Literature DB >> 27503660

Genetic characterization of cysteine-rich type-b avenin-like protein coding genes in common wheat.

X Y Chen1,2,3, X Y Cao3, Y J Zhang2, S Islam2, J J Zhang2, R C Yang2, J J Liu3, G Y Li3, R Appels2, G Keeble-Gagnere2, W Q Ji1, Z H He4, W J Ma2.   

Abstract

The wheat avenin-like proteins (ALP) are considered atypical gluten constituents and have shown positive effects on dough properties revealed using a transgenic approach. However, to date the genetic architecture of ALP genes is unclear, making it impossible to be utilized in wheat breeding. In the current study, three genes of type-b ALPs were identified and mapped to chromosomes 7AS, 4AL and 7DS. The coding gene sequence of both TaALP-7A and TaALP-7D was 855 bp long, encoding two identical homologous 284 amino acid long proteins. TaALP-4A was 858 bp long, encoding a 285 amino acid protein variant. Three alleles were identified for TaALP-7A and four for TaALP-4A. TaALP-7A alleles were of two types: type-1, which includes TaALP-7A1 andTaALP-7A2, encodes mature proteins, while type-2, represented byTaALP-7A3, contains a stop codon in the coding region and thus does not encode a mature protein. Dough quality testing of 102 wheat cultivars established a highly significant association of the type-1 TaALP-7A allele with better wheat processing quality. This allelic effects were confirmed among a range of commercial wheat cultivars. Our research makes the ALP be the first of such genetic variation source that can be readily utilized in wheat breeding.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27503660      PMCID: PMC4977551          DOI: 10.1038/srep30692

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Bread wheat (Triticum aestivum L.) is the most important staple food worldwide. Its unique viscoelastic properties conferred by the storage proteins, glutenins and gliadins, account for its extensive use and multi-ethnic expressions in food preparation, reflected in a wide range of wheat-derived food products12. The glutenin polymers are composed of an elastic backbone, formed by high-molecular-weight (HMW) subunits, and the branches, formed by low-molecular-weight (LMW) subunits which are the main contributors to dough strength and elasticity. The monomeric gliadins, conferring dough tractability, interact with the polymeric glutenins by strong covalent and non-covalent forces345. The structural characteristics of proteins affect polymerization behavior through both the strategic positioning of generally conserved cysteine residues and the presence of glutamine-rich repetitive regions within the polypeptide chain56789. Cysteines constitute only a small proportion of the amino acids of gluten proteins (about2%), yet are extremely important to the structure and functionality of gluten due to their capacity to form intra- and inter-chain disulfide bonds10. Non-covalent bonds (hydrogen bridges, ionic interactions, and hydrophobic bonds), characteristically formed by glutamines, are responsible for the aggregation and structural stability of gluten proteins and dough structure formation1112. Besides the typical gluten proteins, storage protein components also include LMW gliadins or globulins with a molecular weight below 30,000 dalton131415. Most of these atypical gluten proteins fall into the categories of ALPs or proteins with sequences similar to the previously reported LMW gliadin monomers1415. LMW gliadins differ from gliadins and glutenins in lacking repetitive domains, with only a short sequence of proline and glutamine residues present in the mature protein15. The existence of proteins related to LMW gliadins, and constituting a new family of grain prolamin proteins, has also been confirmed in barley1617 and rye18. DuPont and co-workers described a protein isolated from wheat grains as ‘avenin-like’, based on partial amino sequences determined by mass spectrometry19. Similarly, Vensel and coworkers20 identified five avenin-like proteins in the proteome of albumins and globulins during early and late stages of grain development. Kan and coworkers reported two classes of cDNAs encoding two types of ALPs, namely type-a and type-b21. In a phylogenetic analysis of the prolamin superfamily, the ALP genes co-locate as a single cluster, with its closest neighbors being avenin of oats and the sulphur-rich proteins (α-gliadins, γ-gliadins, LMW subunits of glutenin). Furthermore, in the same study the authors observed that type-a ALPs contain 14 cysteine residues, among which eight cysteines form the characteristic conserved cysteine skeleton of the typical prolamins (similar to avenin, α-gliadins, γ-gliadins, and LMW subunits of glutenin)22. It is noteworthy that type-a ALPs can form seven intra-chain disulfide bonds, which is typical of monomeric LMW gliadins. Type-b ALPs contain two repetitive domains (R1, R2), each with eight cysteine residues in homologous positions to the cysteines of γ-gliadin and oats avenin protein. Type-b ALPs also exhibited some differences in cysteine distribution, with a total of 18 or 19 cysteine residues. In particular, Mamone and coworkers23 detected type-b ALPs in the glutenin fraction of durum wheat cultivar Svevo, while Kan and co-workers21 found that the two cysteines in the N-terminal domain are not conserved in various Aegilops species, hence suggesting that they could be involved in inter-chain linkages to polymeric subunits of glutenins. The identification of type-b ALPs was supported by the acquisition of sequences from a reasonable number of tryptic peptides matching the expected molecular weights and pI values23. The higher number of cysteines in type-b ALPs was expected to have a significant effect on folding and the arrangement of disulfide linkages, not only by stabilizing the molecular structure, but also by influencing glutenin polymer formation. Chen and coworkers24 predicted that type-b ALPs were capable of forming eight intra-molecular disulfide bonds, with three free cysteine residues involved in inter-molecular disulfide bond formation. They confirmed that type-b ALPs can notably perform as “chain branches”, increasing the probability of glutenin macro-polymer (GMP) formation and including other glutenin subunits24. Ma and coworkers overexpressed type-b ALPs in two transgenic wheat lines, resulting in a highly significant improve of dough mixing properties and provided strong evidence for their incorporation into gluten polymers25. Until now, when selecting for dough and baking quality improvement, wheat breeders have mainly relied on the genetic variation underlying gluten proteins. The effect on dough mixing properties associated with ALPs represents a novel genetic effect that has not been utilized in a targeted way in wheat grain functionality breeding thus far. Marker-assisted selection targeting ALPs depends on both natural allelic variation of ALPs and their validated effects on dough mixing properties. The objectives of this study were to locate the type-b ALP coding genes, find the number of available alleles and quantify the allelic effects for each locus, and to develop allele-specific markers for wheat grain functionality breeding.

