| Literature DB >> 27391700 |
Mariusz Stasiołek1, Hanna Romanowicz2, Katarzyna Połatyńska1, Maciej Chamielec1, Dominik Skalski3, Marianna Makowska4, Beata Smolarz5.
Abstract
PURPOSE: Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.Entities:
Keywords: Children; Drug-resistant epilepsy; Drug-responsive epilepsy; Gene polymorphism; MDR1
Mesh:
Substances:
Year: 2016 PMID: 27391700 PMCID: PMC4938960 DOI: 10.1186/s12993-016-0106-z
Source DB: PubMed Journal: Behav Brain Funct ISSN: 1744-9081 Impact factor: 3.759
The number and age of the patients submitted to MDR1 gene polymorphism studies
| Children with drug-resistant epilepsy (n = 106) | Children with drug-responsive epilepsy (n = 67) | Healthy children (n = 98) |
|---|---|---|
| Age (range) 1–15 years | Age (range) 1–16 years | Age (range) 4–14 years |
| Age (mean) 8.5 ± 4.84 | Age (mean) 8.2 ± 4.019 | Age (mean) 8.3 ± 4.64 |
Primer sequences and conditions for real-time PCR and the following HRM analysis of the examined MDR1 C3435T
| Target | Primers (5′–3′) | PCR cycling (40 cycles) | HRM | ||
|---|---|---|---|---|---|
| Denaturation | Annealing | Extension | |||
| rs1045642 | Forward: TCCTGAAGTTGATCTGTGAAC | 30 s for 95 °C | 30 s for 58 °C | 30 s for 72 °C | 75–90 °C |
Distributions of TT, CT and CC genotypes and T and C alleles in C3435T polymorphism of MDR1 gene in the group of children with drug-resistant epilepsy and in the group of healthy children
| Children with drug-resistant epilepsy (n = 106) | Healthy children (n = 98) | OR (95 % CIa)b |
| |||
|---|---|---|---|---|---|---|
| Number | (%) | Number | (%) | |||
| CC | 35 | 33 | 16 | 16 | 1.00 Ref.d | |
| CT | 39 | 37 | 37 | 38 | 0.48 (0.23–1.01) | 0.079 |
| TT | 32 | 30 | 45 | 46 | 0.33 (0.15–0.68) | 0.005 |
| C | 109 | 51 | 69 | 35 | 1.00 Ref. | |
| T | 103 | 49 | 127 | 65 | 0.53 (0.33–0.85) | 0.012 |
aCrude odds ratio (OR), 95 % CI confidence interval at 95 %
bAdjusted for age and use of variety of drugs
cfor the test of χ2 conformity with the distribution predicted by the Hardy–Weinberg law
dReference group—wild type of allele
Distributions of TT, CT and CC genotypes and T and C alleles in C3435T polymorphism of MDR1 gene in the group of children with drug-resistant epilepsy and in the group of drug-responsive epilepsy
| Children with drug-resistant epilepsy (n = 106) | Children with drug-responsive epilepsy (n = 67) | OR (95 % CIa)b |
| |||
|---|---|---|---|---|---|---|
| Number | (%) | Number | (%) | |||
| CC | 35 | 33 | 16 | 24 | 1.00 Ref.d | |
| CT | 39 | 37 | 18 | 27 | 0.99 (0.44–2.23) | 0.862 |
| TT | 32 | 30 | 33 | 49 | 0.44 (0.21–0.95) | 0.036 |
| C | 109 | 51 | 50 | 37 | 1.00 Ref. | |
| T | 103 | 49 | 84 | 63 | 0.56 (0.36–0.87) | 0.014 |
aAnalysis of odds ratio (OR odds ratio, PU Confidence Interval 95 %)
bAdjusted for age and use of variety of drugs
cFor the test of χ2 conformity with the distribution predicted by the Hardy–Weinberg law
dReference group—wild type of allele
Distributions of TT, CT and CC genotypes and T and C alleles in C3435T polymorphism of MDR1 gene in the group of children with drug-responsive epilepsy and in the group of healthy children
| Children with drug-responsive epilepsy (n = 67) | Healthy children (n = 98) | OR (95 % CIa)b |
| |||
|---|---|---|---|---|---|---|
| Number | (%) | Number | (%) | |||
| CC | 16 | 24 | 16 | 16 | 1.00 Ref.d | |
| CT | 18 | 27 | 37 | 38 | 0.48 (0.19–1.18) | 0.172 |
| TT | 33 | 49 | 45 | 46 | 0.73 (0.32–1.67) | 0.596 |
| C | 50 | 37 | 69 | 35 | 1.00 Ref. | |
| T | 84 | 63 | 127 | 65 | 0.92 (0.58–1.44) | 0.777 |
aAnalysis of odds ratio (OR odds ratio, PU Confidence Interval 95 %)
bAdjusted for age and use of variety of drugs
cFor the test of χ2 conformity with the distribution predicted by the Hardy–Weinberg law
dReference group—wild type of allele