Literature DB >> 27547323

A revisited phylogeography of Nautilus pompilius.

Lauren E Vandepas1, Frederick D Dooley1, Gregory J Barord2, Billie J Swalla1, Peter D Ward1.   

Abstract

The cephalopod genus Nautilus is considered a "living fossil" with a contested number of extant and extinct species, and a benthic lifestyle that limits movement of animals between isolated seamounts and landmasses in the Indo-Pacific. Nautiluses are fished for their shells, most heavily in the Philippines, and these fisheries have little monitoring or regulation. Here, we evaluate the hypothesis that multiple species of Nautilus (e.g., N. belauensis, N. repertus and N. stenomphalus) are in fact one species with a diverse phenotypic and geologic range. Using mitochondrial markers, we show that nautiluses from the Philippines, eastern Australia (Great Barrier Reef), Vanuatu, American Samoa, and Fiji fall into distinct geographical clades. For phylogenetic analysis of species complexes across the range of nautilus, we included sequences of Nautilus pompilius and other Nautilus species from GenBank from localities sampled in this study and others. We found that specimens from Western Australia cluster with samples from the Philippines, suggesting that interbreeding may be occurring between those locations, or that there is limited genetic drift due to large effective population sizes. Intriguingly, our data also show that nautilus identified in other studies as N. belauensis, N. stenomphalus, or N. repertus are likely N. pompilius displaying a diversity of morphological characters, suggesting that there is significant phenotypic plasticity within N. pompilius.

Entities:  

Keywords:  Indo‐Pacific; Nautilus pompilius; mitochondrial DNA; phenotypic plasticity; phylogeography

Year:  2016        PMID: 27547323      PMCID: PMC4979717          DOI: 10.1002/ece3.2248

Source DB:  PubMed          Journal:  Ecol Evol        ISSN: 2045-7758            Impact factor:   2.912


Introduction

The genus Nautilus (Mollusca, Cephalopoda) belongs to subclass Nautiloidea that has an extensive fossil record dating back to the Devonian (Teichert and Matsumoto 1987; Kröger et al. 2011). Here, we will refer to Nautilus as the genus and nautilus when discussing the animal itself. Because members of the extant Nautilus genus have been hypothesized to have evolved in their current form between 7 and 10 mya (Ward 1984) or possibly much earlier, approximately 40 mya (Teichert and Matsumoto 1987; Woodruff et al. 1987), and modern nautiluses appear to be very similar to some of their Mesozoic ancestors (Ward and Saunders 1997), these animals have been described as “living fossils” (Sinclair et al. 2011). The family Nautilidae (Nautilus Linnaeus 1758) has a disputed number of extant species ranging from two to nearly a dozen (Saunders and Landman 1987; Wray et al. 1995). The genus Allonautilus Ward and Saunders 1997 has one accepted species, Allonautilus scrobiculatus, and a second possible species, Allonautilus perforates (Ward and Saunders 1997). All known populations are thought to live at depths of about 100–600 m along fore‐reef slopes, with a wide distribution of the Indo‐Pacific (tropical north and south regions of the western Pacific and Indian Ocean). Extant nautilids are limited in their ability to disperse: they are obligately nektobenthic, do not swim far off the sea floor, and have rarely been observed in mid‐water (Ward et al. 1984; Dunstan et al. 2011a; P. D. Ward, pers. observ.). Nautilus have a maximum depth limit caused by fatal shell implosion of between 700 and 800 m (Ward et al. 1980; Saunders and Ward 1987) and a minimum water depth constrained by water temperatures in excess of 28°C. As most shallow waters across the range of the nautiluses' habitats is warmer than this, these high surface water temperatures and the presence of visual predators make dispersal in surface and near surface waters rare (O'Dor et al. 1993; Carlson 2010; Williams et al. 2012). There have been an increasing number of investigations into the morphological and genetic diversity of the genus Nautilus (Saunders 1981; Saunders and Landman 1987; Saunders et al. 1989; Ward and Saunders 1997; Sinclair et al. 2007, 2011; Bonacum et al. 2011; Dunstan et al. 2011b; Williams et al. 2015a, 2015b). Original species descriptions of Nautilus utilized few discrete characters, and many of the morphological characteristics delimiting the species may be difficult to quantify or have values that overlap broadly between multiple species (e. g. size, Table S1). Confounding this is the potential for the variation of characters like shell color and size within populations. Species of Nautilus for which we have sequencing data available are described in Tables S1 and S2, although the validity of several of these species (Nautilus repertus, Nautilus stenomphalus, and Nautilus belauensis) has been questioned (reviewed in Saunders 1987). Although genetic work shows that different populations of Nautilus pompilius around disparate island groups and land masses can form clades based on location (Sinclair et al. 2007, 2011; Bonacum et al. 2011; Williams et al. 2012, 2015b), the samples between locations were few and the power of these observations may be low. A larger question that remains unresolved is whether genetic studies support several named species falling into their own distinct clades. Few studies to date have examined sequence data from multiple species of Nautilus (Wray et al. 1995; Bonacum et al. 2011), and the status of three taxonomic species (N. repertus, N. stenomphalus, and N. belauensis) remained unresolved. Previous studies have not examined nautilus samples across their entire range, nor included robust genetic analyses examining the validity of these contested species. In this study, we sought to assess whether low morphological diversity within the genus Nautilus reflects a low number of genetic species or whether there may be cryptic diversity within extant nautilids that is not obvious with morphology alone (Fig. 1, Table S1).
Figure 1

