Literature DB >> 27387288

Habenular Neurogenesis in Zebrafish Is Regulated by a Hedgehog, Pax6 Proneural Gene Cascade.

Caroline Halluin1,2,3, Romain Madelaine1,2,3, François Naye4, Bernard Peers4, Myriam Roussigné1,2, Patrick Blader1,2.   

Abstract

The habenulae are highly conserved nuclei in the dorsal diencephalon that connect the forebrain to the midbrain and hindbrain. These nuclei have been implicated in a broad variety of behaviours in humans, primates, rodents and zebrafish. Despite this, the molecular mechanisms that control the genesis and differentiation of neural progenitors in the habenulae remain relatively unknown. We have previously shown that, in zebrafish, the timing of habenular neurogenesis is left-right asymmetric and that in the absence of Nodal signalling this asymmetry is lost. Here, we show that habenular neurogenesis requires the homeobox transcription factor Pax6a and the redundant action of two proneural bHLH factors, Neurog1 and Neurod4. We present evidence that Hedgehog signalling is required for the expression of pax6a, which is in turn necessary for the expression of neurog1 and neurod4. Finally, we demonstrate by pharmacological inhibition that Hedgehog signalling is required continuously during habenular neurogenesis and by cell transplantation experiments that pathway activation is required cell autonomously. Our data sheds light on the mechanism underlying habenular development that may provide insights into how Nodal signalling imposes asymmetry on the timing of habenular neurogenesis.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27387288      PMCID: PMC4936704          DOI: 10.1371/journal.pone.0158210

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The Dorsal Diencephalic Conduction system (DDC) is a highly conserved neural circuit in the brain that consists of a pair of epithalamic nuclei, the habenulae, and two associated fibre tracts, the stria medullaris that carries axonal afferences from various area of the forebrain to the habenulae and the fasciculus retroflexus that conducts efferent axons from the habenulae to various midbrain/hindbrain target nuclei including the intrapeduncular nucleus or IPN [1,2]. The diversity in habenular afferent and efferent connections has led to the habenular nuclei being considered as major integrative and relay centres in the brain. Consistent with this idea, results from lesioning and electrophysiological studies indicate that the habenula complex is involved in controlling a multitude of cognitive functions and behaviours such as mating, aversive and olfactory guided behaviour, and spatial learning and attention [3,4]. More recently, the habenulae have caught neuroscientist’s attention for their role in the control of emotion and motivated behaviours. For instance, the lateral habenular subnucleus has been implicated in behaviour guided by error predictions in reward in primates and humans [5,6]. The medial subnucleus, on the other hand, has been shown to regulate anxiety and the expression of fear in zebrafish and mouse [7-9]. Finally, an abnormal increase in habenular activity has been associated with, and thought to drive symptoms of major depression in human [10] and in a rodent model of depression [11]. The habenulae display prominent left-right (LR) asymmetry in lower vertebrates, making them an attractive model to study the development of brain asymmetry [1,12-15]. In zebrafish, the habenulae consist of a dorsal (dHb) asymmetric and a ventral (vHb) symmetric domain that are homologous to the medial and lateral habenular sub-nuclei in mammals, respectively [16]. Based on the asymmetric expression of a restricted set of markers, the dHb has been further sub-divided into two main sub-nuclei whose sizes differ along the LR axis: the medial sub-nucleus (dHbm), which is bigger in the right habenula than the left and projects predominantly to the ventral part of the IPN, and the lateral sub-nucleus (dHbl), which is larger in the left habenula than the right and predominantly innervates the dorsal part of the IPN [17-21]. This subnuclear organisation implies that neuronal precursor of the dHb chose between at least two specification program (lateral or medial character) at different frequencies on the left and right sides. In zebrafish, this choice is predominantly controlled by a second epithalamic structure, the parapineal organ, a small nucleus that is specified at the midline and migrates to the left side in most wild type embryos [19,20]. While the orientation of habenular asymmetry always correlates with the side of parapineal migration, parapineal ablation prior to migration results in both habenulae adopting a predominantly “right” character [19,20]. Despite nearly 15 years of study, it is not yet clear how the parapineal imposes “left” character on the dorsal habenula, although recent studies indicate that this process involves a modulation of WNT signalling [22,23]. In addition to the role of the parapineal in the specification of habenular neuron identity, it has also been shown that there is an heterochrony in the birth of different habenular neuron subtypes; while habenular neurons are born first on the left and tend to populate the lateral sub-domain, neurons born later preferentially adopt medial characters [24]. We showed in a previous study that, in contrast to its requirement for later habenular asymmetries, the parapineal is not necessary for the early asymmetry in the timing of habenular neurogenesis [25]. We also showed that when a LR bias in Nodal signaling is abrogated, habenular neurons appear at the same time in both habenulae. Habenular neurons are nonetheless produced in the absence of Nodal activity leading us to propose that the Nodal pathway modulates a generic/symmetric programme of habenular neurogenesis, rendering it more effective/efficient on the left [25]. Relatively little is known about the mechanisms controlling this generic programme of habenular neurogenesis. Here, we identify the proneural genes Neurog1 and Neurod4 as being redundantly required for habenular neurogenesis and show that their expression in the habenulae depends on the homeodomain transcription factor Pax6a. Furthermore, we show that habenular neural progenitors are absent in embryos mutant for the Hedgehog (Hh) receptor Smoothened, and that Pax6a, Neurog1 and Neurod4 act downstream of Hh signalling. Using a pharmacological inhibitor of Hh signalling, we show that pathway activity is required continuously for habenular neurogenesis. Finally, cell transplantation studies show that Hh pathway activation is required cell autonomously. Our results provide insights into the generic programme of habenular neurogenesis that will serve as a guide for understanding how Nodal signalling modulates asymmetric habenular development.

