Literature DB >> 27576309

Characterization of novel SSR markers in diverse sainfoin (Onobrychis viciifolia) germplasm.

Katharina Kempf1, Marina Mora-Ortiz2, Lydia M J Smith2, Roland Kölliker1, Leif Skøt3.   

Abstract

BACKGROUND: Sainfoin is a perennial forage legume with beneficial properties for animal husbandry due to the presence of secondary metabolites. However, worldwide cultivation of sainfoin is marginal due to the lack of varieties with good agronomic performance, adapted to a broad range of environmental conditions. Little is known about the genetics of sainfoin and only few genetic markers are available to assist breeding and genetic investigations. The objective of this study was to develop a set of SSR markers useful for genetic studies in sainfoin and their characterization in diverse germplasm.
RESULTS: A set of 400 SSR primer combinations were tested for amplification and their ability to detect polymorphisms in a set of 32 sainfoin individuals, representing distinct varieties or landraces. Alleles were scored for presence or absence and polymorphism information content of each SSR locus was calculated with an adapted formula taking into account the tetraploid character of sainfoin. Relationships among individuals were visualized using cluster and principle components analysis. Of the 400 primer combinations tested, 101 reliably detected polymorphisms among the 32 sainfoin individuals. Among the 1154 alleles amplified 250 private alleles were observed. The number of alleles per locus ranged from 2 to 24 with an average of 11.4 alleles. The average polymorphism information content reached values of 0.14 to 0.36. The clustering of the 32 individuals suggested a separation into two groups depending on the origin of the accessions.
CONCLUSIONS: The SSR markers characterized and tested in this study provide a valuable tool to detect polymorphisms in sainfoin for future genetic studies and breeding programs. As a proof of concept, we showed that these markers can be used to separate sainfoin individuals based on their origin.

Entities:  

Keywords:  Fingerprinting; Genetic diversity; Microsatellite; Molecular markers; Onobrychis viciifolia; SSR; Sainfoin

Mesh:

Substances:

Year:  2016        PMID: 27576309      PMCID: PMC5006395          DOI: 10.1186/s12863-016-0431-0

Source DB:  PubMed          Journal:  BMC Genet        ISSN: 1471-2156            Impact factor:   2.797


Background

Onobrychis viciifolia Scop., commonly known as sainfoin, belongs to the tribe Hedysareae and the family Fabaceae. It is a tetraploid (2n = 4x = 28) perennial forage legume, rich in proteins and secondary plant metabolites. Its center of origin is attributed to the Middle East and Central Asia. It was introduced into Europe in the fifteenth century and was rapidly adopted by farmers due to its high fodder value, especially for working horses [1]. Nowadays, sainfoin is cultivated only in small areas for fodder production and on ecological compensation areas. Its cultivation steadily declined since the 1950’s, due to the expanding availability of inorganic fertilizers and the preference for higher yielding legume crops such as alfalfa (Medicago sativa) or red clover (Trifolium pratense) [2-4]. In the last few years, however, sainfoin has gained renewed interest due to its animal health promoting properties associated with the presence of condensed tannins (CT) and other complex phytochemicals in the foliage. Benefits include anthelminthic properties and prevention of potentially lethal bloat associated with most other forage legumes [5-9]. In addition, sainfoin shows a range of beneficial agronomic features. In common with most other legumes sainfoin fixes atmospheric nitrogen in its root nodules, thus reducing the need for industrial N fertilizer input. [1, 10]. Furthermore, soil fertility is improved by increased humus development through its deep rooting capability and low input requirements once established [11]. Used as a component of permanent grassland, sainfoin is a valuable alternative for areas suffering from intensification, as it increases soil fertility and has become a popular addition to non-cropped environmental planting; sainfoin provides good resources for native insects and high quality fodder for livestock [11]. Despite its advantages, a wide distribution of sainfoin is hampered by the often poor agronomic performance and the lack of sainfoin varieties adapted to different environmental conditions. The main weaknesses of sainfoin lie in its low tolerance to waterlogging and frost as well as in its poor competitive ability in the early stages of development. Therefore, targeted breeding activities are needed to select for sainfoin individuals better adapted to a broad range of environmental conditions. Breeding activities have also been impaired by the lack of knowledge of the genetic diversity of the species and its mode of inheritance. Further investigation and development of tools for marker assisted breeding has been hampered by the limited availability of species-specific molecular markers. So far, most studies have focused on the use of cross-amplifiable EST-SSRs, mainly from Medicago and Glycine species; ITS markers based on nuclear internal transcribed spacer regions and dominant SRAP markers [12-15]. The use of co-dominant SSR markers developed in other species yielded only a low number of alleles per locus in sainfoin (from 5 to 7 in bulks of 10 individual plants [12]. The development of highly informative, specific markers for sainfoin is indispensable to create a genetic knowledge base and assist breeding by marker assisted selection (MAS) [16]. SSRs or Microsatellites [17] are composed of tandemly repeated sections of DNA [18]. SSR markers show co-dominance of alleles and are randomly distributed along the genome, particularly in low-copy regions [19, 20]. Considering the complex tetraploid sainfoin genome and the lack of knowledge about its genetics, SSRs are the markers of choice. SSR are multi-allelic in contrast to next generation high-throughput sequencing (NGS) derived SNP marker which are bi-allelic. This makes SSR markers highly variable and useful for distinguishing even between closely related populations or varieties [21]. Furthermore, SSR are easily detected using standard PCR methods and are transferable to related taxa [22]. The development of NGS has recently enabled the identification of a large set of set of SSR sequences from sainfoin (Mora-Ortiz et al. 2016, BMC Genomics, accepted). In this study, our aim was to develop and characterize a comprehensive set of markers based on recently identified SSR sequences (Mora-Ortiz et al. 2016, BMC Genomics, accepted) in a panel of 32 sainfoin individuals of different origin.