Map of the Indo‐Pacific showing sampling locations of Nautilus pompilius for this study and photographs of representative animals from each location: (1) Panglao, Philippines; (2) Great Barrier Reef, Australia; (3) Vanuatu; (4) Fiji; (5) American Samoa. There appears to be interesting phenotypic plasticity displayed between different populations of Nautilus pompilius in traits such as size, shell coloration, and hood morphology.

Map of the Indo‐Pacific showing sampling locations of Nautilus pompilius for this study and photographs of representative animals from each location: (1) Panglao, Philippines; (2) Great Barrier Reef, Australia; (3) Vanuatu; (4) Fiji; (5) American Samoa. There appears to be interesting phenotypic plasticity displayed between different populations of Nautilus pompilius in traits such as size, shell coloration, and hood morphology. Here, we report the genetic analysis of mitochondrial genes cytochrome c oxidase I (COI) and 16S rDNA, commonly utilized genetic tools for the phylogeographical studies of marine invertebrates, including cephalopods (Anderson 2000; Anderson et al. 2007; Dai et al. 2012; Sales et al. 2013a) from individuals across the known locations of Nautilus populations (Philippines, Fiji, American Samoa, Vanuatu, and eastern Australia – Great Barrier Reef). We chose COI and 16S because of their variability and success in past studies, and to align with sequences generated for this study with previous nautilus studies (Bonacum et al. 2011; Williams et al. 2012). We neglect nuclear genes (e.g., 28S or histone 3) because sequencing efforts have been limited in nautilus, precluding comparative analysis with past studies, and have been shown to be relatively uninformative for phylogenetic studies within this genus (Wray et al. 1995). We use several analyses to understand the genetic distance between populations in hopes of shedding light on the possibility of multiple distinct populations or one highly plastic population with gene flow that is low but not significant enough to promote speciation.

Materials and Methods

Sample sites

Sample sites included broad geographical ranges in the Indo‐Pacific at locations with known nautilus populations (Philippines, Australia, Vanuatu American Samoa, and Fiji). In the Philippines, samples were collected in the Bohol Sea (9°35′18.87″N, 123°43′44.54″E) off the coast of Panglao. In Australia, we collected along a transect of the Great Barrier Reef from Cairns to Lizard Island (16°37′28.91″S, 145°53′07.35″E). In Fiji, we samples in Beqa Harbor near Pacific Harbor (18°19′40.24″S, 178°06′30.86″E). We sampled on Taena Bank near the harbor of Pago Pago, American Samoa (14°19′19.57″S, 170°38′57.78″W) and in Mele Bay, Port Vila, Vanuatu (17°44′21.3″S, 168°15′56.7″E).

Sample collection

Tissue sampling was conducted alongside the deployment of Baited Remote Underwater Video Systems (BRUVS; Barord et al. 2014). Traps consisted of weighted cages approximately 2 m in length and 1 m in diameter with a double entry. Traps were baited with canned tuna and raw chicken. Traps were deployed between 200 and 400 m depth. Captured nautiluses were placed into chilled seawater while on the surface and returned to their location of capture upon the completion of examination. Individuals were photographed, sexed, and weighed, and measurements of shell length and width were taken. Each individual was x‐rayed, and a tentacle snip or small pieces of hood tissue were collected for DNA extraction. Tissue samples were stored in 95% ethanol and returned to the University of Washington in Seattle, WA, USA, for processing.