Materials and Methods

Fish lines and developmental conditions

Embryos were raised and staged according to standard protocols [26]. The transgenic lines Tg(-8.4neurog1:GFP) and Tg(elavl3:EGFP), and the neurog1, smo and pax6b mutations have previously been described [27-31]. Embryos homozygous for the various mutations were obtained by inter-crossing heterozygous carriers; adults heterozygous for the different mutant alleles were identified by PCR genotyping of tail-clip genomic DNA. Embryos were fixed overnight at 4°C in 4% paraformaldehyde/1xPBS, after which they were dehydrated through an ethanol series and stored at −20°C until use. Fixed embryos for shha [32] and smo [33] mutant lines were kindly provided by Simon Hughes (King College London, UK)

Ethics statement

All animals were handled in a facility certified by the French Ministry of Agriculture (approval ID B-31-555-10) and in accordance with the guidelines from the European directive on the protection of animals used for scientific purposes (2010/63/UE), French Decret 2013–118. MR and PB have received an authorisation to experiment on vertebrates models (N° 311255556 and N° 311255553) from the ‘Direction Départementale de la Protection des Populations de la Haute-Garonne’. All anaesthesia and euthanasia procedures were performed in Tricaine Methanesulfonate (MS222) solutions as recommended for zebrafish (0,16mg/ml for anaesthesia, 0,30 mg/ml for euthanasia). All efforts were made to minimize the number of animals used and their suffering, according to the guiding principles from the Decret 2013–118.

Cyclopamine treatment

Dechorionated embryos were treated at 16, 18, 20 and 24 hpf with 100μM cyclopamine (Toronto Research Clinical) by diluting a 10 mM ethanol-based stock solution in E3 medium. Control embryos were treated simultaneously with an equal volume of ethanol diluted 1/100 in E3 medium. Embryos were incubated at 28.5°C in cyclopamine continuously beginning at indicated time points until they were collected for processing.

In situ hybridization and immunostaining

In situ hybridizations were performed as previously described [34]. Antisense DIG labelled probes for brn3a [17], cxcr4b [35], pax6a [36], neurog1 [37] and neurod4 [38] were generated using standard procedures. In situ hybridizations were revealed using BCIP and NBT (Roche) or Fast Red (Roche) as substrate. Immunohistochemical stainings were performed as previously described [39], using either anti-GFP (1/1000, Torrey Pines Biolabs) or anti-HuC/D (1/500, Molecular Probes); secondary antibodies used were Alexa 488 or Alexa 555-conjugated goat anti-rabbit IgG or goat anti-mouse IgG (1/1000, Molecular Probes). For nuclear staining, embryos were incubated in ToPro (1/1000, Molecular Probes) as previously described (25).

Antisense morpholino injection and Transplantation

For morpholino knock-downs, embryos were injected at the one cell stage with either two previously described morpholinos targeting the 5’ end of neurod4 [38] or a splice-blocking morpholino (GAGCACAGGTATTCTCCTCACCTGC) that targets the exon5/intron5 boundary of pax6a. Transplantation experiments were performed as previously described [39].

Image acquisition

Bright field pictures were taken on a Nikon eclipse 80i microscope. Confocal acquisitions were acquired using a Leica SP5 or SP8 and confocal stacks were analysed using ImageJ software. Images were manipulated using Photoshop (Adobe) software.