Methods

Plant material

In order to include a large range of genetic diversity, we selected a set of 32 individual sainfoin plants from 29 different accessions (Table 1), originating from a range of geographical regions and showing differences for tannin content and composition [12, 13, 23, 24]. These accessions were grown in the glasshouse at the National Institute of Agricultural Botany (NIAB) (Cambridge UK) and in the field at Agroscope (Zurich, Switzerland). Young leaf material was collected from each single plant, ground in liquid nitrogen and stored at −80°C until subsequent DNA extraction.
Table 1

O. viciifolia individuals used for marker characterization in this study

Individual numberVarietyStatusOriginSource
ID_01247NAMoroccoGRIN
ID_02BuceanskijNARomaniaGRIN
ID_03CPI 63750NATurkeyGRIN
ID_04CPI 63764wildTurkeyGRIN
ID_05CPI 63820NASpainGRIN
ID_06CPI 63826NASpainGRIN
ID_07NA / RCAT028437NAHungaryGRIN
ID_08Ökotyp WiedlisbachecotypeSwitzerlandISS
ID_09PremierlandraceSwitzerlandISS
ID_10Rees AcultivarUKGRIN
ID_11TU86-43-03cultivatedTurkeyGRIN
ID_12NovacultivarCanadaGRIN
ID_13VisnovskycultivarCzech RepublikISS
ID_14PerlycultivarSwitzerlandISS
ID_15BrunnerlandraceAustriaISS
ID_16PerdixcultivarSwitzerlandISS
ID_17Cotswold CommoncultivarUKRAU
ID_18PerlycultivarSwitzerlandRAU
ID_19SombornecultivarUKRAU
ID_20Ibaneti/ RCAT028292NARomaniaRCAH
ID_21Bivolari/RCAT028294cultivarRomaniaRCAH
ID_22NA/170582NAHungaryRCAH
ID_23CPI 637554/ 192995NATurkeyGRIN
ID_24CPI 63767 / 212241cultivarUSAGRIN
ID_25Na/228352wildIranGRIN
ID_26CPI 63781/ 236486NATurkeyGRIN
ID_27Cholderton Hamshire CommoncultivarUKGRIN
ID_28VisnovskycultivarCzech RepublicGRIN
ID_29ZeuscultivarItalyCotswold Seeds Ltd
ID_30ZeuscultivarItalyCotswold Seeds Ltd
ID_31AmbracultivarItalyprivate
ID_32EsparcettecultivarUKprivate

RAU Royal Agricultural University Gloucestershire UK, RCAH Research Centre for Agrobotany Tápiószele; Hungary, GRIN Germplasm Resources Information Network, Washington, USA, ISS Agroscope Institute for sustainability science, Zurich, Switzerland

O. viciifolia individuals used for marker characterization in this study RAU Royal Agricultural University Gloucestershire UK, RCAH Research Centre for Agrobotany Tápiószele; Hungary, GRIN Germplasm Resources Information Network, Washington, USA, ISS Agroscope Institute for sustainability science, Zurich, Switzerland

DNA extraction

DNA was extracted using the Nucleon Phytopure Genomic DNA extraction kit (GE Healthcare, Little Chalfont Buckinghamshire, United Kingdom) following the manufacturer’s instructions. This method has been shown to be suitable for extraction of high quality DNA from O. viciifolia, in which high levels of polyphenol and condensed tannins have been reported to interfere with a successful DNA extraction using other approaches [14]. DNA quality and quantity was assessed using gel electrophoresis and spectrophotometry.

PCR and Gel electrophoresis

A total of 400 SSR primers designed from O. viciifolia transcriptome data (Mora-Ortiz 2016, unpublished), were tested with unlabeled primers for amplification in the 32 plants using an iCyler (Biorad, Hercules, USA) in a volume of 10 μL, with 10 ng DNA, 1 x Go Taqflexi buffer (Promega, Madison, USA), 2.5 mM MgCl2 (Promega), 0.2 mM dNTPs (Promega), 0.2 μM forward primer, 0.2 μM reverse primer and 0.5 U Polymerase G2 (Promega). The conditions followed a touchdown PCR approach with 4 min at 94 °C, 12 cycles of 30 s at 66 °C with −1 °C decrease at each cycle plus 30 s at 72 °C, and 30 cycles of 30 s at 94 °C, 30 s at 54 °C plus 30 s at 72 °C, followed by 7 min at 72 °C. PCR products were separated by gel electrophoresis. Amplicons were separated on 1 % agarose in 1x TBE buffer, stained with ethidium bromide and visualized under UV light.

M13 PCR and capillary electrophoresis

Those 101 primer pairs that successfully amplified fragments in the 32 individuals (Table 2) were further characterized for polymorphisms using the M13 (–21) tail primer genotyping protocol [25]. The PCR reactions were conducted in an iCycler (Biorad) in a sample volume of 10 μL, each containing 20 ng DNA template, 1x Go Taqflexi buffer (Promega), 1.5 mM MgCl2, (Promega), 0.2 mM dNTPs (Promega), 0.16 μM forward primer carrying the M13-tail, 0.04 μM reverse primer and 0.16 μM fluorescently labelled M13-primer, 0.5 U polymerase GoTaq G2 (Promega).
Table 2

SSR primer sequences used for amplification in 32 O. viciifolia individuals and characteristics of SSR motifs