Results

Type-b ALP coding genes in Triticum aestivum

ALP specific primers were used to amplify the complete coding sequence of type-b ALP genes from the genomic DNA of 19 cultivars. The amplified products covering the start and stop codons were about 902 bp in length (Fig. 1). Nucleotide sequences highly similar (99%) to the previously reported type-b ALP gene sequence (Accession No. FJ529695) were obtained.
Figure 1

PCR amplification products of type b ALP genes from genomic DNA of 19 wheat cultivars (lines).

M DNA ladder 100 bp; 01, Chara; 02, Negative control; 03, Kauz; 04, Eagle Rock; 05, Gregory; 06, Living Stone; 07, Westonia; 08, Wyalkatchem; 09, Yitpi; 10, Chinese Spring; 11, Jimai0860229; 12, Jimai13P406; 13, Jimai13J492; 14, Jimai13J492; 15, Jimai13J394; 16, Jimai13J494; 17, Jimai13P414; 18, Jimai23; 19, Jimai24; 20, Jimai44.

Sequence alignment and analysis

The sequences of the amplified ALP genes were used to search the EnsemblPlants (http://plants.ensembl.org/Triticum_aestivum/Info/Index) and the International Wheat Genome Sequencing Consortium (IWGSC) databases. The results showed that type-b ALP genes were transcribed at a high rate and consisted of a single uninterrupted exon. The results were consistent with previous studies26. In addition, the type-b ALP gene sequences were good matches to three surveyed sequences (Chinese Spring) on chromosomes 7DS (99%), 4AL (98%) and 7AS (97%).

Gene locations

Three pairs of specific primers were designed, targeting ALP genes on chromosomes 7AS, 4AL and 7DS to verify the blasted results (Table 1). These primers were tested across the entire set of Chinese Spring deletion lines. Results were consistent with the surveyed sequence databases and the chromosomal location of the gene products ALP-7A, ALP-4A and ALP-7D was confirmed (Fig. 2). We thus named the three ALP gene loci TaALPb-7A, TaALPb-4A, and TaALPb-7D, accordingly.
Table 1

Chromosome-specific primer sets for cloning type-b ALP genes.

MarkerPrimer sequences (5′-3′)Tm (°C)Product size (bp)Amplified target
ALPF: TGCCACACATGATGATGCATG60912Full length
R:ATGAAGGTCTTCATCCTG GCTC
ALP-7AF: ATGCCAACATCAACAACCG557627A genome-specific
R: TAGTACGCACCACCAGGGTAA
ALP-4AF: TCGGACAATACCAACAACAG557774A genome-specific
R: TCTAGCATGCACCACTAGTGC
ALP-7DF: ATGAAGGTCTTCATCCTGGCT588057D genome-specific
R: CTAGCACGCACCACCAGT
Figure 2

Chromosome-specific type-b ALP amplification using Chinese Spring deletion lines.

M DNA ladder 100bp; 01, 7A (deletion lines); 02, 7B (deletion lines); 03, 7D (deletion lines); 04, 7A (deletion lines); 05, 7B (deletion lines); 06, 7D (deletion lines); 07, 4A (deletion lines); 08, 4B (deletion lines); 09, 4D (deletion lines).

SNP and indel analyses

Genomic DNA of 19 cultivars was amplified using the primer pairs specific for ALP-7A, ALP-4A and ALP-7D, with each primer pair amplifying one single sequence across all cultivars. The full-length sequences at the three gene loci were either 855 or 858 bp, encoding proteins with 284 and 285 amino acid residues, accordingly. In addition, SNP and indel polymorphisms were discovered among the amplicons of different cultivars at loci TaALPb-7A and TaALPb-4A. Seven polymorphic sites were detected among the TaALPb-7Aamplicons, including one deletion (three bases) and six SNPs involving five transversions and one transition (Fig. 3). Eighteen polymorphic sites were detected among the TaALPb-4A amplicons, including seventeen SNPs involving14 transversions and 3 transitions, as well as one indel variant (Fig. 4). No variationwas found at the TaALPb-7D locus (Fig. 5). These results indicate that multiple alleles exist for TaALPb-7A and 4A while no or little genetic variation exists at the TaALPb-7D locus. Further comparison revealed that the TaALPb-7A gene had three alleles, designated TaALPb-7A1 (GenBank accession no. KU286147), TaALPb-7A2 (GenBank accession no. KU286148) (frequency 50.98%) and TaALPb-7A3 (GenBank accession no. KU286149) (frequency 49.02%) in the current study (Table 2), while TaALPb-4A gene had four alleles, TaALPb-4A1 (GenBank accession no. KU286150), TaALPb-4A2 (GenBank accession no. KU286151), TaALPb-4A3 (GenBank accession no. KU286152), and TaALPb-4A4 (GenBank accession no. KU286153). The TaALPb-7D (GenBank accession no. KU286154) locus did not show any allelic variation across the cultivars screened in this study. Analysis of the translated protein sequences revealed that the signal peptides at the N-and C-termini were rather conserved, with hardly any variation detected. The sequence differences occurred mainly in the repetitive region. Major variations were detected on 7AS and 4AL alleles. Among the 7AS alleles, TaALPb-7A1 andTaALPb-7A2encode mature proteins, while allele TaALPb-7A3 contained a stop codon (a SNP resulting in CAA→TAA codon change. Figure 3), leading to early termination of translation in 10 cultivars (Supplementary Figure 1). Anonymous silenced ALP genes have been previously reported272829. In-frame stop codons were not detected for the 4AL alleles, although many variations occurred within the mature proteins (Supplementary Figure 2). In addition, 18 cysteine residues were detected in 7AS and 7DS ALPs. The 4AL ALPs contained 19 cysteine residues, exhibiting more cysteine residues than previously reported for endosperm-specific storage proteins.
Figure 3