DNA extraction, PCR, and sequencing

Genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Primers for cytochrome oxidase I were taken from Meyer (2003): dgLCO‐1490 GGTCAACAAATCATAAAGAYATYGG (forward), dgHCO‐2198 TAAACTTCAGGGTGACCAAARAAYCA (reverse). COI amplifications were carried out in 25‐μL reactions containing 12.5 μL of PrimeSTAR® MAX DNA Polymerase Premix (Clontech Laboratories, Mountain View, CA), 5.5 μL water, 1.0 μg each primer, and 25–50 ng total DNA. Cycling conditions for CO1 are 35 cycles of 10 sec denaturing at 98°C, 15 sec annealing at 48°C, and 10 sec elongation at 72°C. Primers for 16S were described previously (Sales et al. 2013b) L1987 GCCTCGCCTGTTTACCAAAAAC (forward), H2609 CGGTCTGAACTCAGATCACGT (reverse). 16S amplifications were carried out in 25‐μL reactions containing 2.5 μL 10× PCR buffer (100 mmol/L Tris–HCl pH 9, 500 mmol/L KCl, 15 mmol/L MgCl2, 1% Triton X‐100), 18.5 μL water, 10 mmol/L dNTPs, 1.0 μg each primer, 1 unit taq polymerase, and 25–50 ng total DNA. Cycling conditions for 16S were 2 m initial denaturing at 94°C, followed by 30 cycles of 30 sec denaturing 94°C, 1 m annealing at 51°C, and 2 m elongation at 72°C and 7 m at 72°C for final extension. PCR products were extracted from agarose gel using Illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, Pittsburgh, PA). DNA sequencing was performed using BigDye3.1 (Life Technologies, Carlsbad, CA) with a 3130 DNA Analyzer (Life Technologies) in the University of Washington Biology Department Comparative Genomics Center. Forward and reverse sequences were generated for each sample and compared to eliminate sequencing error. The coding sequences were translated to protein sequences to verify that the reading frame was not disrupted by premature stop codons or deletions, as a further check of sequence quality and locus identity.

Sequence alignments and phylogenetic analysis

Cytochrome oxidase I, 16S, and concatenated sequences were aligned using MUSCLE (Edgar 2004) in Geneious version 9.0.5 (Kearse et al. 2012). Optimal nucleotide substitution models were determined for each gene under the corrected Akaike information criterion (AICc) in jModeltest 2.1.4 (Darriba et al. 2012). The HKY + I model was applied to 16S; HKY + G to COI; and GTR + I + G to concatenated 16S‐COI. Phylogenetic analyses using Bayesian inference in Mr. Bayes 3.1.2 (Ronquist and Huelsenbeck 2003); two independent parallel runs of four incrementally heated Metropolis‐coupled Monte Carlo Markov chains, sampling every 1000 generations with a burn‐in of 25%. Trees were visualized in FigTree v1.3.1 (Rambaut 2009). Outgroups and other Nautilus sequences were obtained from GenBank. Numbers of variable and informative sites were generated using PAUP* version 4.0b10 (Swofford 2002).

Analysis of genetic diversity and structure

Divergences of concatenated 16S‐cytochrome oxidase I (COI) sequences within and between sampling location sites in our study and COI sequences from GenBank (Table S2) were estimated using average pairwise distances (p‐distances) calculated in Arlequin 3.5 (Excoffier and Lischer 2010). For population analysis for samples from our study, concatenated 16S‐COI sequences were trimmed to the same length and ambiguous base calls removed to minimize error and biases. To examine intraspecific relationships between sampling localities, a haplotype network for each mitochondrial gene and concatenated sequences were constructed based on the TCS algorithm (Clement et al. 2002) in PopART (http://popart.otago.ac.nz). Compiling all COI sequences (400 bp or longer) from GenBank, we constructed a haplotype network for samples across the entire known geographical range of Nautilus for which there is genetic data available. To quantify genetic differentiation between sampling localities across the Indo‐Pacific pairwise, F ST values were calculated Arlequin 3.5 (Excoffier and Lischer 2010). Although we could not perform a hierarchical AMOVA on samples from our study alone, which requires sampling more than one population per region or location, we utilized the entire suite of Nautilus spp. cytochrome oxidase subunit I (COI) sequences available on GenBank to examine genetic diversity and population connectivity of the genus. To test whether populations evolved under neutrality Tajima's D (Tajima 1989, 1996) was calculated with 1000 permutations in Arlequin.

Results

Morphological and sample information

Examples of nautilus specimens collected in each of locality are illustrated in Figure 1. Table 1 lists the shell sizes (length and width), sex, and weights of the animals collected in this study. To date, there have been few, if any, informative taxonomic features identified from soft parts of nautiluses (Saunders and Landman 1987). Because taxonomic efforts have focused on shell and hood morphology, species‐specific identification using these characters should be treated with caution, as phenotypic plasticity within and between populations is not well understood.
Table 1

Specimen collection location, sex, weight, shell length, shell width, and GenBank accessions for mitochondrial genes cytochrome oxidase subunit I (COI) and 16S rDNA