MarkerMotifRepeatsPredicted sizeForward primer (5′–3′)Reverse primer (5′–3′)
OVK002AG9164CCCACCAGACAAAAAGAATAGCTTTCCCCTTCATCAACTAT
OVK003TA8122GATAGAATTCGTTTGTTGGTGATCTTTGTAACTGTTCGCTCA
OVK017AC8158GGGTGTTAGTTATCCATTTCCACATACTAGCCTTCTGGGGTA
OVK027CTCG6129AATGGAATCTCGGAGACAGGGAAGAAGACGAAGTAGTAGGA
OVK034GCT6150GTGAGATGAGCTTGGACATTAGATAACTAACTGCAGGCAAG
OVK036AGGT6150GTGTTAAAGGGGTGAAAACATCATTTTGACAAACCAGTATCC
OVK038ATT6166CCACATACGAGACAGAATAGGCTGAAAATTGATCGATACTGG
OVK042GTT6144GGAACGGTTAATTTCTGATTTAGAATTCCGTACAAGTCGAG
OVK045AGA6148CCAAAAATCATCAATCAACACTTGAACAAGGGTTAGGGTTAT
OVK046AGTG6151TCAACCACATTATAAAACCTCACGCGAAATCATAGTTCACTT
OVK054GAA6201TTGCAGAGATAACACTCACCTTCCTGAAAAACCTAATCACAA
OVK055GAT6189GAAGATATTTCAAAGCAGCAACATGCTACCACTAGCAGAAGT
OVK063TTG6188AATTGCAACTGAAACTGAAACACTGCTACCCTCTCCATAAAT
OVK068GGA6195GACCACCCGCAGCTCAACGTCTTCTTCCCCCATATTTAG
OVK072ACC7199TTGCCTTAGTCAGTTACCTTGGTGGAGAGAATGAGAGAACCT
OVK073GAC6200GTAGACAACCGTATCTGGACAAAGATGGAAGGTTCTAGTTCG
OVK077TTA6249GTCCCTCTCTCTCAAATTGTTAGGTTAATGGAGCTTAGTGGT
OVK089CAT6257CAAAGTCATACCAATCACCATTCTTGGAAGCACTTGTTACTC
OVK093CCA6259CCAAGTGTTTGAAAGTCTCAGTGAGAGTTCGTTCAAGGTAGA
OVK094TTGCG5255ACCGATCTTAGGATAGATGGAACTTTTGGTTGCTTAGTCGAT
OVK096TCA6249GAGCGTTGCATTTACATTTACCATCCTCCTTTACACCCTAAT
OVK097GTGA6252TCTATAGAGATGAGGCGACAACGCCCCTAACTAACCTACTAC
OVK099TGAG6247AGAAAATGGAAGCAACAGAGTACAAATAGCAGCTCCCTTC
OVK101CTAA6254GTTGAGTTTCAGACACAGAGCAATAGCTCCCACAATAACTCC
OVK102TGT6249CCAAAGGGTGTTTTATTTTCTGGAAGAAATTAAGCAAATGGT
OVK107AG8193AAGTTAAAACTTTGCGTTGTGGACGTTGTTCTGGATTTCTTC
OVK111GGT7206TATAGACCTTCTCCTCCCAGAGTGAAAGTCACAAATCCAAAG
OVK119CAG6199ACCCTCCTTCTCTCCTTATTTGACGAGAGAACTCGTTTATGA
OVK122TC9211GCAGATAGCACAGTTATCGACGAACCACACACACAGAATCA
OVK123ACA9200CACCCATTAACTATCATGGTCCAAGCCCTTTGTGAGATACTA
OVK124TGA9211GCCTTTTCTGTGACTCGTAAGCTCCATTCCCATTTATAGTT
OVK125CATTT5193AAATTTAAGCACCGGAATAACAAAGCAAAAGGGCTACTAAAG
OVK126TC8197CGACAAAACTATTTAGGCAAAGGGAAGAGATCATAAACCCTA
OVK127AT8200GCCCAAAATGTATTATCCTTCAGAACAGACAGATATGCAAGC
OVK131TA8200TCTATCTGGGTGTTGTTTTGTCTGTTTGAATATCGATTACCAC
OVK133TG8196TGCTTCAGCATTATTGTAACATTGCACTTCTCCATACTTCCTA
OVK138CTAA6250TAATATGGTGCAAGTTCCAATTTCTACGCTTAGCTCAAACC
OVK141CACG6239GAGGAGGTACATACAGCACAGCAACCTCCTCGTTATCTTTTT
OVK142GT8243AACATGACTACTGTGAACAAGGCGAACATGTAATTGATCCAAG
OVK155GTG6251CAGGTTTGAAGTAGCAGAGAAGTAGACCACGCATACTGAATC
OVK158GACT6257TCAGAGTGTGTTGTGTTGTGTAGTGAAGCAAATGTGTGATTT
OVK159TG8251CATTATTGCCTAGCATTGTTCATTTCACCATCAAGTATGCAC
OVK161TTCC6249AAAGCTTTCTACACGTTGGTATGGGTTTTTACACTCTGTGAT
OVK165ACA6267TTTCAAACACTCACTCACTCCTCGGATTTGTGACCTAACTC
OVK168TGA6253AATTATCACCCACTGCTATGAGGTTTCCATCACTGTTTGTTA
OVK172AGC6256TTATTAAACCTGCGTCTTCTGGTAGAGCTGTGGGCTTTATCT
OVK173CT8253TCGTTCTCGTGATTATTCTGTCCTCTATTCAAATAGGGCAAT
OVK174GGCCC5246ACATGATCGTGAATATGAAGCCAGCAGCAATCAATATATCATC
OVK175CA9250GTAAAATATCAAGCAGGAGCAAAACTATGCAGACACCCTGTA
OVK177CTG7257TCTGTTGATTTAAGGAGACGACTCTTGCTCATATTTTCCTCA
OVK181AAG6257AGGAAGAAGAAGAAGAAGCAGTTCTCCTTTAACCACAACCTT
OVK183TGAT6256GAGGGTAAGAGAGAGTGGAAGCTTGCCTGATATCTTCTCAAA
OVK196AGC6286TTTTGAGAGTGTGGAAGGTTAAGTATGAGCCTGATGATGATG
OVM003TC9297CCGTCTGTTTAATCATTCACTGAAAGGAAAGGTTATTGGAGA
OVM004ATTT5290GGGAATTCTTAAATCTCATGGATGCATGGTACTGGGTCGT
OVM025CAA6297TTCTGAACAACAACAACAACAGTCCAGGAGCTAAGTAACCAT