Results

Habenular neurogenesis requires the redundant activity of neurog1 and neurod4

Proneural genes of the atonal and achaete-scute families encode bHLH transcription factors that are key regulators of neurogenesis in both vertebrates and invertebrates. The zebrafish atonal homologue neurogenin1 (neurog1) is expressed in habenular progenitors [25,40]. To address whether Neurog1 controls habenular neurogenesis we examined the expression of well-described habenular markers in embryos homozygous for the neurog1 mutant allele [28]. Expression of the chemokine receptor cxcr4b, a marker of habenular progenitors [25], is largely unaffected in the absence of Neurog1 function (Fig 1A and 1B). Likewise, no differences were detected between wild type and neurog1 mutant siblings in the expression of the homeo-domain transcription factor brn3a, a marker of post-mitotic habenular neurons [17,25] (Fig 1E and 1F). Thus, as previously reported by Kuan at al, loss of Neurog1 function alone does not affect habenular development [41]. During development of the zebrafish cranial ganglia and olfactory system, Neurog1 acts redundantly with a second atonal-like proneural factor, Neurod4 [38,42]. To address if a similar situation exists during habenular neurogenesis, we injected neurod4 specific morpholinos into embryos from crosses between heterozygous neurog1 mutant carriers and examined the effect of the loss-of-function of both bHLH factors on the expression of habenular markers. As for the simple neurog1 mutant loss-of-function context, knock-down of Neurod4 alone had no effect on the expression of cxcr4b or brn3a (Fig 1C and 1G). In contrast, the expression of cxcr4b and brn3a was respectively absent or strongly reduced in embryos lacking the activity of both neurog1 and neurod4 (Fig 1D and 1H). We conclude that the redundant proneural activity of neurog1 and neurod4 is required for habenular neurogenesis.
Fig 1

Combined loss of Neurog1 and Neurod4 function disrupts habenular neurogenesis.

Whole-mount in situ hybridization against cxcr4b (A-D) or brn3a (F-H) showing the epithalamus of wild type (A,E), neurog1 mutant embryos (B,F), neurod4 morpholino injected embryos (C,G) or neurog1;neurod4 morphant embryos (D,H) at 36 (A-D) or 48 (E-H) hpf. The expression of cxcr4b and brn3a appears unaffected in neurod4 morpholino injected embryos (C, n = 13/13 and G, n = 14/15) as compared with the expression in wild type (A, n = 9/9 and E, n = 9/9); cxcr4b and brn3a expression is also unaffected in neurog1 mutant (B, n = 12/14 and F, n = 9/11) or only slightly decreased in few cases (respectively n = 2/14 and n = 2/11; data not shown). In contrast, the expression of both genes is either abrogated or strongly reduced in neurog1;neurod4 morphants (D, n = 16/16 and H, n = 12/14). Embryos are viewed dorsally with anterior up.

Combined loss of Neurog1 and Neurod4 function disrupts habenular neurogenesis.

Whole-mount in situ hybridization against cxcr4b (A-D) or brn3a (F-H) showing the epithalamus of wild type (A,E), neurog1 mutant embryos (B,F), neurod4 morpholino injected embryos (C,G) or neurog1;neurod4 morphant embryos (D,H) at 36 (A-D) or 48 (E-H) hpf. The expression of cxcr4b and brn3a appears unaffected in neurod4 morpholino injected embryos (C, n = 13/13 and G, n = 14/15) as compared with the expression in wild type (A, n = 9/9 and E, n = 9/9); cxcr4b and brn3a expression is also unaffected in neurog1 mutant (B, n = 12/14 and F, n = 9/11) or only slightly decreased in few cases (respectively n = 2/14 and n = 2/11; data not shown). In contrast, the expression of both genes is either abrogated or strongly reduced in neurog1;neurod4 morphants (D, n = 16/16 and H, n = 12/14). Embryos are viewed dorsally with anterior up.