Country, sample numberSampling locationCOI GenBank accession16S GenBank accessionSexWeight (g)Shell length (mm)Shell width (mm)
American Samoa 1Pago Pago, Taena Bank KR062163
American Samoa 3Pago Pago, Taena Bank KM020806 KR062164
American Samoa 4Pago Pago, Taena Bank KM020805 KR108897
American Samoa 5Pago Pago, Taena Bank KM020804 KR108898
American Samoa 6Pago Pago, Taena Bank KM020803 KR108899
Australia 1Great Barrier Reef KM020802 KR062142 M16079
Australia 3Great Barrier Reef KM020801 M18085
Australia 4Great Barrier Reef KM020800 M15580.5
Australia 5Great Barrier Reef KM020799 F15273.5
Australia 6Great Barrier Reef KM020798 M15781
Australia 7Great Barrier Reef KM020797 M16079
Australia 8Great Barrier Reef KM020796 KR062143 NA15678
Australia 9Great Barrier Reef KM020795 KR062144 M150.575.5
Australia 11Great Barrier Reef KM020794 KR062145 M14977
Australia 12Great Barrier Reef KM020793 KR062146 M16579
Australia 13Great Barrier Reef KM020792 KR062147 M15378
Australia 14Great Barrier Reef KM020791 KR062148 M15271
Australia 15Great Barrier Reef KR062149 F13567.5
Australia 16Great Barrier Reef KM020790 KR062150 NA14369
Australia 17Great Barrier Reef KR062151 F14370.5
Australia 18Great Barrier Reef KM020789 KR062152 F138.559
Australia 19Great Barrier Reef KM020788 KR062153 F14369.5
Australia 20Great Barrier Reef KM020787 F14470
Australia 22bGreat Barrier Reef KM020786 KR062154 NA16181
Australia 23Great Barrier Reef KM020785 KR062155 M17082
Australia 24Great Barrier Reef KM020784 KR062156 M13778
Australia 25Great Barrier Reef KR062157 M16880
Australia 26Great Barrier Reef KR062158 M15676
Australia 27Great Barrier Reef KM020783 KR062159 M18283
Australia 28Great Barrier Reef KR062160 M16883
Australia 29Great Barrier Reef KM020782 KR062161 M16681
Australia 30Great Barrier Reef KM020781 KR062162 F15779
Fiji 1Beqa Harbor KM020780 KR108896 600151.577
Fiji 2Beqa Harbor KM020779 KR062165 48013872.5
Fiji 3Beqa Harbor KR062166 600147.575
Fiji 4Beqa Harbor KM020778 KR062167 590141.572.5
Philippines 1Bohol Sea, Panglao KM020777 KR062176 400128.667.3
Philippines 2Bohol Sea, Panglao KM020776 KR062177 1030162.497.2
Philippines 3Bohol Sea, Panglao KM020775 KR062178 105019192.8
Philippines 4Bohol Sea, Panglao KM020774 KR108880 315126.470.3
Philippines 5Bohol Sea, Panglao KM020773 KR108881 470146.882.5
Philippines 6Bohol Sea, Panglao KM020772 KR108882 1140194.394.2
Philippines 7Bohol Sea, Panglao KM020771 KR108883 490141.476.2
Philippines 8Bohol Sea, Panglao KM020770 KR108884 45014373.3
Philippines 9Bohol Sea, Panglao KM020769 KR108885 66015887.3
Philippines 10Bohol Sea, Panglao KM020768 KR108886 35012765.5
Philippines 11Bohol Sea, Panglao KM020767 KR062179 650157.585.6
Philippines 12Bohol Sea, Panglao KM020766 KR108887 600157.590
Philippines 13Bohol Sea, Panglao KM020765 KR108888 98518184
Philippines 14Bohol Sea, Panglao KM020764 KR062181 1125188.792.1
Philippines 15Bohol Sea, Panglao KM020763 KR108889 1090184.994.1
Philippines 16Bohol Sea, Panglao KM020762 KR108890 84517887.7
Philippines 17Bohol Sea, Panglao KM020761 KR108891 99517391
Philippines 18Bohol Sea, Panglao KM020760 KR108892 114018290.1
Philippines 20Bohol Sea, Panglao KM020759 KR108893 975186.589
Philippines 21Bohol Sea, Panglao KR108894 835176.385
Philippines 22Bohol Sea, Panglao KR062180 1050188.591.9
Philippines 24Bohol Sea, Panglao KM020758 1210195.395.6
Philippines 27Bohol Sea, Panglao KM020757 1050185.287.1
Philippines 28Bohol Sea, Panglao KR108895
Philippines 29Bohol Sea, Panglao KM020756 110019087.9
Vanuatu 1Mele Bay, Port Vila KR025872 KR062168 F850129.674.1
Vanuatu 2Mele Bay, Port Vila KR025876 KR062169 F920124.3977.27
Vanuatu 3Mele Bay, Port Vila KR025873 KR062170 M82015281
Vanuatu 4Mele Bay, Port Vila KR025874 KR062171 M75014475.57
Vanuatu 5Mele Bay, Port Vila KR025875 KR062172 M80015078.4
Vanuatu 6Mele Bay, Port Vila KR062173 M860161.4680.39
Vanuatu 7Mele Bay, Port Vila KR062174 M820150.775.8
Vanuatu 8Mele Bay, Port Vila KR062175 F85015487
Specimen collection location, sex, weight, shell length, shell width, and GenBank accessions for mitochondrial genes cytochrome oxidase subunit I (COI) and 16S rDNA

