANOVA results for experimental study. We tested one hypothesis: the effects of light condition (LD or DD) and time of day on foraging expression in workers.
| d.f. | ||||
|---|---|---|---|---|
| task | 1,57 | 9.141 | 0.004** | 0.138 |
| light condition | 1,57 | 0.058 | 0.810 | 0.001 |
| time | 2,57 | 1.643 | 0.202 | 0.055 |
| task × light | 1,57 | 0.011 | 0.916 | 0.000 |
| task × time | 2,57 | 0.558 | 0.576 | 0.019 |
| light × time | 2,57 | 0.401 | 0.671 | 0.014 |
| task × light × time | 2,57 | 0.585 | 0.560 | 0.020 |
**p < 0.01.
Figure 3.Expression levels of foraging mRNA differ with time of day in LD but not DD conditions in foragers. Bars represent relative gene expression calculated across foragers only. Data were transformed using a z-score analysis across colonies (n = 6) to control for differences in expression levels between colonies. Relative expression values are plotted as the number of standard deviations above and below the mean colony value for foragers (±s.e.). LD = 13 h ambient light exposure, 11 h dark; DD = continuous 24 h dark.