Habenular neurogenesis requires Pax6a

Pax6 encodes a paired homeodomain transcription factor that acts in a concentration-dependent manner during region-specific differentiation of neural tissues [43]. The two zebrafish pax6 orthologues, pax6a and pax6b, are expressed in large, overlapping domains in the diencephalon [36,44] and have been implicated in aspects of diencephalon development [45]. We have previously shown that the zebrafish pax6 genes directly regulate neurog1 expression in the zebrafish diencephalon via a conserved cis-regulatory module located immediately upstream of the neurog1 coding region [46]; a similar regulatory paradigm exists between Pax6 and Neurog2 in the mouse telencephalon and spinal cord [47]. However, while simultaneous knock-down of the two pax6 orthologues affects the expression of neurog1, the consequences on habenular neurogenesis are not known in zebrafish [46]. To address this question, we injected pax6a morpholinos into embryos from crosses between heterozygous pax6b mutant carriers and examined the expression of early and late habenular markers. Homozygous pax6b mutant embryos display cxcr4b and brn3a expression in the habenulae largely indistinguishable from that of wild type siblings (Fig 2A, 2B, 2E and 2F). Somewhat surprisingly, on the other hand, morpholino knock-down of pax6a alone abrogated the expression of both markers (Fig 2C and 2G); pax6a morphant/pax6b mutant embryos behaved the same as pax6a morphants alone with respect to these markers (Fig 2D and 2H). These results suggest that while both pax genes appear to be required for the expression of neurog1 widely throughout the diencephalon, Pax6a but not Pax6b is needed for the expression domain of neurog1 driving habenular neurogenesis. A more precise analysis in the epithalamus shows that pax6a expression overlaps extensively with GFP from a Tg(neurog1:GFP) transgene prior to the appearance of habenular neurons (S1 Fig). Together with our previous work, this suggests that Pax6a regulation of neurog1 in this domain is direct [46].
Fig 2

Pax6a but not Pax6b are required for habenular neurogenesis.

Whole-mount in situ hybridization against cxcr4b (A-D) or brn3a (E-H) showing the epithalamus of wild type (A,E), pax6b mutant embryos (B,F), pax6a morpholino injected embryos (C,G) or pax6b;pax6a morphant embryos (D,H) at 36 (A-D) or 48 (E-H) hpf. Whereas the expression of cxcr4b and brn3a appears unaffected in pax6b mutant embryos (B, n = 6/6 and F, n = 5/5) compared to the expression in wild type controls (A and E, n = 5/5), expression of both genes is abrogated after injection of morpholinos against pax6a in either wild type (C, n = 4/6 and G, n = 6/8) or pax6b embryos (D and H, n = 4/4). Embryos are viewed dorsally with anterior up.

Pax6a but not Pax6b are required for habenular neurogenesis.

Whole-mount in situ hybridization against cxcr4b (A-D) or brn3a (E-H) showing the epithalamus of wild type (A,E), pax6b mutant embryos (B,F), pax6a morpholino injected embryos (C,G) or pax6b;pax6a morphant embryos (D,H) at 36 (A-D) or 48 (E-H) hpf. Whereas the expression of cxcr4b and brn3a appears unaffected in pax6b mutant embryos (B, n = 6/6 and F, n = 5/5) compared to the expression in wild type controls (A and E, n = 5/5), expression of both genes is abrogated after injection of morpholinos against pax6a in either wild type (C, n = 4/6 and G, n = 6/8) or pax6b embryos (D and H, n = 4/4). Embryos are viewed dorsally with anterior up. Scardigli and colleagues reported that while Pax6 directly regulates Neurog2 expression in the mouse spinal cord, Neurog2 feeds back onto Pax6 to maintain its expression [47,48]. To address whether similar feedback control is active during habenular neurogenesis in zebrafish, we assayed the expression of pax6a in neurog1;neurod4 morphant embryos. As shown in Fig 3, no change in the expression of pax6a was detected in the epithalamus of the neurog1;neurod4 morphant embryos (Fig 3A and 3A’ versus 3B and 3B’). To address whether habenular neurogenesis was affected in this double loss of function context, we analysed the expression of HuC/D in the epithalamus of the same neurog1;neurod4 morphant embryos; the RNA-binding protein HuC is a general marker of newly differentiated neurons that is expressed in the epithalamus in both habenular neurons and epiphysial projection neurons [25,49]. HuC/D was not detected at 36 hpf in the habenulae of neurog1;neurod4 morphant embryos, confirming a requirement of Neurog1 and Neurod4 for habenular neurogenesis (Fig 3A–3B’). Thus, our results suggest that there is no feedback control of neurog1 and neurod4 on pax6a in this system.
Fig 3

Expression of pax6a is unaffected in neurog1;neurod4 morphant embryos.

Confocal sections (A,B) or 10μm maximum projections (A’,B’) of the head of wild type (A; n = 6/6) or neurog1;neurod4 Mo injected embryos (B; n = 10/10) at 36 hpf after a whole-mount in situ hybridization against pax6a (red) and an immunostaining against HuC/D protein (green); cell nuclei staining (in grey) makes visible brain structures (A,B). As previously described, the neuronal marker HuC/D is expressed in the epithalamus, both in epiphyseal projection neurons (ep) and in habenular neurons (Hb, white brackets) located on either sides of the epiphysis. The expression of HuC/D is abrogated or strongly reduced in the habenular domain of neurog1;neurod4 morphant embryos, while it is still detected in the telencephalon (Tel), in the epiphysis and in neurons of the tectum (Tc) (B,B’). On the contrary, no change is seen in the expression of pax6a in the same region, suggesting that the expression of neurog1 and neurod4 does not regulate pax6a during habenular neurogenesis. Embryos are viewed dorsally with anterior up. The expression of HuC/D and pax6a in neurog1 mutants (n = 5/5) and neurod4 Mo injected embryos (n = 11/11) was similar to that observed in the non-injected controls (data not shown).