Alignment of the type-b ALP gene sequences located on wheat chromosome 7AS.

SNPs/InDels are shown. Polymorphisms are represented by black box. Dashed (-) and Dots (.), respectively indicate identical and deletion nucleotides. 1, Chinese Spring; 2, Eagle Rock; 3, Jimai13J394; 4, Jimai13J409; 5, Jimai13J492; 6, Jimai13P406; 7, Jimai0860229; 8, Living Stone; 9, Westonia; 10, Wyalkatchem; 11, Jimai13J494; 12, Jimai13P414; 13, Jimai23; 14, Jimai24; 15, Jimai44; 16, Kauz; 17, Yitpi; 18, Gregory; 19, Chara.

Figure 4

Alignment of the type-b ALP gene sequences located on wheat chromosome 4AL.

SNPs/InDels are shown. Polymorphisms loci are represented by black box. Dashed (-) and Dots (.), respectively indicate identical and deletion nucleotides. 1, Jimai13J492; 2, Kauz; 3, Jimai13J409; 4, Eagle Rock; 5, Chara; 6, Jimai13P406; 7, Jimai23; 8, Jimai24; 9, Jimai13J494; 10, Jimai13P414; 11, Yitpi; 12, Wyalkatchem; 13, Westonia; 14, Chinese Spring; 15, Gregory; 16, Living Stone; 17, Jimai44; 18, Jimai0860229; 19, Jimai13J394.

Figure 5

The type-b ALP gene sequences located on wheat chromosome 7DS.

No SNPs/InDels are shown in 19 wheat cultivars. 1, Chinese Spring; 2, Eagle Rock; 3, Jimai13J394; 4, Jimai13J409; 5, Jimai13J492; 6, Jimai13P406; 7, Jimai0860229; 8, Living Stone; 9, Westonia; 10, Wyalkatchem; 11, Jimai13J494; 12, Jimai13P414; 13, Jimai23; 14, Jimai24; 15, Jimai44; 16, Kauz; 17, Yitpi; 18, Gregory; 19, Chara.

Table 2

Mixograph parameters investigated for active and silent alleles of TaALPb-7A.

 Mean ± SD
Mixograph ParametersBand type: 0 (Frequency: 49.02%)Band type: 1 (Frequency: 50.98%)
Midline Peak time (min)2.32 ± 0.852.84 ± 1.63*
Midline Peak integral (cm2)89.06 ± 35.15107.49 ± 63.47
Midline Peak width (%)17.36 ± 3.0517.16 ± 3.56
Midline Time × width (%)5.43 ± 2.227.03 ± 3.70***

Band type 0: silent alleles; Band type 1: active alleles.

*Difference significant at 5% probability level; ***Difference significant at 0.1% probability level.

In general, the type-b ALP proteins can be considered to be glutamine and proline-rich proteins, although less than gliadins and LMW glutenins, due to the lack of extensive repetitive sequences. At the same time, ALP proteins exhibited a conserved distribution of cysteines (Supplementary Figures 1 and 2), which are predicted to be able to form seven or eight intra-molecular disulfide bonds among the 18 or 19 cysteine residues. The remaining cysteines (at least two) may form inter-molecular disulfide bonds linking to adjacent storage protein subunits.

Phylogenetic analysis

The phylogenetic relationship of the 42 cloned type b ALPs sequences was analyzed by applying UPGMA to the aligned complete coding sequences of all clones and wheat storage protein genes, as well as the reported ALPs of wheat-related species available from various databases (Table 3). As shown in Fig. 6, the cloned type-b ALP sequences clustered according to their chromosomal origin. The cloned ALP sequences were closest to the reported type-b ALP sequences of related species, followed by sequences corresponding to HMW-GS and LMW-GS, while ω-gliadin were the furthest in evolutionary terms (Fig. 6).
Table 3

The reported nucleotide sequences of the wheat storage protein sequences and ALPs sequences of related species for phylogenetic analysis.

