Literature DB >> 27403451

Identification of Genes Coding Aminoglycoside Modifying Enzymes in E. coli of UTI Patients in India.

Abdul Rouf Mir1, Yasir Bashir2, Firdous Ahmad Dar1, M Sekhar3.   

Abstract

This study is to probe the pattern of antibiotic resistance against aminoglycosides and its mechanism in E. coli obtained from patients from Chennai, India. Isolation and identification of pathogens were done on MacConkey agar. Antimicrobial sensitivity testing was done by disc diffusion test. The identification of genes encoding aminoglycoside modifying enzymes was done by Polymerase Chain Reaction (PCR). Out of 98 isolates, 71 (72.45%) isolates were identified as E. coli and the remaining 27 (27.55%) as other bacteria. Disc diffusion method results showed a resistance level of 72.15% for streptomycin, 73.4% for gentamicin, 63.26% for neomycin, 57.14% for tobramycin, 47.9% for netilmicin, and 8.16% for amikacin in E. coli. PCR screening showed the presence of four genes, namely, rrs, aacC2, aacA-aphD, and aphA3, in their plasmid DNA. The results point towards the novel mechanism of drug resistance in E. coli from UTI patients in India as they confirm the presence of genes encoding enzymes that cause resistance to aminoglycoside drugs. This could be an alarm for drug prescription to UTI patients.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27403451      PMCID: PMC4926017          DOI: 10.1155/2016/1875865

Source DB:  PubMed          Journal:  ScientificWorldJournal        ISSN: 1537-744X


1. Introduction

Infectious diseases continue to be a leading cause of mortality all over the world especially in developing countries with poorly accessed health services [1]. With the passage of time, the burden of bacterial infections is showing an ascending trend and this is largely due to the generation of resistance mechanisms by bacteria [2, 3]. Among the various patterns of resistance, reports across the globe continue to emerge on the resistance to aminoglycoside antibiotics which otherwise have been reported as highly potent drugs against life threatening Gram-negative bacterial infections [4, 5]. Aminoglycosides act primarily by impairing bacterial protein synthesis through binding to prokaryotic ribosomes via 16S ribosomal RNA (16S rRNA) and by disrupting the bacterial cell membrane integrity [6]. Aminoglycoside resistance has been reported in both Gram-negative and Gram-positive bacteria and main mechanisms that affect the efficacy of aminoglycoside drugs are a decreased uptake and/or accumulation of the drug in bacteria and the expression of aminoglycoside modifying enzymes (AMEs) that eventually inactivate the drugs [7]. Reduced drug uptake and active efflux of aminoglycosides have emerged as an additional mechanism of aminoglycoside resistance in Gram-negative bacteria [6]. Enzymatic inactivation of aminoglycoside drugs is caused by acetyltransferases, nucleotidyltransferases, and phosphotransferases through acetylation, adenylation, and phosphorylation, respectively. The genetic determinants of these enzymes are often located on mobile elements facilitating the rapid dissemination of the genes in various bacterial populations [8]. The emergence of complexity in defence mechanism has intensified the epidemiological research on these antibiotics and various reports have emerged to document the resistance patterns and the reasoning behind that. The comparative studies on the data on mechanisms of aminoglycoside resistance in bacteria isolated from various regions of the world have helped in understanding the spread of multidrug-resistant strains [9]. Similar studies have correlated the selective pressure of antibiotics and the patterns of combinations of aminoglycoside resistance mechanisms [10]. Resistance patterns and prevalence of the aminoglycoside modifying enzymes in clinical isolates showing multidrug-resistant patterns have also been reported from various parts of India and it has been shown that high level aminoglycoside resistance genes are widely disseminated among Indian populations [11, 12]. Though aminoglycoside drugs are being widely prescribed to patients in India, there is urgent need for assessment of emerging drug resistance pattern against these drugs. This study aims at studying antibiotic resistance pattern on commonly used aminoglycoside antibiotics in India using disc diffusion and molecular screening method (PCR) to detect the aminoglycoside resistance genes rrs (rrs1 and rrs2), aacC2 (aacC1-1, aacC1-2, aacC2-1, aacC2-2, aacC3-1, aacC3-2, aacC4-1, aacC4-2, aadC-1, and aadC-2), aacA-aphD (aacA-aphD-1 and aacA-aphD-2), and aphA3 (aphA3-1 and aphA3-2) in E. coli using eight sets of primers (Table 1). The same genes were earlier reported in bacteria of clinical isolates from Jordan University Hospital [13].
Table 1

Primer specification.