OVM031TGA6306ATTGGTTTCTAAGGAGGACTGGCAATACTCCTCTGCCTAGTT
OVM033CTC6300CAAGGCTTATTTGGTTAACAGATACTATTTCCCATGCCTACC
OVM034TTC6308GCATTTCATCAAACACTTTTCTTGGTTTGAATCTGTGAGACT
OVM035TTC7303TCATCAAACACTTTTCGTTCTTTGGTTTGAATCTGTGAGACT
OVM038GAAG6297CACAGGACAAGAGTGAGAGAGTCATGATACCACGAATTTTTC
OVM043GAG7167TAGTATGGCTGAAATCAAAGGATATCATAAGGGCAACAGTGA
OVM048AT9157GACATTGAAATCAAACAATCCAACACTTGTCATGTTTCCAAG
OVM049TGA7150AACAAACAAGAGGAAAAGGAGTATGTGCTTATCAGGCATTTT
OVM050ATCC6161ATGAGCATGAAGAGTTTCAGAACACATCTACGACTTCTTTCG
OVM053GTGGA5149CACCAAAAGCATAGCAATAGTGCTTGAATTGAATGAGAAATG
OVM057TTG6153CCTTGAGGAGGAATAATAGGAGACATCATCATCACCTTCACT
OVM058AT9150GTCAAGTCATACCCATACGAGCAGTGTAACCATATGCACAAA
OVM059AGA6149ACTCCAACTCCAACTCAGAACAAGCGAAGAAGAGAGTGAGAT
OVM060CT8159ATGTAATCAAAAGGTGCAGAAAGCTTCCAAAACAGTGTATGA
OVM061GTA6150TTAACACACGTACGTACCACATTTGTCGTTGATCGTTAAGTT
OVM062AG8139GGAAAAAGGTTTGGATAGATGAAGTTTTCCCCACACTATTCT
OVM064AT8353GCATGCACAGAATTAAGTTTCAGAAGGTCCTTTGAAAATCAG
OVM065CT8352AAGACAGCGAGTTACCAATCTGATTGAAACTGAGTAGCGATG
OVM067CTT6352CAACCTTAATACCAACCTTCCAAAAGTAGCCAGAGAGCAAAT
OVM068CCT6333CTACAACTCACCGAAACTCACCGATTTCTGCCTCTTTATTCT
OVM069AATG6357ATGTTGTACAGATGAGCTTCGTAGTGAGCAAACCTATTTTGG
OVM072GAA6350TTGATGTGGTTGATCCTATTCGATGTCAACATCTTGGTCATTA
OVM073ACA6346GTTCTCAAACGCACTATCAACAAAATCTTGTAGGGATTCGAT
OVM076AAC7348CCCATTCTTCATCTTTCTCTCTGCTTCCATAATCAGTGAAAT
OVM081GT9350TCTAGCACAATGTTTTGGATTTATTGAGTTGAAGCAGACCAT
OVM083CT8347CACACAAACACAAAACTCACAGATCGGAGAAAAGAAGAAGAG
OVM086GAA6350TCATACAAAGTTCCTTCCGTAATTGCCAATAACAGTGAAGAG
OVM090CCA6151AATCAATGGAGGAGGATAAACGAAGGTTGAAAAGGGAATAAA
OVM091ATC6188AACCACCCTTAATTCCATAAGAGATAAAAGCCGCAAAAGTAT
OVM092CAC6157GGACCAACAAAGAGGATTATTCCCTTGCTTGAAGTGTTACTA
OVM094GTTT5163ATTCATGGGGACAATAAATTCCAAGAGAATGAATGAATCAGC
OVM099GA9149TATGTATTGCAGAATCACAGCTATTACCCTTTTCCATCTTCC
OVM100AAG6151GAACTAGATTTGCGGCATTCCCACACCCTTATCCTTATTA
OVM110AT8154CTGGACGAAAACAACATATTCGTTGGCTTTGGTACTGACATA
OVM116GAT7151AACTACACGCACGTAATGAATTGGTTTGATAAACACCTCAAG
OVM120TTC6152TTCAGTGTCACTTTCCTCATTAGAAGTTGTCATGTCAAGGAA
OVM122TGG6156ATGAATCTTGTACGGAATCTGGAAGAAAAAGCCATAAACACC
OVM125AAATT5151ATTCTTTCAACAAGCAAGTGACTGCAATTCCATCCTATTTTA
OVM126TCC6188ACTAAGAACCACCCAAAACATTGAGAAGATGGAGAAGATGTG
OVM128TGTT6155GAGAAGCATAACCAAAATCCTTGGAAGAAAAGAAACTTCTGA
OVM129TG8133AATTGGATTCATGTGTTAGGAGAAGTGGAGCCAAAACCT
OVM130AG9154GCAAATTATCACCATGCACCGTGAAGAAAATCGGTACTTA
OVM131AGA6153GAAATAACGCAGGCAGATACAATTAGAGGCTTCGACTTGTT
OVM132GAC6142ACGGTAATCAGTAGTGACAGCGTGTGACAGAAAATGGGATTA
OVM133TTTC5171TAGCATCAAGGTTGGAAATAGCTAGGCTACCTGAATCAAACA
SSR primer sequences used for amplification in 32 O. viciifolia individuals and characteristics of SSR motifs PCR conditions were 2 min at 94 °C, 30 cycles of 30 s at 94 °C, 45 s at 56 °C and 45 s at 72 °C, followed by 8 cycles of 30 s at 94 °C, 45 s at 53 °C and 45 s at 72 °C. The final extension step was conducted at 72 °C for 10 min. An aliquot of 1μl of the PCR product was diluted in 10 μl HiDi™ formamide (Applied Biosystems®, Thermo Fisher Scientific, Waltham, MA, USA) and 0.2 μl Rox 500™ oligonucleotide ‘size ladder’(Applied Biosystems®) for capillary electrophoresis on the Genetic Analyzer 3730 (Life Technologies, Carlsbad, CA). Alleles were scored using the GeneMarker software (Softgenetics, V2.4.0 Inc., State College, USA).