Gene nameCategoryGenBank accession No.Source
HMW-GSx-typeGQ403045Ae. markgrafii
y-typeGQ403046Ae. markgrafii
LMW-GSi-typeAY453156T. aestivum
s-typeEU189088T. aestivum
m-typeAB062851T. aestivum
Gliadinα-typeEU401789T. turgidum
GQ891682T. aestivum
β-typeDQ166376T. aestivum
DQ166378T. aestivum
γ-typeFJ006600T. aestivum
GQ871773T. aestivum
ω-typeAY591334T. aestivum
GQ423430T. aestivum
ALPsType bEU096535Ae. triuncialis
EU096544Ae. juvenalis
EU096550H. vulgare
EU096551O. sativa
EF526510T. aestivum
FJ529695T. aestivum
EU096547T. monococcum
EU096548T. turgidum
Figure 6

Phylogenetic analysis of the cloned sequences of type-b ALPs.

Allelic effects

The fact that the TaALPb-7A locus has two types of alleles, active and silent, allowed us to study its allelic effects. Allele-specific PCR markers were designed to differentiate the two types of TaALPb-7A alleles and a total 102 wheat cultivars or lines were selected for quality testing and marker analysis (Fig. 7). Mixograph analyses were conducted to assess wheat dough strength using procedures published previously3031323334. Significant allelic effect differences were detected bewteen the active and silent alleles of TaALPb-7A. The active allele was significantly associated with higher dough strength parameters, including Midline Peak Time (P < 0.0443), and Midline Time × Width (P < 0.0096) (Table 2). Meanwhile, the component of HMW-GS, protein content and gluten content of 102 wheat cultivars or lines were analyzed (see Supplementary Table 1). Results revealed that the HMW-GS alleles were randomly distributed between the allelic types. The favorable subunit Dx5 was found in 33% of the silent wheat lines and 29% in the active lines. No significant association was detected between the allelic types and grain protein content or gluten content (Table 4), indicating the high dough strength of the active allelic type is from the expression of TaALPb-7A.
Figure 7

PCR amplification products of AS-PCR marker for TaALP-7A.

M DNA ladder 100bp; 01 to 11 lanes are PCR products of selected cultivars; 12, Negative control; presence of a band indicates TaALP-7A1 and TaALP-7A2, absence stands for TaALP-7A3.

Table 4

Statistical analysis of Mixograph and NIR parameters.

AlleleNumber of accessionsMean ProteinMean MTxWMean MPWMean MPIMean MPTMean Gluten
Active5211.68a7.03a17.16a107.49a2.84a39.81a
Silent5011.98a5.43b17.36a89.06a2.32b40.06a

(a and b indicate significance at P = 0.05).

Comparison of the active and silent alleles of TaALPb-7A at gene expression level

To further confirm the function of these two types of the TaALPb-7A alleles, comparison of gene expression between four Australian cultivars (Kauz, Yitpi, Gregory, and Chara) containing the active TaALPb-7A allele and another four wheat cultivars (Chinese Spring, Eagle Rock, Westonia, and Wyalketchem) containing the silent TaALPb-7A allele were conducted by using reverse transcription (RT) reaction followed by digital droplet PCR (ddPCR). Results revealed that the cultivars with the active allele give a normal gene expression, the ratios of expressed gene copy numbers between TaALPb-7A and actin ranged from 1:2.54 to 1:3.36 (Table 5), while the four cultivars with the silent allele had no gene expression.
Table 5

Comparison of the active and silent alleles of TaALP-7A at gene expression by ddPCR.

CultivarTaALP-7A typeExpressed gene copiesMeanActin expressiod copiesMeanActin/TaALP
Chinese spring 1Silent01890561727630
Chinese spring 2161358
Chinese spring 3167877
Eagle rock1Silent093603925360
Eagle rock293141
Eagle rock390864
Westonia1Silent099825919340
Westonia275655
Westonia3100321
Wyalketchem1Silent020577214890
Wyalketchem221837
Wyalketchem322054
Chara1Active124191264838018387943.07
Chara21292143240
Chara31260535123
Greygory1Active4872493911761125422.54
Greygory2576615829
Greygory3417910038
Kauz1Active43054111655810865.42.64
Kauz2426310443
Kauz3376715595
Yitip1Active1528061479215373294970293.36
Yitip2124735521603
Yitip3166223432155
NTC1
NTC2
NTC3