NameSubfamilyPrimer sequence (5→3)PCR product
rrs rrs1 GGATTAGATACCCTGGTAGTCC320
rrs2 TCGTTGCGGGACTTAACCCAAC

aacC aacC1-1 ACCTACTCCCAACATCAGCC169
aacC1-2 ATATAGATCTCACTACGCGC
aacC2-1 ACTGTGATGGGATACGCGTC237
aacC2-2 CTCCGTCAGCGTTTCAGCTA
aacC3-1 CACAAGAACGTGGTCCGCTA185
aacC3-2 AACAGGTAAGCATCCGCATC
aacC4-1 CTTCAGGATGGCAAGTTGGT286
aacC4-2 TCATCTCGTTCTCCGCTCAT
aadC-1 GCAAGGACCGACAACATTTC165
aadC-2 TGGCACAGATGGTCATAACC

aacA-aphD aacA-aphD-1 CCAAGAGCAATAAGGGCATA220
aacA-aphD-2 CACTATCATAACCACTACCC

aphA3 aphA3-1 GCCGATGTGGATTGCGAAAA292
aphA3-2 GCTTGATCCCCAGTAAGTC

2. Materials and Methods

The study includes nonhospitalized patients attending clinical laboratory (Ehrlich Laboratory, Chennai, India). The clinical specimens were the urine samples collected from different patients from February to June 2015. The clean catch midstream urine samples were collected in sterile containers and transported within half an hour of collection to the laboratory. This study was duly approved by the Institutional Ethical Committee at University of Madras. Urine samples were collected from the patients after informed verbal consent. The mode of consent was duly approved by the ethical committee. A proper record of all the patients and healthy individuals has been maintained.

2.1. Isolation and Identification of Bacteria

Primary isolation was done on blood agar and MacConkey agar. Colonies from the primary isolation plates were picked up and Gram staining was done to study the morphology and Gram character. E. coli screening was carried out by carbohydrate fermentation test and the isolates were confirmed for genus and species by standard protocols [14]. Microscopic analysis was also used in identification.

2.2. Antibiotic Sensitivity Testing (Disc Diffusion Method)

Antimicrobial sensitivity testing was done by Kirby-Bauer Antimicrobial Susceptibility Test (disc diffusion method) using Mueller-Hinton agar [15]. Six different antibiotics were tested and the zone size was measured. Amikacin, streptomycin, gentamicin, tobramycin, netilmicin, and neomycin (obtained from HiMedia, India) were taken and screening test for detection of high level aminoglycoside resistance (HLAR) in Enterococcus species was confirmed as per Clinical and Laboratory Standards Institute (CLSI) approved standards [16] The E. coli isolates were described as isolates with high level aminoglycoside resistance considering growth ≥2048 μg/mL for streptomycin, ≥512 μg/mL for gentamicin, ≥512 μg/mL for neomycin, ≥256 μg/mL for tobramycin, ≥256 μg/mL for netilmicin, and ≥256 μg/mL for amikacin. MICs were determined by Etest (AB Biodisk).

2.3. Isolation of Plasmid DNA

Procedure for the isolation of plasmid DNA from Gram-negative bacteria that showed resistance to at least two aminoglycoside antibiotics (38 samples) was followed as given in HiElute Miniprep DNA Isolation Kit from HiMedia, India. The isolated plasmids were stored at −20°C in deep freezer till processed.