Data analysis

All statistical analyses and calculations were performed using R statistical software (R Core Team, 2014). The polymorphism information content (PIC) of SSR markers was calculated as the mean of the PIC of each allele, using the formula for dominant markers from Roldan-Ruiz et al. [26] as; where PICi is the polymorphism information content of allele i and fi is the frequency of occurrence of allele i (fragment present) in the 32 individuals. From single alleles, average (PICAv), minimum (PICMin) and maximum (PICMax) PIC values were calculated for each SSR marker. In order to calculate genetic distance measures, SSR alleles were coded as individual markers with 1 for presence and 0 for absence of the allele as binary data. Pairwise genetic distances between individuals were calculated as modified Rogers’ distance Dw, [27] which shows the extent of genetic diversity between two individuals [28] ranging from 0 (no diversity between individuals) and 1 (maximum diversity). Genetic relationships were visualised using cluster analysis and the R-function pvclust() [29] based on Euclidean distance that was rescaled to Dw for plotting purposes (Dw and Euclidean distance show a linear relationship, Additional file 1: Figure S1). Probability values (p-values) were calculated for each cluster using multiscale bootstrap resampling [30, 31] to calculate approximately unbiased (AU) p-values [32]. The k-means clustering algorithm [33] was applied to the Dw values using a sequence of k = 2 clusters to 32 clusters. The Calinsky criterion [34] was then calculated for each number of k as implemented in the R function cascadeKM() and the optimum number of clusters was determined at the maximal value. Population structure was further investigated by principal component analysis performed on binary raw data of individual alleles.

Results

SSR analysis

SSR markers showed a high degree of polymorphism and overall, 1154 alleles were found with an average of 11.4 alleles per marker locus (Table 3). Among those 1154 alleles, only five alleles (from SSR OVK042, OVK172, OVM031, OVM072 and OVM100) were non-polymorphic and hence present in all individuals studied.
Table 3

Characterization of the 101 polymorphic sainfoin markers

MarkerPIC AvPIC MinPIC MaxNoANoA PrivMinAFMaxAFSize
OVK0020.220.060.47930.030.63154–175
OVK0030.230.060.471120.030.3892–124
OVK0170.220.060.501950.030.47148–184
OVK0270.280.060.50920.030.59120–140
OVK0340.270.060.491210.030.56138–154
OVK0360.350.170.50700.090.69133–154
OVK0380.190.060.401440.030.28155–186
OVK0420.250.000.50200.501.00183–186
OVK0450.290.120.43600.090.94138–148
OVK0460.310.060.491210.030.56138–157
OVK0540.290.120.491500.060.44274–290
OVK0550.200.060.38820.030.84135–159
OVK0630.240.060.501320.030.72179–200
OVK0680.250.060.43930.030.31186–213
OVK0720.320.120.50400.060.81193–198
OVK0730.290.060.501110.030.53186–210
OVK0770.230.060.45920.030.78233–264
OVK0890.270.060.49920.030.44279–299
OVK0930.230.060.501460.030.56234–271
OVK0940.240.060.481440.030.66208–244
OVK0960.210.060.482060.030.41215–294
OVK0970.220.060.38300.130.97240–248
OVK0990.250.060.491320.030.75232–270
OVK1010.360.060.50710.030.72339–352
OVK1020.230.060.34410.030.22239–251
OVK1070.290.060.451510.030.72206–234
OVK1110.260.060.48720.030.75213–232
OVK1190.300.060.471010.030.72216–252
OVK1220.240.060.45810.030.66330–341
OVK1230.260.060.501030.030.75208–237
OVK1240.260.060.491510.030.44218–267
OVK1250.290.060.50910.030.72197–222
OVK1260.250.060.491530.030.56198–233
OVK1270.280.060.49610.030.44204–222
OVK1310.170.060.481530.030.59183–228
OVK1330.250.060.501330.030.63205–239
OVK1380.210.060.491360.030.56232–267
OVK1410.140.060.471570.030.38242–269
OVK1420.250.060.501230.030.47256–285
OVK1550.240.060.491430.030.56234–282
OVK1580.190.060.402460.030.28273–375
OVK1590.230.060.501440.030.81268–290
OVK1610.250.060.401210.030.28220–276
OVK1650.190.060.502060.030.50273–311
OVK1680.240.060.501130.030.81258–284
OVK1720.160.000.30500.061.00268–279
OVK1730.230.060.481850.030.59268–316
OVK1740.230.060.48520.030.75245–266
OVK1750.190.060.381020.030.88252–267
OVK1770.270.060.49720.030.59267–286
OVK1810.190.060.381940.030.25343–381
OVK1830.240.060.491710.030.44266–289
OVK1960.210.060.50820.030.53297–314
OVM0030.310.120.471000.060.69299–321
OVM0040.210.060.451860.030.34380–426
OVM0250.330.170.49700.090.84306–324
OVM0310.260.000.501310.031.00292–353
OVM0330.290.060.50810.030.69308–330
OVM0340.220.060.501750.030.53307–355
OVM0350.220.060.501750.030.53301–350
OVM0380.190.060.431440.030.31311–351
OVM0430.300.060.491020.030.66173–203
OVM0480.290.120.43600.060.72174–186
OVM0490.310.060.50910.030.50162–198
OVM0500.200.060.491360.030.72168–198
OVM0530.320.060.501110.030.50134–182
OVM0570.350.170.49500.090.66165–180
OVM0580.230.060.491530.030.44135–178
OVM0590.240.060.48720.030.59156–174
OVM0600.230.060.502140.030.50172–219
OVM0610.190.060.501040.030.84143–175
OVM0620.300.060.491220.030.59151–170
OVM0640.160.060.471680.030.38380–444
OVM0650.250.060.491440.030.69360–391
OVM0670.330.170.49600.090.66366–380
OVM0680.260.120.43800.060.88343–368
OVM0690.260.060.481320.030.59454–479
OVM0720.280.000.50710.031.00365–387
OVM0730.200.060.452150.030.34446–511
OVM0760.220.060.481730.030.41347–376
OVM0810.180.060.401750.030.28353–396
OVM0830.300.060.501120.030.63365–384
OVM0860.320.060.501010.030.63371–391
OVM0900.300.060.49820.030.84158–180
OVM0910.340.060.50810.030.47184–217
OVM0920.230.060.43720.030.81163–185
OVM0940.330.120.50700.060.81190–207
OVM0990.180.060.501150.030.50165–198
OVM1000.240.000.48500.091.00163–179
OVM1100.210.060.491850.030.44163–185
OVM1160.280.060.491520.030.56138–204
OVM1200.340.060.50610.030.88169–187
OVM1220.310.060.50410.030.91164–180
OVM1250.260.060.501030.030.47161–180
OVM1260.220.060.501840.030.53191–229
OVM1280.260.060.47910.030.81173–190
OVM1290.250.060.491440.030.56146–173
OVM1300.200.060.472070.030.38152–187
OVM1310.340.060.50820.030.56159–198
OVM1320.300.060.47820.030.78157–176
OVM1330.200.060.471430.030.63177–212