Phylogenetic relationships between Nautilus species and populations

All nautiluses that we sampled were N. pompilius, including specimens from the GBR (Australia) (Fig. 1, Table 1). Using concatenated 16S‐COI sequences analyzed by Bayesian statistics, samples from Fiji, American Samoa, Philippines, Vanuatu, and Australia (GBR) each cluster together with high support based on geographical location, with Fiji, Vanuatu, and Samoa samples forming a sister clade to samples in the western Indo‐Pacific (Philippines and Australia) (Fig. 2). Although some individuals from the Great Barrier Reef were identified in previous studies as the species N. stenomphalus (Saunders 1987; Bonacum et al. 2011), our rigorous phylogenetic analyses show that sequences from these samples are indistinguishable from those of N. pompilius (Fig. 3). Our 16S alignment contained 71/554 variable sites, with 44/554 being parsimony‐informative. The COI sequences alignment from our study contained 130/709 variable sites with 97 being parsimony‐informative. The Bayesian trees built with concatenated 16S‐COI sequences from this study and from other identified Nautilus species from GenBank (Fig. 3) are consistent with our conclusion that N. repertus, N. belauensis, N. stenomphalus, and an individual identified as a hybrid N. stenomphalus × N. pompilius do not fall within distinct clades. Rather, they are scattered within the N. pompilius clade.
Figure 2

Bayesian inference tree based on 1196 bp concatenated sequences of cytochrome oxidase subunit I () and 16S rDNA sequences of Nautilus macromphalus (GenBank accession: NC_007980.1) and Nautilus pompilius from our study (See Table 1 for accessions). Samples from discrete geographical locations cluster together with high support. Posterior probabilities below 0.95 are not shown.

Figure 3

Bayesian inference tree of concatenated sequences of Nautilus pompilius sequences from our study, and sequences of specimens identified in other studies as separate Nautilus species from GenBank (in bold; accessions can be found in Table S2). Specimens identified in other studies as Nautilus species N. belauensis, N. stenomphalus, and N. repertus do not fall into discrete clades but are interspersed throughout N. pompilius samples. Posterior probabilities below 0.95 are not shown.

Bayesian inference tree based on 1196 bp concatenated sequences of cytochrome oxidase subunit I () and 16S rDNA sequences of Nautilus macromphalus (GenBank accession: NC_007980.1) and Nautilus pompilius from our study (See Table 1 for accessions). Samples from discrete geographical locations cluster together with high support. Posterior probabilities below 0.95 are not shown. Bayesian inference tree of concatenated sequences of Nautilus pompilius sequences from our study, and sequences of specimens identified in other studies as separate Nautilus species from GenBank (in bold; accessions can be found in Table S2). Specimens identified in other studies as Nautilus species N. belauensis, N. stenomphalus, and N. repertus do not fall into discrete clades but are interspersed throughout N. pompilius samples. Posterior probabilities below 0.95 are not shown. When GenBank COI sequences from additional geographical locations were analyzed with our sequences (Figure S1), samples from Western Australia were interspersed with samples from the Philippines, and Papua New Guinea sequences clustered with samples from eastern Australia. This may indicate that the populations in these areas may not be reproductively isolated, and there is likely gene flow between the Nautilus populations in the Philippines (a fished population) and Western Australia (an unfished population), and between Papua New Guinea and eastern Australia. Because of the few informative sites in 16S sequences, Bayesian inference did not robustly recover geographical clades (Figure S2).

Genetic diversity of Nautilus populations

When calculating the fixation index (F ST) using concatenated 16S‐COI sequences from samples from our study alone, F ST values between all populations (from Fiji, American Samoa, Philippines, Vanuatu, GBR – Australia) were high (0.888 for Philippines/GBR – 0.975 for American Samoa/GBR), indicating very little gene flow between these populations (Table 2, above diagonal). Using COI sequences from a large swath of GenBank samples (Table 2, below diagonal; Table S2), we labeled individual sampling localities (n = 27) as “populations,” while “groups” were geographical clusters of populations (n = 10), as specified in Table 3. Low F ST values, closer to 0, indicate greater sharing of genes between populations (e.g., values between Western Australia, Indonesia, and the Philippines; Table 2, below diagonal). High F ST values (nearer to 1) indicate isolation of a population (e.g., between American Samoa and other populations: 0.878–0.957). Significant F ST values for COI alone ranged from −0.1872 (Indonesia–Philippines) to 0.97462 (Palau–Fiji). F ST values were not significant divergence between Palau–Indonesia, Palau–Philippines, and Palau–Western Australia, indicating that there is no significant differentiation between these populations and gene flow may be occurring F ST values between Indonesia and Philippines were also relatively low (0.1872).
Table 2

Population analyses for Nautilus pompilius samples. Above diagonal: Pairwise F st of Nautilus pompilius collected for this study alone (See Table 1 for accessions), using concatenated 16S‐COI sequences. Below diagonal: Pairwise F st of Nautilus pompilius COI sequences between sampling regions (See Table S2 for accessions)