2.4. Identification of Genes Encoding Aminoglycoside Enzymes

Detection of aminoglycoside resistance genes rrs (rrs1 and rrs2), aacC2 (aacC1-1, aacC1-2, aacC2-1, aacC2-2, aacC3-1, aacC3-2, aacC4-1, aacC4-2, aadC-1, and aadC-2), aacA-aphD (aacA-aphD-1 and aacA-aphD-2), and aphA3 (aphA3-1 and aphA3-2) from E. coli was done by PCR technique using Thermal Cycler (PTC 150, MJ Research). Blue mix DNA polymerase master mix, deoxynucleotide triphosphates (dNTPs), taq DNA polymerase, and the reaction buffer containing magnesium ions and the other required components were obtained from RBC Bioscience, India. Primers for the genes were purchased from Invitrogen (USA) through JOYVEL Biotech, India. Template DNA was isolated from E. coli. The working concentration of the primer was taken as 200 mM. The amount of PCR reaction mixture was taken as 50 μL which included 25 μL of blue mix DNA master mix, 5 μL of forward primer, 5 μL of reverse primer, 5 μL of template DNA, and 10 μL of TAE buffer. The PCR was performed with initial denaturation at 95°C for 3 min followed by 32 cycles each of denaturation at 94°C for 30 sec, annealing at 60°C for 45 sec, and extension at 72°C for two min for each gene. The amplification products were analyzed by 0.8% agarose gel electrophoresis and the product size was compared with DNA markers. After treatment with ethidium bromide (0.5 μg/mL), the gels were visualized using gel-doc system (Bio-Rad Laboratories, USA).

3. Results

Out of the total 320 clinical specimens collected from a private clinical laboratory, Ehrlich Laboratory, only 98 (30.6%) showed pathogenic growth. Out of 98 isolates, 71 (72.45%) isolates were identified as E. coli and the remaining 27 (27.55%) as other bacteria. Phenotypic resistance to aminoglycoside antibiotics as analyzed by standard Kirby-Bauer disc diffusion method showed an overall mean resistance level of 73.4% for gentamicin, 72.15% for streptomycin, 63.26% for neomycin, 57.14% for tobramycin, 47.9% for netilmicin, and 8.16% for amikacin. We further probed the mechanism of resistance at molecular level using PCR technique for those E. coli isolates that were resistant to at least two aminoglycoside antibiotics. These included 38 of the total E. coli samples. PCR was carried out using eight sets of primers from previously published data (Table 1) [13]. The screened isolates were shown to carry four genes, namely, rrs, aacC2, aacA-aphD,and aphA3. Primers for five subtypes of the same gene aacC were employed. The rrs was found to be the most abundant and was found in 26 (68.4%) isolates and others included aacC gene in 18 (47.36%), aphA3 gene in 13 (34.2%), and aacC-aphD gene in 7 (18.42%). No amplification of genes could be seen for seven isolates (Figures 1 and 2). We could find five isolates with three genes encoding aminoglycoside enzymes, sixteen isolates containing two genes, five isolates containing no genes, and other isolates containing a single gene. None of the isolates contained all the four genes in the plasmid genome. The 38 samples that were rendered to PCR analysis included patients aged 3–18 years (3 males and 5 females), 25–45 years (4 males and 12 females), and 55–80 years (5 males and 9 females). The presence of three genes in E. coli isolates was found in single male (age: 45 years) and four females (age: 8, 36, 68, and 72 years).
Figure 1

Gel documentation for genes encoding aminoglycoside modifying enzymes.

Figure 2

Gel documentation for rrs genes (five different samples) encoding aminoglycoside modifying enzymes.