Discussion

Cysteine-rich wheat grain storage avenin-like proteins (ALPs) capable of forming intra-molecular disulfide bonds were discovered in recent years and are considered atypical gluten components of the wheat grain storage protein complement. However, the presence of similar low-molecular weight subunits in glutenins and gliadins has been reported in the 1970s3536, and these seem capable of forming strong in vivo associations among themselves and with HMW-GS and LMW-GS, apparently by inter-chain disulfide bonds. ALPs make up about 1% of total endosperm proteins37. Contrary to the typical gluten proteins that are characterized by large repetitive central domains these non-traditional gluten proteins lack repeating sequences. In 2D gels, type-b ALPs migrate only slightly faster than the LMW glutenins, α-, or γ-gliadins, due to sequence duplication in the central domain (R1, R2), compensating to a large extent for the missing repeating sequence domain3738. The unique properties demonstrated by type-b ALPs make them an ideal component of elastic disulfide-linked aggregates. In this study, phylogenetic analysis clearly showed that the type-b ALP sequences of common wheat clustered in the same class. The cloned sequences of the current study also clustered together, forming a small class of its own. Further, the sequences of type-b ALP genes indicated a genetic relationship to the unique C-terminal domains of gluten proteins (LMW-GS and gliadins) and are notable for the absence of significant repetitive domains of typical HMW-GS. Due to the great homology of ALP genes to gliadins and avenins, these genes might be primitive versions of earlier storage proteins predating development of the repetitive domains of the traditional gluten proteins. Alternatively, they might have evolved by losing the repetitive domains of the ancestral genes. Further work is needed to establish a clear evolutionary context for ALPs in relation to the traditional gluten proteins. It is noteworthy that almost all reported type-b ALP genes were derived from chromosome 7D, suggesting that the genes on chromosomes 7A and 4A in the current study were new discoveries. More importantly, the allelic effects identified in this study were attributed to the newly discovered 7A locus, representing a class of novel non-traditional gluten protein variation that can be readily utilized in breeding for wheat grain functionality. Our results confirmed that ALP genes belong to a multigene family, like other gluten proteins genes26394041. Cole and coworkers42 reported that the tetraploid forms (AABB) of wheat are actually heterogeneous for the diploid donors of the A and B genomes, which helps explain the genetic variability at the 7A and 4A loci. However, the addition of the D genome to the tetraploid ancestor of bread wheat, even though it occurred on several separate occasions, seems to have relied on the hybridization with a rather conservative Aegilopsspp genome42. We found no genetic variation at the 7D locus of type-b ALP genes in the lines and varieties investigated in this study. Despite the potential of type-b ALP proteins to form intermolecular bonds, their low abundance and the absence of a repetitive domain might limit their ability to play a major role in determining dough functional properties, so further work is needed to establish the potential of individual ALPs for dough viscoelasticity improvement. Research conducted on transgenic type-b ALP wheat lines confirmed the presence of free cysteines capable of improving dough mixing properties by forming extra inter-chain disulfide linkages with glutenins (HMW-GS and LMW-GS)43. Future research on the expression of ALPs, aimed at providing a more detailed understanding of peptide chain interactions, disulfide bond arrangements, and tertiary structure formation will allow us to delve deeper into the molecular interactions with gluten proteins. Combination and association analysis using targeted allelic ALP combinations will shed further light upon the highly complex interactions due to the allelic composition of sulfur-rich proteins (γ- and α-gliadin, LMW-GS), as well as sulfur-poor proteins (ω-gliadins and HMW-GS). Although many researchers have mentioned that type-b ALP genes of wheat belong to a multigenefamily26394041, there still remained a paucity of genetic information about the chromosomal location, number of loci and alleles, and allelic effects. The current study clearly identified the chromosomal locations of type-b ALP genes and the number of alleles at each locus for the first time. In this study, the three type-b ALP gene loci were mapped to chromosomes 7AS, 4AL and 7DS. Theoretically, due to the allohexaploid (AABBDD) nature of bread wheat, the three gene loci should be located on three homeologous chromosome locations (7AS, 7BS and 7DS). The reason for the unusual chromosomal locations can be found in the evolutionary relationships of wheat chromosome arms44454647, ie., a 4AL/7BS translocation, a pericentric inversion, and a paracentric inversion that took place in the tetraploid progenitor of hexaploid wheat48. This clearly provides a theoretical basis for the localization of the type-b ALP loci on 7AS, 4AL and 7DS. Common factors contribute to the different types of allelic variations, including natural evolution and artificial selection. In this study, the TaALP-7A1 allele was detected in five Chinese cultivars (lines) (Jimai13J494, Jimai13P414, Jimai23, Jimai24 and Jimai44), while the TaALP-7A2 allele came from four Australian cultivars (Kauz, Yitpi, Gregory and Chara). It is expected that new alleles may be discovered by expanding the number of lines and varieties screened. In addition, multilocus analyses of the experimental wheat lines have shown that striking, non-random associations of alleles develop over certain loci, i.e. the wheat lines develop a highly organized genetic structure featuring multilocus gene complexes. The frequency of functional alleles (50.98%) and the silent allele (49.02%) for TaALP-7A among eight type-b ALP alleles at three-locus combinations are found at equal levels in the tested wheat cultivars. This equal distribution of functional and non-functional alleles indicates that they could be used for marker-assisted screening for improved wheat flour processing quality. The occurrence frequency of the active TaALP-7A1 and TaALP-7A2 (50.98%) alleles underlines the potential utility of these alleles in wheat breeding programs. The use of functional markers (FM) is especially important for the accurate discrimination of different alleles in marker-assisted selection (MAS)4950. Thus far, 56 FM for processing quality traits are have been developed for 16 loci, with 62 alleles associated with HMW glutenins, LMW glutenins, polyphenol oxidase activity, lipoxygenase activity, yellow pigment content, kernel hardness, and starch properties50. These FMs play an important role in MAS-based breeding for improved wheat grain functionality. However, selection for wheat dough properties and breadmaking qualities has been limited to the genetic variability o gluten using the available HMW and LMW glutenin markers. The ALP allelic variation associated with dough quality discovered in the current study represents a class of novel natural genetic variation that has not been previously utilized in wheat breeding. The FM developed for the active 7AS allele can be efficiently applied to track this newly discovered variation. Important genetic and cytogenetic aspects of wheat grain functionality that still require our attention are how the expression of genes associated with dough processing properties (HMW-GS, LMW-GS, gliadins and ALPs) relates to the response of wheat storage protein accumulation to certain environmental and physiological processes.