PICAv, PICMin and PICMax give the average, minimum and maximum allele-wise polymorphism information content values, NoATot the total number of alleles, NoAPriv the number of private alleles, MinAF the minimum allele frequency and MaxAF the maximum allele frequency value

Characterization of the 101 polymorphic sainfoin markers PICAv, PICMin and PICMax give the average, minimum and maximum allele-wise polymorphism information content values, NoATot the total number of alleles, NoAPriv the number of private alleles, MinAF the minimum allele frequency and MaxAF the maximum allele frequency value With only two alleles in the 32 individuals, SSR OVK042 had the lowest number of alleles, whereas OVK158 had the highest number with 24 amplified alleles. The minimum rate of allele occurrence was 0.03125, corresponding to occurrence in only one genotype (i.e. a private allele of an individual genotype). In total, 250 private alleles were detected and these were equally distributed across the examined set of individuals and markers. With regard to individuals, the highest number of private alleles over all markers was found for individual ID_08 (14 private alleles) and the lowest number was found for ID_17 (3 private alleles). The origin of the individual did not appear to affect the occurrence of private alleles. With regard to markers, the most private alleles were observed in OVM064 (8 private alleles), whereas 16 markers (15.8 %) had no private alleles at all. The average polymorphism information content (PICAv) ranged from 0.14 (OVK141) to 0.36 (OVK101) (Table 3). A detailed look at the PIC values of individual alleles in the different markers exhibited minimum PIC values per SSR (PICMin) between 0 (Additional file 2: Figure S2), OVK042, OVK172, OVM031, OVM072, OVM100) and 0.17 (OVK131) and maximum PIC values per SSR (PICMax) between 0.3 (OVK 172) and 0.5 (16 different markers). The overall length of SSR fragments detected ranged from 91 to 511base pairs (bp). Markers with two base pair motifs had a slightly higher number of repeats (eight to nine) when compared to markers with three to five bp motifs (five to seven repetitions). The total fragment length observed did not differ between motif lengths (data not shown). Contrastingly, the number of alleles found for SSRs with two bp motifs was higher (13.5 alleles on average), compared to SSRs with longer motifs (10.7 alleles). The average number of alleles per sainfoin genotype was 230.1 over all SSR markers, leading to an average of 2.3 alleles per SSR marker and genotype. The lowest number of alleles was found for genotype ID_25 with 191 alleles, the highest for ID_07 with 268 alleles. Assigning all individuals to cultivars and non-cultivars (ecotypes, landraces and NA) resulted in 981 alleles for individuals from cultivars (57.7 alleles per individual) and 942 alleles for non-cultivars (62.8 alleles per individual).

Diversity of O. viciifolia individuals

The allocation of individuals to groups by overall similarity of alleles was assessed using k-means partition comparisons. Those k-means statistic (Fig. 1, left) simulate a grouping of individuals (assigned by different colors) dependent on number of groups chosen. Individuals were assigned into two to ten groups, with a more homogenous grouping for two and three groups. The Calinski criterion (Fig. 1, right), giving the most likely grouping by the highest value reached, indicating a grouping of individuals into two groups by a value >3.
Fig. 1

Group separation of individuals as assessed by k-means partitioning for k = 2 to 10 with colors indicating different groups (left). The optimum number of groups (k) according to maximum Calinski criterion was determined to be two (right)

Group separation of individuals as assessed by k-means partitioning for k = 2 to 10 with colors indicating different groups (left). The optimum number of groups (k) according to maximum Calinski criterion was determined to be two (right) The cluster dendrogram based on the modified Roger’s distance (Fig. 2) also displayed a partitioning of individuals in two main groups, which were separated by a modified Roger’s distance value of 0.47. Individuals belonging to the same variety located in the same main branch for the varieties Perly (ID_14, ID_18; 0.4), Visnovsky (ID_13, ID_28; 0.39) and Zeus (ID_29, ID_30; 0.48). The variety Perdix is an advanced variety originating from the variety Perly and the Perdix genotype (ID_16) clusters closely to one of the Perly individuals (ID_14).
Fig. 2

Cluster Dendrogram of individuals based on the modified Rogers’ distance. Values at branches are AU p-values (blue). Different colours of genotype labels give the affiliation to the two groups determined by k-means partitioning

Cluster Dendrogram of individuals based on the modified Rogers’ distance. Values at branches are AU p-values (blue). Different colours of genotype labels give the affiliation to the two groups determined by k-means partitioning The first, smaller branch of the cluster (Fig. 2, right hand side) consisted mainly of individuals originating from Switzerland and the United Kingdom (cluster 1), whereas the majority of the second, larger branch was comprised of individuals from Southern and Eastern Europe as well as individuals from USA, Morocco and Canada (cluster 2). However, AU values showed no significance (values <95) for most branches. Principal component analysis (PCA; Fig. 3) showed a pattern comparable to that observed from cluster analysis with individuals of the two main clusters mainly being separated by the first principle component which explained 10.3 % of the total marker variation. The second principle component accounted for 4.9 % of the variation, most of which was intragroup. The occurrence of alleles across all markers varied between the two clusters with 849 alleles amplified in cluster 1 (65.3 per individual) and 979 alleles in cluster 2 (51.5 per individual).
Fig. 3