4. Discussion

Aminoglycoside resistance rates, phenotypes, and mechanisms of Gram-negative bacteria from infected patients across the world have shown progressive trends and it has been observed that resistance patterns have been disseminated in various bacterial species [7, 11]. Since aminoglycoside drugs are thus far making a choice for clinicians for infectious treatments, it is highly significant to investigate the emerging resistance patterns in bacteria against these drugs, so as to understand the current resistance status and explore the more efficient means of dealing with these infectious agents. We screened resistance to aminoglycoside antibiotics using both phenotypic and genotypic methods. These results clearly indicate the enhanced resistance in the bacterial isolates against various aminoglycoside antibiotics. An earlier report that has employed Kirby-Bauer method to check the high level aminoglycoside resistance in Enterococci isolates has provided the similar inference for aminoglycoside resistance against gentamicin, streptomycin, and both of them together from Chennai, India [11]. Another report from infected patients in Upper Egypt has shown Gram-negative bacterial resistance against streptomycin, neomycin, kanamycin, gentamicin, and tobramycin. Similar to our observation, minimal resistance was reported against amikacin antibiotic [7]. Other various similar reports have published data showing growing multidrug resistance against most commonly used antibiotics in India [17-19]. Some latest reports emerging from different parts of India have shown an alarming rise of aminoglycoside drug resistance. One of such studies has shown high level resistance to gentamicin against five common aminoglycoside resistance genes aac(6′)-Ie-aph(2′′)-Ia, aph(2′′)-Ib, aph(2′′)-Ic, aph(2′′)-Id, and aph(3′)-IIIa [20]. Another report shows high level aminoglycoside resistance for gentamicin, streptomycin, and both antibiotics with the detection of various aminoglycoside modifying enzyme encoding genes from southern part of India [11]. The reports from central India and north India have also shown a similar trend of rising aminoglycoside resistant isolates [21-24]. Studies from different parts of India show increasing resistance to aminoglycoside drugs among the bacterial isolates and more and more genes are being identified and found responsible for molecular mechanism of the drug resistance. This study now confirmed that one or more antibiotic resistance genes are carried on an R plasmid and more than one antibiotic could be a substrate for certain aminoglycoside modifying enzymes. The presence of different aminoglycoside resistance genes, namely, rrs, aacC2, aacA-aphD, and aphA3, in E. coli infers towards emergence of defence mechanism at molecular levels. Amikacin was observed to be the most potent drug among the used antibiotics. The results clearly infer towards the expression of aminoglycoside resistance genes in the E. coli isolates under study from India, which is a real problem and a challenge for urinary tract infection patients. The absence of genes in the five isolates can plausibly be explained by the presence of genes for which we did not include primers or the genes that are as yet unknown. Such a resistance would limit the choices of antibiotics available to clinicians to treat bacterial infections in patients. Earlier studies in India have shown the presence of aac(6), ant(2), and aph(3) genes in the E. coli, Klebsiella species, and Pseudomonas species bacterial isolates [23]. A latest study has shown an array of AMEs expressed by aac(6′)-Ie-aph(2′′)-Ia and aph(3′)-IIIa genes responsible for causing high level of resistance in Enterococcus species against aminoglycosides [11]. It is clear that E. coli has assumed resistant patterns with the advancement of time and due to the exposure to the drugs. The resistance mechanisms lead to a compromising position for a clinician whether to subscribe the drugs to the patients or not. Various workers have developed combinational drugs with better bactericidal efficiencies and they may be a better choice for the treatment of infectious diseases caused by E. coli. This may be the only way to discourage the proliferation of antibiotic resistant microbes and to safeguard effectiveness of existing antimicrobial drugs. The concern of aminoglycoside resistance is serious and needs urgent attention. Regular surveillance of antimicrobial susceptibilities and effective management of bacterial infections needs urgent attention to limit the further spread of multidrug resistance in India.
  18 in total

Review 1.  Aminoglycosides: activity and resistance.

Authors:  M P Mingeot-Leclercq; Y Glupczynski; P M Tulkens
Journal:  Antimicrob Agents Chemother       Date:  1999-04       Impact factor: 5.191

Review 2.  The emerging threat of multidrug-resistant Gram-negative bacteria in urology.

Authors:  Hosam M Zowawi; Patrick N A Harris; Matthew J Roberts; Paul A Tambyah; Mark A Schembri; M Diletta Pezzani; Deborah A Williamson; David L Paterson
Journal:  Nat Rev Urol       Date:  2015-09-01       Impact factor: 14.432

3.  Clinico-Microbiological Investigation of Catheter Associated Urinary Tract Infection by Enterococcus faecalis: vanA Genotype.