Methods

Plant material and experimental design

All wheat lines used in the current study is listed in Table 6. Nineteen wheat cultivars from Australia and China were used to clone the type-b ALP genes. Field trial of 102 bread wheat cultivars (lines) with a randomized complete block design with 3 replications at the experiment station in Crop Research Institute, Shandong Academy of Agricultural Sciences, Jinan, China, in 2012 and 2013 (36°42′N, 117°4′E; altitude 48 m). Shandong has a humid subtropical climate with a mean annual rainfall of 700 mm and average maximum temperatures of over 34 °C during wheat growing season. Seeds were sown by 300 kernels per square meter in 4 × 6 m plots.
Table 6

Name and origin of 111 wheat cultivars and advanced lines.

NameOriginNameOriginNameOriginNameOrigin
JimaiH101CHINAJimaiT112CHINAJimaiC70218CHINAJimai13J390CHINA
JimaiH102CHINAJimaiT118CHINAJimaiC70223CHINAJimai13P406CHINA
JimaiH105CHINAJimaiT120CHINAJimaiC70228CHINAJimai13J407CHINA
JimaiH106CHINAJimaiD101CHINAJimaiC70231CHINAJimai13J408CHINA
JimaiH107CHINAJimaiD102CHINAJimaiC70241CHINAJimai13J492CHINA
JimaiH108CHINAJimaiD103CHINAJimaiC70245CHINAJimai13J424CHINA
JimaiH109CHINAJimaiD104CHINAJimaiC70247CHINAJimai13J427CHINA
JimaiH110CHINAJimaiD105CHINAJimaiC70285CHINAJimai13J394CHINA
JimaiH111CHINAJimaiD106CHINAJimaiC70298CHINAJimai13J464CHINA
JimaiH112CHINAJimaiD107CHINAJimaiC70321CHINAJimai13J467CHINA
JimaiH113CHINAJimaiD108CHINAJimaiC70356CHINAJimai13J490CHINA
JimaiH114CHINAJimaiD109CHINAJimaiC70361CHINAJimai13J492CHINA
JimaiH117CHINAJimaiD111CHINAJimaiC70365CHINAJimai13J494CHINA
JimaiH118CHINAJimaiD113CHINAJimaiC70373CHINAJimai13J495CHINA
JimaiH120CHINAJimaiD116CHINAJimaiC70421CHINAJimai9088CHINA
JimaiH122CHINAJimaiD117CHINAJimaiC70445CHINAJimai23CHINA
JimaiH123CHINAJimaiD118CHINAJimaiC70459CHINAJimai24CHINA
JimaiH124CHINAJimaiD119CHINAJimaiC70483CHINAJimai0860229CHINA
JimaiH125CHINAJimaiD120CHINAJimaiC70509CHINAChinese SpringCHINA
JimaiT102CHINAJimaiD121CHINAJimaiT30005CHINAKauzAUSTRALIA
JimaiT103CHINAJimaiD122CHINAJimaiT40097CHINAEagle RockAUSTRALIA
JimaiT104CHINAJimaiD123CHINAJimaiT40098CHINACharaAUSTRALIA
JimaiT105CHINAJimaiD124CHINAJimaiT40103CHINAWyalkatchemAUSTRALIA
JimaiT216CHINAJimai13P307CHINAJimaiT40271CHINAGregoryAUSTRALIA
JimaiT108CHINAJimai13P406CHINAJimaiT40284CHINALiving StoneAUSTRALIA
JimaiT109CHINAJimai44CHINAJimaiT40362CHINAYitpiAUSTRALIA
JimaiT110CHINAJimai13P414CHINAJimaiT40368CHINAWestoniaAUSTRALIA
JimaiT111CHINAJimaiC70107CHINAJimai13J386CHINA
Fertilizers of 120 kg N ha−1, 60 kg P2O5 ha−1, and 120 kg K2O ha−1 were applied to the soil prior to sowing, and another 120 kg N ha−1 was top dressed at jointing in accordance with local wheat farming practices. The soil contained 1.64 g kg−1 organic matter in both years. All other standard agronomical practices were adopted. Seeds were harvested and used for mixograph, HMW-GS and NIR analysis. The means values of two trials were taken for analysis.

DNA extraction and PCR amplification

Genomic DNA of 19 cultivars was extracted from 1-week-old seedlings by using the cetyltrimethyl ammonium bromide (CTAB) method51. Primers to amplify the full-length gene were designed based on the type-b ALP coding sequence from NCBI database (Accession No.FJ529695) (Table 2). The PCR conditions were set to 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 60 °C for 45 s and 72 °C for 50 s, and a final extension at 72 °C for 10 min. PCR products were separated by 1.5% (w/v) agarose gel electrophoresis, and the expected fragments were purified from the gel using a Gel Extraction Kit (Promega, Madison, WI, USA). Subsequently, the purified PCR products were amplified using BigDye@version 3.1 terminator mix (Applied Biosystems) and submitted for Sanger sequencing at the Western Australia State Agricultural Biotechnology Centre. PCR and DNA sequencing were repeated three times to ensure the accuracy.

Chromosomal locations of type-b ALP genes

The EnsemblPlants (http://plants.ensembl.org/Triticum_aestivum/Info/Index) and the International Wheat Genome Sequencing Consortium (IWGSC) databases were used to analyze the obtained sequences. After blasting the obtained sequence from 19 cultivars against the databases, good matches were found on chromosomes 7DS, 4AL and 7AS. Based on this, three pairs of specific primers were designed for each chromosome using Primer V5.0 software (http://www.premierbiosoft.com) (Table 2). Chinese Spring deletion lines were then used to test the designed chromosome-specific primers and to verify the chromosomal locations.