Principle component analysis of 32 sainfoin (O. viciifolia) individuals based on 1054 alleles of 101 SSR markers. Different colors give the affiliation to the two groups as determined by k-means partitioning

Principle component analysis of 32 sainfoin (O. viciifolia) individuals based on 1054 alleles of 101 SSR markers. Different colors give the affiliation to the two groups as determined by k-means partitioning

Discussion

The 101 SSR markers newly developed from sainfoin revealed a high degree of polymorphism. In addition to differences in multiples of the repeat motif, we also found alleles differing by fractions of the multiple motif length. Such variations could have arisen from insertions, deletions and translocations in the flanking region of the SSR [35]. Such mutations in the flanking region might also contribute to the high degree of polymorphism in our marker data set. The SSR sizes predicted through sequencing and the actual size distribution observed in the 32 individuals was consistent for most of the markers. Discrepancies can largely be explained by the fact that SSR motifs were developed from individuals not represented in the present study. In total, we found 1154 alleles at 101 loci resulting in 11.4 amplified alleles per SSR on average. This is twice the amount found by Demdoum [12], who found 5.83 alleles by transferring markers from barrel clover (Medicago truncatula Gaertn.) and soybean (Glycine max L.) to sainfoin. Fragments were smaller for the specific marker set in this study (92 to 511 bp) compared to markers adopted from other species [12] (79 to 865 bp). The larger sizes of alleles from cross-species amplification could be attributed to interspecific differences to the donor species due to repeat length variation within the SSR region and indels in the flanking region [36]. Avci [37] amplified 725 alleles from 18 SSR markers in diverse Onobrychis spp. using markers from pea and barrel clover. The higher number found by these authors could be explained by the larger diversity of germplasm used, which originated from different subspecies. SSR marker studies with other tetraploid species using diverse panels of individuals showed lower numbers of alleles per marker compared to the present study, e.g. 7.2 alleles in sugar cane (Saccharum officinarum) [38], 6.7 alleles in switchgrass (Panicum virgatum) [39] and 6 alleles in peanut (Arachis hypogaea) [40]. A few markers were observed with less than five alleles among the 32 individuals. These may still be useful in future studies, since this study represents an initial screening of single individuals and not an extensive population survey. Additionally, using only the most polymorphic markers would bias the overall genetic diversity e.g. in conservation studies [41]. The challenge in analyzing SSR alleles in tetraploids lies in determining the dosage of each allele, which is often impossible using capillary electrophoresis for individuals carrying less than four different alleles at a specific marker locus. The PIC content gives an estimation of the information content of a marker and is traditionally calculated by the formula of Botstein [42]. This was developed for diploid species, for which the allele frequency is either known or can be inferred from the allele occurrence (presence/absence). For tetraploid species, the allele frequency is difficult to derive from the allele occurrence due to different allele doses (1 to 4 alleles). Hence, the formula for diploids could not be used for tetraploid sainfoin. Thus, the PIC was calculated separately for each allele, on the basis of allele occurrence counts, using a formula adopted from Roldan-Ruiz [26] and averaging the PIC across all loci of one locus [43]. Here, the maximum value that can be reached is 0.5, which corresponds to alleles found in 50 % of the population. Small values, on the other hand, correspond to very abundant or to very rare alleles. Deciding whether a SSR marker is useful also depends upon the scientific issue. Taking into account different allele-based PIC values of an SSR locus (Additional file 2: Figure S2), therefore, gives the most holistic picture of the SSR marker. High PIC values of alleles (0.5–0.4) are useful for inside population studies e.g. to trace marker trait associations, whereas low PIC values (0.0–0.1) of single alleles could be more useful for studies of evolution or genetic drift [44]. The average PIC values in this study indicated that most markers had alleles which could be found in a group of individuals and are suitable for several approaches in future studies. These PIC values were comparable to those found by Tehrani [43] which were between 0.16 and 0.44 in Lolium persicum Boiss. The large number of private alleles is a clear indication of genetic distinctness of the individuals, which was anticipated in view of their diverse origins. Genetic diversity is a prerequisite for selection in variety development. So far, there is limited information on the genetic diversity of sainfoin available. Use of AFLP and SSR markers from other species were not able to reveal genetic diversity in distinct Spanish sainfoin accessions [12, 45]. The values of that study, given by Nei’s similarity values, which represent the proportion of shared fragments on the basis of binary data and corrected by the marker number [46], reached values of 0.73 to 0.8 [12, 45]. A conversion of those values to genetic distance values by the formula –ln (Nei’s similarity values) resulted in Nei’s genetic distance values of 0.31 and 0.22 [47]. In a study of sainfoin genetic diversity using RAPD markers in ten landraces from East Azerbaijan and in 36 Iranian sainfoin populations, Nei’s genetic distance values of 0.32 and 0.25, respectively, were observed [48, 49]. In our study, highest modified Roger’s distance of 0.48 corresponds to alleles not shared between our two cluster groups, which is almost 50 % (Fig. 2). The smallest Roger’s distance values with 0.35, corresponds to an approximate Nei’s distance value of 0.43 (Additional file 1: Figure S1), which is higher than the low values observed in other studies [12, 45, 48]. The majority of among-genotype comparisons showed higher values. The higher values of genetic diversity found in the present study may reflect the high variability of the markers developed and the selection of 32 individuals of contrasting origin. Despite the fact that individuals of the same cultivars in this predominantly outbreeding species can show considerable variability [50], the individuals from the same cultivar grouped clearly together in the present study (Figs. 2 and 3, Table 1). The 32 individuals investigated separated into two clear groups based on different multivariate analyses. The first main group was comprised mainly of individuals from Switzerland and the United Kingdom, whereas the second group contained individuals originating from South and East Europe as well as USA, Canada and Morocco. In some instances, individuals originating from the same geographical region did not cluster tightly together, some even into the two different cluster groups. The three plants from Italy, ID_29 and ID_30, both cultivar “Zeus”, clustered in group 2, whereas ID_31 of the cultivar “Ambra” clustered to group 1). Especially for cultivars, this is likely to be due to different origin of base material (which is often unknown), as well as divergent breeding and selection history. A similar grouping of accessions identified by the present cluster analysis could be found in earlier studies between sainfoin accessions from Western Europe and those from Eastern Europe and Asia [12, 23]. This clear genetic distinction between the individuals from Western Europe and those from Eastern Europe and beyond could reflect adaptation to diverse climatic conditions either naturally or as a result of local selection by growers [44]. Under genetic isolation and limited gene exchange, differentiation in the sainfoin germplasm with accompanied morphological separation seems likely [51]. The average number of alleles amplified in individuals of the West European cluster was 65.3, which was approximately 14 alleles more than individuals from the other cluster (51.5). These results might indicate a higher allelic diversity in individuals from mainly Switzerland and Great Britain compared to other origins. Deducing differences in tannin content and composition between single individuals of the two clusters based on earlier studies dealing with samples of plants from the same accessions is extremely difficult because the variation found within accessions is at least as large as variation between accessions [24].