Eastern AustraliaPhilippinesVanuatuFijiAmerican SamoaWestern AustraliaIndonesiaPapua New GuineaPalauNew Caledonia
Tajima's D for 16S/COI−1.43028−1.103720.082980.00000−0.61237
Eastern Australia0.88762* 0.95909* 0.96959* 0.97504*
Philippines0.79171* 0.89254* 0.90582* 0.91071*
Vanuatu0.86653* 0.90265* 0.90471* 0.91695*
Fiji0.8709* 0.91197* 0.93848* 0.97114*
American Samoa0.87821* 0.90281* 0.92109* 0.94792*
Western Australia0.83294* 0.20906* 0.92827* 0.93688* 0.93231*
Indonesia0.81541* 0.90265* 0.95373* 0.96388* 0.95748* 0.04848*
Papua New Guinea0.30838* 0.82014* 0.95373* 0.97605* 0.90875* 0.93231* 0.88836*
Palau0.79726* 0.11750.95264* 0.97462* 0.9547* −0.04844−0.037710.83611*
New Caledonia0.86982* 0.92806* 0.96578* 0.97605* 0.97313* 0.93716* 0.96388* 0.87867* 0.97019*

Significant values (P < 0.05) are marked with an “*”.

Table 3

Nautilus pompilius genetic diversity analyses using COI sequences from this study and sequences from GenBank

Geographical group (bold)/PopulationNo. samplesTajima's D Mean H E GenBank accessions
Eastern Australia 0.843
Bougainville Reef20.000N/A EF128187‐88
Carter Reef60.9390.506 GQ280195‐200
Osprey Reef39−0.6920.162 EF128184,189,197‐210,212‐215; JQ862308‐21
Shark Reef190.4170.351 EF128195‐ 96,211
N. Great Barrier Reef260.8420.345 EF128174‐183; JN227635; JQ862293‐307
Cairns‐Lizard Isl.22−1.4040.154 KM020781‐802
Western Australia 1.913 *
Scott Reef62−1.3280.121 GQ387444‐81; JQ890081‐90; JQ862322‐33
Ashmore Reef10−0.4700.314 JN227639‐48
Clerke Reef10−0.8560.283 JN227649‐58
Imperieuse Reef9−1.2050.272 JN227659‐87
Rowley Shoals20.0001.0
New Caledonia 1.186 *
Ile des Pins13−0.9090.218 GQ280227‐39
Noumea10−1.5730.222 GQ280217‐26
Fiji 0.817
Suva20.000N/A GQ280215‐16
Beqa Harbor30.0000.667 KM020778‐80
Indonesia 1.202
Ambon Straight20.000N/A GQ280190‐91
Unspecified28−1.1870.173 KC539898‐925
Papua New Guinea 1.666 *
Little Ndrova Isl.8−0.1680.371 GQ280206‐13
Lorengau20.0001.0 GQ280203‐04
Port Moresby20.0001.0 GQ280201‐02
Komuli Isl.10.000N/A GQ280205
Vanuatu 101.146 0.256 GQ280240‐49
Philippines 0.802
Bohol Sea22−0.5690.231 KM020756‐77
Panglao10.000N/A GQ280192
Balayan Bay20.0001.0 GQ280193‐94
Palau 4 0.168 0.556 GQ280187
American Samoa 51.094 0.40 KM020803‐06, GQ280214

H E, expected heterozygosity.

Significant values (P < 0.05) are marked with an “*”.

Population analyses for Nautilus pompilius samples. Above diagonal: Pairwise F st of Nautilus pompilius collected for this study alone (See Table 1 for accessions), using concatenated 16S‐COI sequences. Below diagonal: Pairwise F st of Nautilus pompilius COI sequences between sampling regions (See Table S2 for accessions) Significant values (P < 0.05) are marked with an “*”. Nautilus pompilius genetic diversity analyses using COI sequences from this study and sequences from GenBank H E, expected heterozygosity. Significant values (P < 0.05) are marked with an “*”. To determine whether or not populations are geographically structured across the geographical range of N. pompilius, hierarchical analyses of molecular variance (AMOVAs) were performed based on pairwise differences with populations (1) treated as a single group to determine the amount of variation partitioned among and within locations, and (2) grouped into geographical clades. Hierarchical AMOVAs attributed 85.52% of the overall variation to variation across the geographical range of N. pompilius and only 14.48% to variation within populations (Table S3). Tajima's D tests departures from population equilibrium, comparing the mean number of pairwise differences and the number of segregating sites in a sample, with positive selection expected to yield a negative Tajima's D value in a population with recent population expansion or purifying selection (Tajima 1989, 1996). Tajima's D values were significant in Western Australia (−1.193), New Caledonia (−1.186), and Papua New Guinea (−1.666) (Table 3), indicating recent population growth while recovering from possible bottleneck. Values for Tajima's D were not significant in other sampling locations.