Sequence analysis

The chromosome-specific primers were used to amplify the genomic DNA of 19 cultivars. The PCR products were ligated into pGEM-T Easy vector (Promega, Madison, WI, USA) following the manufacturer’s protocol and then the hybrid vector was transformed into competent cells of E. coli strain DH-5α. Plasmids were extracted using the Magic Mini Plasmid Prep kit (Promega, Madison, WI, USA) and the extracted DNA was amplified using BigDye@version 3.1 terminator mix (Applied Biosystems) for Sanger sequencing. The program Bioedit 7.0 was used for sequence analysis. Geneious® software (R7) was used for multiple alignment of the translated amino acid sequences and phylogenetic analysis.

Allele-specific marker development

Primers targeting the type-1 TaALP-7A allele were designed based on SNP/InDel information: F: 5′-TGCAGCAGCTTAGCAGCTGCCAT-3′; R: 5′-GCTGGT AGGCTGATCCACCGGA-3′. A total of 102 wheat cultivars and lines (Table 1) were screened using the allele-specific primers.

HMW-GS electrophoretic analysis

The HMW-GS protein for SDS-PAGE was extracted from wheat grains by using a modified method based on Singh et al.52. In detail, 500 μl of 55% (v/v) isopropanol was mixed with crushed individual kernels for 5 min through continuous vortexing, followed by incubation (30 min at 65 C), vortexing (5 min), and centrifugation (5 min at 10000 rpm). This step was repeated three times to completely remove gliadins. Add 600 μl of 62.5 mM Tris-HCl (pH 6.8) buffer containing 10% (w/v) glycerol, 2% (w/v) sodium dodecyl sulfate (SDS), 0.003% (w/v) bromophenol blue, and 5% β-mercaptoethanol. The samples were boiled for 2 hours and then centrifuged for 5 minutes at 10000 rpm, 15 ml of upper solution of each sample were loaded on to the gel. Proteins were separated by SDS-PAGE according to Jackson et al.53 using stacking separation gels containing 4% acrylamide, 0.3% bis acrylamide, 0.1% SDS, and 0.125 M Tris-HCL (pH 6.8), and 8.7% acrylamide, 0.3% bis acrylamide, 0.1% SDS, and 0.38 M Tris-HCL (pH 8.8). The bands of HMW-GS on SDS-PAGE were scored according to the nomenclature system described by Payne and Lawrence54.

Quality testing

A 10-gram mixograph (National Manufacturing Co., Lincoln NE) was used to evaluate wheat dough mixing properties, as described by Zhang and coworkers55. Mixograph Peak Time (MPT, min), Peak Integral (MPI, cm2), Peak Width (MPW, %), and Midline Time × Width (MT × W, min) were measured as the four parameters selected for evaluating the dough quality. The statistical significance of mixograph data was assessed performing T-tests using the SAS/STAT System software, Version 8.0 (SAS Institute Inc. Cary, NG)55. DA7200 near infrared apparatus (Perten, Swedish) was applied to analyze the protein content and gluten content following the manufacture’s suggestion.

RNA extraction and ddPCR

RNA was extracted from 2 mature wheat grains of the 8 cultivars: Kauz, Yitpi, Gregory, Chara, Chinese spring, Eagle rock, Westonia, and Wyalketchem using the Qiagen RNeasy mini kit. The TaALP-7A RNA was carried out using the SuperScript® II Reverse Transcriptase (Applied Biosystems), with the 3′ primer: 5′-GCTGGTAGGCTGATCCACCGGA-3′ for the active allele and 3′ primer 5′-GCTGGT AGGCTGATCCACCAGT-3′ for the silent allele. The ddPCR was performed in a QX200 ddPCR system (Bio-Rad). The forward primers were 5′-TGCAGCAGCTTAGCAGCTGCCAT-3′ for the active allele and 5′-TGCAGCAGCTTAGCAGCTGCCAG-3′ for the silent allele. The beta actin primers (F: 5′-AGAGCTACGAGCTGCCTGAC-3′; R: 5′-AGCACTGTGTTGGCGTACAG-3′) were used as the reference gene in a separate ddPCR. The ratios of the expressed gene copies between actin and TaALP-7A were calculated.

Additional Information

How to cite this article: Chen, X. Y. et al. Genetic characterization of cysteine-rich type-b avenin-like protein coding genes in common wheat. Sci. Rep. 6, 30692; doi: 10.1038/srep30692 (2016).
  26 in total

Review 1.  Cereal seed storage proteins: structures, properties and role in grain utilization.

Authors:  Peter R Shewry; Nigel G Halford
Journal:  J Exp Bot       Date:  2002-04       Impact factor: 6.992

2.  The characterisation and mapping of a family of LMW-gliadin genes: effects on dough properties and bread volume.

Authors:  Bryan C Clarke; Tanya Phongkham; Maria Cristina Gianibelli; Helen Beasley; Ferenc Bekes
Journal:  Theor Appl Genet       Date:  2002-10-19       Impact factor: 5.699

3.  Characterization and organization of gene families at the Gli-1 loci of bread and durum wheats by restriction fragment analysis.