Conclusions

This study reports the first characterization of specific co-dominant SSR markers for sainfoin. The 101 SSR markers characterized in this study showed a high degree of polymorphism and clearly demonstrated the differences between sainfoin individuals, with diverse origin, on a molecular genetic level. The genetic differences found in our panel separated the individuals into two groups, with a clear correlation to the geographical origin of those individuals. SSR markers, such as those characterized here, will be very useful in future genetic analyses, such as paternity or pedigree analysis in breeding programs, as well as more detailed analysis of genetic diversity in this forage crop. Furthermore, the development of new varieties could be crucially improved by choosing distinct genepools and minimising inbreeding depression.
  16 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes.

Authors:  Michele Morgante; Michael Hanafey; Wayne Powell
Journal:  Nat Genet       Date:  2002-01-22       Impact factor: 38.330

3.  An approximately unbiased test of phylogenetic tree selection.

Authors:  Hidetoshi Shimodaira
Journal:  Syst Biol       Date:  2002-06       Impact factor: 15.683

Review 4.  The effects of tannin-rich plants on parasitic nematodes in ruminants.

Authors:  Hervé Hoste; Frank Jackson; Spiridoula Athanasiadou; Stig M Thamsborg; Simone O Hoskin
Journal:  Trends Parasitol       Date:  2006-04-24

5.  Computing genetic similarity coefficients from RAPD data: the effects of PCR artifacts.

Authors:  W F Lamboy
Journal:  PCR Methods Appl       Date:  1994-08

6.  Polyphenols, condensed tannins, and other natural products in Onobrychis viciifolia (Sainfoin).

Authors:  J P Marais; I Mueller-Harvey; E V Brandt; D Ferreira
Journal:  J Agric Food Chem       Date:  2000-08       Impact factor: 5.279

Review 7.  Construction of a genetic linkage map in man using restriction fragment length polymorphisms.

Authors:  D Botstein; R L White; M Skolnick; R W Davis
Journal:  Am J Hum Genet       Date:  1980-05       Impact factor: 11.025

8.  Occurrence and inheritance of microsatellites in Pinus radiata.

Authors:  D Smith; M E Devey
Journal:  Genome       Date:  1994-12       Impact factor: 2.166

9.  Development and Validation of EST-SSR Markers from the Transcriptome of Adzuki Bean (Vigna angularis).

Authors:  Honglin Chen; Liping Liu; Lixia Wang; Suhua Wang; Prakit Somta; Xuzhen Cheng
Journal:  PLoS One       Date:  2015-07-06       Impact factor: 3.240

10.  Evidence and consequences of self-fertilisation in the predominantly outbreeding forage legume Onobrychis viciifolia.

Authors:  Katharina Kempf; Christoph Grieder; Achim Walter; Franco Widmer; Sonja Reinhard; Roland Kölliker
Journal:  BMC Genet       Date:  2015-10-07       Impact factor: 2.797

View more
  5 in total

1.  High allelic diversity of the centromere-specific histone H3 (CENH3) in the legume sainfoin (Onobrychis viciifolia).

Authors:  Ahmet L Tek; Sevim D Kara Öztürk
Journal:  Mol Biol Rep       Date:  2020-10-26       Impact factor: 2.316

2.  Analysis of genetic diversity among Onobrychis accessions with high agronomic performance by simple sequence repeat (SSR) markers.

Authors:  Tugba Sutcu; Behiye Banu Bilgen; Metin Tuna
Journal:  Mol Biol Rep       Date:  2022-05-25       Impact factor: 2.742

3.  Development of polymorphic EST-SSR markers and characterization of the autotetraploid genome of sainfoin (Onobrychis viciifolia).

Authors:  Shuheng Shen; Xutian Chai; Qiang Zhou; Dong Luo; Yanrong Wang; Zhipeng Liu
Journal:  PeerJ       Date:  2019-03-26       Impact factor: 2.984

4.  Genetic diversity and population structure analysis in a large collection of Vicia amoena in China with newly developed SSR markers.

Authors:  Feifei Wu; Shangxiong Zhang; Qiu Gao; Fang Liu; Jianli Wang; Xianguo Wang
Journal:  BMC Plant Biol       Date:  2021-11-20       Impact factor: 4.215

5.  De-novo transcriptome assembly for gene identification, analysis, annotation, and molecular marker discovery in Onobrychis viciifolia.

Authors:  Marina Mora-Ortiz; Martin T Swain; Martin J Vickers; Matthew J Hegarty; Rhys Kelly; Lydia M J Smith; Leif Skøt
Journal:  BMC Genomics       Date:  2016-09-26       Impact factor: 3.969

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.