Mitochondrial genetic population structure

TCS haplotype networks displayed for each locus revealed a strong association between haplotype variation and geographical distribution (Figs. 4 and S3). Haplotypes for concatenated 16S‐COI sequences were not shared between geographical locations (Fig. 4). With the expanded COI data set of nautilus from across their range, haplotypes are heavily shared between Palau, Indonesia, eastern Australia, and the Philippines (Figure S3). No population was found to be completely isolated from other N. pompilius populations, including locations containing samples identified as other Nautilus species: N. macromphalus, N. belauensis, N. stenomphalus, and N. repertus.
Figure 4

TCS haplotype networks of Nautilus pompilius from across the Indo‐Pacific that were collected for this study. Haplotype networks were constructed based on 1196 bp concatenated COI‐16S sequences (See Table S1 for sample information). Each circle represents a different haplotype, with its size proportional to the number of individuals found with that haplotype; black circles represent hypothetical ancestors; and dashes on branches indicate base pair differences. The sampling sites are indicated by different colors refer to the region in which haplotypes were found; we did not observe distinct haplotypes shared among regions.

TCS haplotype networks of Nautilus pompilius from across the Indo‐Pacific that were collected for this study. Haplotype networks were constructed based on 1196 bp concatenated COI‐16S sequences (See Table S1 for sample information). Each circle represents a different haplotype, with its size proportional to the number of individuals found with that haplotype; black circles represent hypothetical ancestors; and dashes on branches indicate base pair differences. The sampling sites are indicated by different colors refer to the region in which haplotypes were found; we did not observe distinct haplotypes shared among regions.

Discussion

There is an important conservation aspect to understanding and discerning the number of genetically distinct taxa in the extant Nautilidae: nautiluses are targeted for their shells and are sold in markets around the world as ornaments or jewelry (Sinclair et al. 2007, 2011; Dunstan et al. 2011a; De Angelis 2012). These fisheries are under no regulations to date, although a proposal to add the family Nautilidae to the CITES treaty under Appendix II protection has been proposed and will be reviewed in 2016. Increased information on the genetics and population biology of these species is vital in understanding the future of this living fossil and assessing the impact of the shell trade on populations across the Indo‐Pacific. Importantly, we need to know how rapidly (if at all) a local population driven to extinction by fishing might become repopulated from more distant localities. Lastly, due to the low fecundity and the unregulated fishing of these populations (Barord et al. 2014), local extinctions may be a real risk, as stressed by the CITES proposal. Molecular data are paramount to understanding the present state of conservation crisis in nautilus. We have sought to resolve intergenus relationships within the genus Nautilus, as well as determine the number of extant species, as results from previous studies have been inconclusive (Sinclair et al. 2007; Bonacum et al. 2011; Sinclair et al. 2011). Our AMOVA results indicate that populations are relatively isolated from one another, with high variation across the range of N. pompilius being attributed to differences between populations, while the populations themselves are less diverse. This corresponds to the clustering of geographical regions within the TCS haplotype network, in which many geographical regions (particularly Fiji, American Samoa, New Caledonia, and Vanuatu) are relatively isolated with the highest numbers of base pair differences. Our results add new samples to these important prior investigations; however, we differ from previous workers in our interpretation of current Nautilus taxonomy. The data presented here support that individual nautiluses identified as N. belauensis, N. repertus, and N. stenomphalus may be morphotypes or subspecies of N. pompilius, or individuals with interesting phenotypic plasticity, as the mitochondrial COI and 16S sequences from these nautiluses are indistinguishable from those of N. pompilius under rigorous phylogenetic analysis. Furthermore, original taxonomic descriptions of N. belauensis, N. repertus, and N. stenomphalus are based on a very small number of morphological characters. For example, a major morphological difference of the species N. belauensis compared to N. pompilius is a slightly different pattern of shell growth lines. Identifying solid taxonomic markers for distinguishing individuals from disparate populations as separate species is difficult because soft parts of these animals are considered to be identical, although we believe a rigorous taxonomic reassessment may illicit more informative morphological characters. Further morphological and genetic experiments must be conducted to rigorously test this hypothesis. Identification of strong taxonomic characters from the viscera of extant nautilids would help to inform assessments of population‐ or species‐level differences at a morphological level. Microsatellites have recently been developed for Nautilus (Williams et al. 2015a, 2015b) but have not been employed across a wide geographical range. These powerful tools should be utilized to inform fisheries management and conservation efforts, as well as assess the validity of the currently recognized extant species.

Conflict of Interest

None declared. Figure S1. Bayesian inference tree of COI sequences of Nautilus pompilius sequences from our study and sequences of all nonredundant Nautilus spp. sequences from GenBank (in bold); GenBank entries that had identical DNA sequences from the same collection location were not included in the analysis. Click here for additional data file. Figure S2. Bayesian inference tree of 16S sequences of Nautilus pompilius from our study and sequences of N. macromphalus and Allonautilus scrobiculatus from GenBank. Click here for additional data file. Figure S3. Median‐joining network of COI haplotypes for Nautilus sp. from GenBank with 95% confidence. Click here for additional data file. Table S1. Descriptions and defining characters of Nautilus species examined in this study. Click here for additional data file. Table S2. Information for GenBank sequences from previous studies used in phylogenetic analysis including species identifications from previous studies, collection sites (country and specific location), Genbank accessions for COI or 16S, and the publication or study that submitted the sequence. Click here for additional data file. Table S3. AMOVA of all Nautilus spp. COI sequences from GenBank. Click here for additional data file. Table S4. Population average pairwise differences for samples from this study, using concatenated 16S‐COI sequences. Click here for additional data file.
  16 in total