Authors:  Kesavaram Padmavathy; Shabana Praveen; Radha Madhavan; Nagarajan Krithika; Alexander Kiruthiga
Journal:  J Clin Diagn Res       Date:  2015-08-01

Review 4.  Versatility of aminoglycosides and prospects for their future.

Authors:  Sergei B Vakulenko; Shahriar Mobashery
Journal:  Clin Microbiol Rev       Date:  2003-07       Impact factor: 26.132

5.  Enterococcus fecalis Sepsis and Leukemoid Reaction: An Unusual Association at Birth.

Authors:  Ashok Kumar; Preetam Kumar; Sriparna Basu
Journal:  J Pediatr Hematol Oncol       Date:  2015-10       Impact factor: 1.289

6.  Aminoglycoside resistance in enterococci isolated from paediatric septicaemia in a tertiary care hospital in north India.

Authors:  V S Randhawa; L Kapoor; V Singh; G Mehta
Journal:  Indian J Med Res       Date:  2004-05       Impact factor: 2.375

7.  Evaluation of genotype MTBDRsl assay to detect drug resistance associated with fluoroquinolones, aminoglycosides and ethambutol on clinical sediments.

Authors:  Kanchan Ajbani; Chaitali Nikam; Mubin Kazi; Christen Gray; Catharina Boehme; Kavita Balan; Anjali Shetty; Camilla Rodrigues
Journal:  PLoS One       Date:  2012-11-15       Impact factor: 3.240

Review 8.  Prospects for circumventing aminoglycoside kinase mediated antibiotic resistance.

Authors:  Kun Shi; Shane J Caldwell; Desiree H Fong; Albert M Berghuis
Journal:  Front Cell Infect Microbiol       Date:  2013-06-25       Impact factor: 5.293

9.  Aminoglycoside resistance rates, phenotypes, and mechanisms of Gram-negative bacteria from infected patients in upper Egypt.

Authors:  Gamal F Gad; Heba A Mohamed; Hossam M Ashour
Journal:  PLoS One       Date:  2011-02-17       Impact factor: 3.240

10.  Antimicrobial drug prescribing patterns for community-acquired pneumonia in hospitalized patients: A retrospective pilot study from New Delhi, India.

Authors:  Anita Kotwani; Santosh Kumar; Prafulla Kumar Swain; J C Suri; S N Gaur
Journal:  Indian J Pharmacol       Date:  2015 Jul-Aug       Impact factor: 1.200

View more
  3 in total

1.  The First Saudi Study Investigating the Plasmid-borne Aminoglycoside and Sulfonamide Resistance among Acinetobacter baumannii Clinical Isolates Genotyped by RAPD-PCR: the Declaration of a Novel Allelic Variant Called aac(6')-SL and Three Novel Mutations in the sul1 Gene in the Acinetobacter Plasmid (s).

Authors:  Mohamed F El-Badawy; Fatma I Abou-Elazm; Mohamed S Omar; Mostafa E El-Naggar; Ibrahim A Maghrabi
Journal:  Infect Drug Resist       Date:  2021-11-12       Impact factor: 4.003

2.  Evaluation of phenotypic and genotypic patterns of aminoglycoside resistance in the Gram-negative bacteria isolates collected from pediatric and general hospitals.

Authors:  Leila Azimi; Shahnaz Armin; Hossein Samadi Kafil; Nafiseh Abdollahi; Kiarash Ghazvini; Sepide Hasanzadeh; Shahram Shahraki Zahedani; Sedigheh Rafiei Tabatabaei; Fatemeh Fallah
Journal:  Mol Cell Pediatr       Date:  2022-02-04

3.  Simultaneous pharmacokinetic/pharmacodynamic (PKPD) assessment of ampicillin and gentamicin in the treatment of neonatal sepsis.

Authors:  Silke Gastine; Christina Obiero; Zoe Kane; Phoebe Williams; John Readman; Sheila Murunga; Johnstone Thitiri; Sally Ellis; Erika Correia; Borna Nyaoke; Karin Kipper; John van den Anker; Mike Sharland; James A Berkley; Joseph F Standing
Journal:  J Antimicrob Chemother       Date:  2022-02-02       Impact factor: 5.790

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.