Authors:  P A Sabelli; P R Shewry
Journal:  Theor Appl Genet       Date:  1991-12       Impact factor: 5.699

4.  Identification of major rye secalins as coeliac immunoreactive proteins.

Authors:  A Rocher; M Calero; F Soriano; E Méndez
Journal:  Biochim Biophys Acta       Date:  1996-06-07

5.  Distribution of Nonstructural Variation between Wheat Cultivars along Chromosome Arm 6Bp: Evidence from the Linkage Map and Physical Map of the Arm.

Authors:  J Dvorák; K C Chen
Journal:  Genetics       Date:  1984-02       Impact factor: 4.562

6.  Proteomic-based analytical approach for the characterization of glutenin subunits in durum wheat.

Authors:  Gianfranco Mamone; Salvatore De Caro; Aldo Di Luccia; Francesco Addeo; Pasquale Ferranti
Journal:  J Mass Spectrom       Date:  2009-12       Impact factor: 1.982

Review 7.  Wheat.

Authors:  P R Shewry
Journal:  J Exp Bot       Date:  2009       Impact factor: 6.992

8.  Chromosome structure of durum wheat.

Authors:  T Naranjo
Journal:  Theor Appl Genet       Date:  1990-05       Impact factor: 5.699

9.  Grain protein variability among species of Triticum and Aegilops: quantitative SDS-PAGE studies.

Authors:  E W Cole; J G Fullington; D D Kasarda
Journal:  Theor Appl Genet       Date:  1981-01       Impact factor: 5.699

10.  Transformation of common wheat (Triticum aestivum L.) with avenin-like b gene improves flour mixing properties.

Authors:  Fengyun Ma; Miao Li; Lingling Yu; Yin Li; Yunyi Liu; Tingting Li; Wei Liu; Hongwen Wang; Qian Zheng; Kexiu Li; Junli Chang; Guangxiao Yang; Yuesheng Wang; Guangyuan He
Journal:  Mol Breed       Date:  2013-08-02       Impact factor: 2.589

View more
  8 in total

1.  Genetic diversity of avenin-like b genes in Aegilops tauschii Coss.

Authors:  Dong Cao; Hongxia Wang; Bo Zhang; Baolong Liu; Dengcai Liu; Wenjie Chen; Huaigang Zhang
Journal:  Genetica       Date:  2017-10-13       Impact factor: 1.082

2.  RNA-Seq Analysis of Developing Grains of Wheat to Intrigue Into the Complex Molecular Mechanism of the Heat Stress Response.

Authors:  Surinder Paul; Joginder Singh Duhan; Sarika Jaiswal; Ulavappa B Angadi; Ruchika Sharma; Nishu Raghav; Om Prakash Gupta; Sonia Sheoran; Pradeep Sharma; Rajender Singh; Anil Rai; Gyanendra Pratap Singh; Dinesh Kumar; Mir Asif Iquebal; Ratan Tiwari
Journal:  Front Plant Sci       Date:  2022-06-02       Impact factor: 6.627

Review 3.  Genomic and functional genomics analyses of gluten proteins and prospect for simultaneous improvement of end-use and health-related traits in wheat.

Authors:  Daowen Wang; Feng Li; Shuanghe Cao; Kunpu Zhang
Journal:  Theor Appl Genet       Date:  2020-02-04       Impact factor: 5.699

4.  New insights into the evolution of wheat avenin-like proteins in wild emmer wheat (Triticum dicoccoides).

Authors:  Yujuan Zhang; Xin Hu; Shahidul Islam; Maoyun She; Yanchun Peng; Zitong Yu; Steve Wylie; Angela Juhasz; Mirza Dowla; Rongchang Yang; Jingjuan Zhang; Xiaolong Wang; Bernard Dell; Xueyan Chen; Eviatar Nevo; Dongfa Sun; Wujun Ma
Journal:  Proc Natl Acad Sci U S A       Date:  2018-12-10       Impact factor: 11.205

5.  Characterising avenin-like proteins (ALPs) from albumin/globulin fraction of wheat grains by RP-HPLC, SDS-PAGE, and MS/MS peptides sequencing.

Authors:  Yujuan Zhang; Xin Hu; Angela Juhasz; Shahidul Islam; Zitong Yu; Yun Zhao; Gang Li; Wenli Ding; Wujun Ma
Journal:  BMC Plant Biol       Date:  2020-01-29       Impact factor: 4.215

6.  Biostimulant Effects of Glutacetine® and Its Derived Formulations Mixed With N Fertilizer on Post-heading N Uptake and Remobilization, Seed Yield, and Grain Quality in Winter Wheat.

Authors:  Victor Maignan; Benoit Bernay; Patrick Géliot; Jean-Christophe Avice
Journal:  Front Plant Sci       Date:  2020-11-13       Impact factor: 5.753

7.  Quantitative Label-Free Comparison of the Metabolic Protein Fraction in Old and Modern Italian Wheat Genotypes by a Shotgun Approach.

Authors:  Antonella Di Francesco; Vincenzo Cunsolo; Rosaria Saletti; Birte Svensson; Vera Muccilli; Pasquale De Vita; Salvatore Foti
Journal:  Molecules       Date:  2021-04-29       Impact factor: 4.411

Review 8.  Wheat Quality Formation and Its Regulatory Mechanism.

Authors:  Yanchun Peng; Yun Zhao; Zitong Yu; Jianbin Zeng; Dengan Xu; Jing Dong; Wujun Ma
Journal:  Front Plant Sci       Date:  2022-03-30       Impact factor: 5.753

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.