1.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

2.  MUSCLE: multiple sequence alignment with high accuracy and high throughput.

Authors:  Robert C Edgar
Journal:  Nucleic Acids Res       Date:  2004-03-19       Impact factor: 16.971

3.  The Natural History of Nautilus. Peter Douglas Ward. Allen and Unwin, Winchester, MA, 1987. xiv, 267 pp., illus. $34.95; Nautilus. The Biology and Paleobiology of a Living Fossil. W. Bruce Saunders and Neil H. Landman, Eds. Plenum, New York, 1988. xxviii, 632 pp., illus., + plates. $95. Topics in Geobiology, vol. 6.

Authors:  G J Vermeij
Journal:  Science       Date:  1988-05-20       Impact factor: 47.728

4.  The amount of DNA polymorphism maintained in a finite population when the neutral mutation rate varies among sites.

Authors:  F Tajima
Journal:  Genetics       Date:  1996-07       Impact factor: 4.562

5.  The genetic structure of Nautilus pompilius populations surrounding Australia and the Philippines.

Authors:  Rachel C Williams; Benjamin C Jackson; Ludovic Duvaux; Deborah A Dawson; Terry Burke; William Sinclair
Journal:  Mol Ecol       Date:  2015-06-19       Impact factor: 6.185

6.  Statistical method for testing the neutral mutation hypothesis by DNA polymorphism.

Authors:  F Tajima
Journal:  Genetics       Date:  1989-11       Impact factor: 4.562

7.  New molecular phylogeny of the squids of the family Loliginidae with emphasis on the genus Doryteuthis Naef, 1912: mitochondrial and nuclear sequences indicate the presence of cryptic species in the southern Atlantic Ocean.

Authors:  João Bráullio de Luna Sales; Paul W Shaw; Manuel Haimovici; Unai Markaida; Divino B Cunha; Jonathan Ready; Wilsea M B Figueiredo-Ready; Horacio Schneider; Iracilda Sampaio
Journal:  Mol Phylogenet Evol       Date:  2013-04-06       Impact factor: 4.286

8.  Vertical distribution and migration patterns of Nautilus pompilius.

Authors:  Andrew J Dunstan; Peter D Ward; N Justin Marshall
Journal:  PLoS One       Date:  2011-02-22       Impact factor: 3.240

9.  Nautilus pompilius life history and demographics at the Osprey Reef Seamount, Coral Sea, Australia.

Authors:  Andrew J Dunstan; Peter D Ward; N Justin Marshall
Journal:  PLoS One       Date:  2011-02-10       Impact factor: 3.240

10.  Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.

Authors:  Matthew Kearse; Richard Moir; Amy Wilson; Steven Stones-Havas; Matthew Cheung; Shane Sturrock; Simon Buxton; Alex Cooper; Sidney Markowitz; Chris Duran; Tobias Thierer; Bruce Ashton; Peter Meintjes; Alexei Drummond
Journal:  Bioinformatics       Date:  2012-04-27       Impact factor: 6.937

View more
  4 in total

1.  The genome of Nautilus pompilius illuminates eye evolution and biomineralization.

Authors:  Yang Zhang; Fan Mao; Huawei Mu; Minwei Huang; Yongbo Bao; Lili Wang; Nai-Kei Wong; Shu Xiao; He Dai; Zhiming Xiang; Mingli Ma; Yuanyan Xiong; Ziwei Zhang; Lvping Zhang; Xiaoyuan Song; Fan Wang; Xiyu Mu; Jun Li; Haitao Ma; Yuehuan Zhang; Hongkun Zheng; Oleg Simakov; Ziniu Yu
Journal:  Nat Ecol Evol       Date:  2021-05-10       Impact factor: 19.100

2.  Postmortem transport in fossil and modern shelled cephalopods.

Authors:  Margaret M Yacobucci
Journal:  PeerJ       Date:  2018-11-27       Impact factor: 2.984

3.  Functional Characterization, Antimicrobial Effects, and Potential Antibacterial Mechanisms of NpHM4, a Derived Peptide of Nautilus pompilius Hemocyanin.

Authors:  Chun Yuan; Xiaoying Zheng; Kunna Liu; Wenbin Yuan; Yang Zhang; Fan Mao; Yongbo Bao
Journal:  Mar Drugs       Date:  2022-07-16       Impact factor: 6.085

4.  Demographic disequilibrium in living nautiloids (Nautilus and Allonautilus): Canary in the coal mines?

Authors:  W Bruce Saunders; Emily Greenfest-Allen; Peter D Ward
Journal:  PLoS One       Date:  2017-07-20       Impact factor: 3.240

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.