| Literature DB >> 27488618 |
Nicole Harrison1, Heinz Burgmann1, Christina Forstner1,2, Michael Ramharter1,3, Marton Széll4, Anna-Margarita Schötta5, Gerold Stanek5, Mateusz Markowicz6.
Abstract
African tick bite fever is an emerging infectious disease among travellers caused by the pathogen Rickettsia africae. Most travel-associated cases have been reported from countries in southern Africa. So far it has rarely been reported among travellers to eastern Africa and our patient is one of the first described cases imported from Tanzania. A woman presented with fever, chills, headache, myalgia and a rickettsial eschar on her ankle after returning from Tanzania. The diagnosis of African tick bite fever is often based on clinical grounds due to a lack of reliable diagnostic tests at commencement of symptoms. In this patient direct molecular detection of R. africae was performed by PCR from a sample obtained non-invasively with a swab from the rickettsial eschar. A positive PCR result was achieved although the patient had already started antibiotic treatment with doxycycline. In conclusion, this non-invasive method enables early diagnosis of African tick bite fever by direct molecular detection of R. africae and might improve the management of undifferentiated fever in travellers from Africa.Entities:
Keywords: African tick bite fever; Eschar; Rickettsia africae; Rickettsiosis; Tanzania
Mesh:
Year: 2016 PMID: 27488618 PMCID: PMC5010599 DOI: 10.1007/s00508-016-1047-0
Source DB: PubMed Journal: Wien Klin Wochenschr ISSN: 0043-5325 Impact factor: 1.704
Fig. 1The rickettsial eschar on the right ankle of the patient during the first visit before treatment was initiated (a) and at the follow-up 1 week later after treatment with doxycycline (b)
Primer and probe sequences used to identify Rickettsia africae
| Oligonucleotide name | Target gene | Oligonucleotide sequence (5’ → 3’) | Reference |
|---|---|---|---|
|
| |||
| RickF | gltA gene | GGT ATA CCG TCG CAA ATG TTC AC | [ |
| RickR | gltA gene | GGG TCT TCG TGCATT TCT TTC C | [ |
| RickTM | gltA gene | TGT GCC ATC CAG CCT ACG GTT CTT Ga | [ |
|
| |||
| Rick-F1 | 16S rRNA gene | GAA CGC TAT CGG TAT GCT TAA CAC A | [ |
| Rick-R2 | 16S rRNA gene | CAT CAC TCA CTC GGT ATT GCT GGA | [ |
| RCK/23-5-F | 23S-5S IGS | GAT AGG TCR GRT GTG GAA GCA C | [ |
| RCK/23-5-R | 23S-5S IGS | TCG GGA YGG GAT CGT GTG TTT C | [ |
| CS-78 | gltA gene | GCA AGT ATC GGT GAG GAT GTA AT | [ |
| CS-323 | gltA gene | GCT TCC TTA AAA TTC AAT AAA TCA GGA T | [ |
| M59 | ompB (I) | CCGCAGGGTTGGTAACTGC | [ |
| 120-807 R | ompB (I) | CCTTTTAGATTACCGCCTAA | [ |
| 120-607 F | ompB (II) | AATATCGGTGACGGTCAAGG | [ |
| 120-1497 | ompB (II) | CCTATATCGCCGGTAATT | [ |
| 120-1378 | ompB (III) | TAAACTTGCTGACGGTACAG | [ |
| 120-2399 | ompB (III) | CTTGTTTGTTTAATGTTACGGT | [ |
| 120-2113 | ompB (IV) | CGATGCTAACGTAGGTTCTT | [ |
| 120-2988 | ompB (IV) | CCGGCTATACCGCCTGTAGT | [ |
| 120-2788 | ompB (V) | AAACAATAATCAAGGTACTGT | [ |
| 120-3599 | ompB (V) | TACTTCCGGTTACAGCAAAGT | [ |
| 120-3462 | ompB (VI) | CCACAGGAACTACAACCATT | [ |
| 120-4346 | ompB (VI) | CGAAGAAGTAACGCTGACTT | [ |
aReal time PCR probe was labeled with 5’FAM and 3’TAMRA
Fig. 2Phylogenetic tree based on partial ompB nucleotide sequences of the genus Rickettsia. The tree was constructed by using the maximum likelihood method with the use of the Tamura-3-parameter model and gamma distribution. The bootstrap consensus tree was inferred from 1000 replicates. A total of 23 nucleotide sequences were involved in the analysis. Accession numbers of sequences obtained from GenBank are shown in parenthesis. The final dataset included a total of 4155 positions. Evolutionary analysis was conducted in MEGA (Molecular Evolutionary Genetics Analysis) version 7.0