Expression of pax6a is unaffected in neurog1;neurod4 morphant embryos.

Confocal sections (A,B) or 10μm maximum projections (A’,B’) of the head of wild type (A; n = 6/6) or neurog1;neurod4 Mo injected embryos (B; n = 10/10) at 36 hpf after a whole-mount in situ hybridization against pax6a (red) and an immunostaining against HuC/D protein (green); cell nuclei staining (in grey) makes visible brain structures (A,B). As previously described, the neuronal marker HuC/D is expressed in the epithalamus, both in epiphyseal projection neurons (ep) and in habenular neurons (Hb, white brackets) located on either sides of the epiphysis. The expression of HuC/D is abrogated or strongly reduced in the habenular domain of neurog1;neurod4 morphant embryos, while it is still detected in the telencephalon (Tel), in the epiphysis and in neurons of the tectum (Tc) (B,B’). On the contrary, no change is seen in the expression of pax6a in the same region, suggesting that the expression of neurog1 and neurod4 does not regulate pax6a during habenular neurogenesis. Embryos are viewed dorsally with anterior up. The expression of HuC/D and pax6a in neurog1 mutants (n = 5/5) and neurod4 Mo injected embryos (n = 11/11) was similar to that observed in the non-injected controls (data not shown).

Hedgehog signalling is required for habenular neurogenesis

Next, we screened existing genetic and pharmacological tools to identify signalling cascades that might regulate habenular neurogenesis upstream of the Pax6a>Neurog1/Neurod4 cassette. Interestingly, whereas the cxcr4b is robustly expressed in habenular progenitors of wild type embryos at 36 hours post-fertilisation (hpf) (Fig 4A and 4A’), cxcr4b expression is absent in the epithalamus of embryos mutant for smoothened, a gene encoding a non-classical G protein-coupled receptor required for Hedgehog (Hh) signalling (smo; [28]; Fig 4B and 4B’); residual expression of cxcr4b in retinal ganglion cells of smo mutant embryos suggests that the lack of expression in the habenulae is due to a lack of habenular progenitors and not because cxcr4b is a direct target of Hh signalling. Similarly, the expression of brn3a is absent from the epithalamus of smo mutant embryos at 48 hpf but is still expressed in the developing tectum (Fig 4C–4D’).
Fig 4

Habenular neurogenesis requires hedgehog signalling.

Whole-mount in situ hybridization against cxcr4b at 36 hpf (A-B’) or brn3a at 48 hpf (C-D’) showing heads (A-D) or the epithalamus (A’-D’) of wild type (A,A’,C,C’) or smo embryos (B,B’,D,D’). The expression of cxcr4b and brn3a is detected in the habenulae of all the wild type siblings (n = 21/21 and n = 6/6, respectively). While residual expression of cxcr4b in the eyes (*) and brn3a in the tectum (blue bracket) is visible in smo embryos, the expression of both genes is abrogated in the habenular nuclei (Black bracket, B,B’, n = 12/13 and D,D’, n = 6/6). Embryos are viewed dorsally with anterior up.

Habenular neurogenesis requires hedgehog signalling.

Whole-mount in situ hybridization against cxcr4b at 36 hpf (A-B’) or brn3a at 48 hpf (C-D’) showing heads (A-D) or the epithalamus (A’-D’) of wild type (A,A’,C,C’) or smo embryos (B,B’,D,D’). The expression of cxcr4b and brn3a is detected in the habenulae of all the wild type siblings (n = 21/21 and n = 6/6, respectively). While residual expression of cxcr4b in the eyes (*) and brn3a in the tectum (blue bracket) is visible in smo embryos, the expression of both genes is abrogated in the habenular nuclei (Black bracket, B,B’, n = 12/13 and D,D’, n = 6/6). Embryos are viewed dorsally with anterior up. To further support our data showing a requirement for Hedgehog signalling in habenular neurogenesis, we analysed the expression of the habenular markers cxcr4b and brn3a in embryos mutant for sonic hedgehog (shha/sonic-you); shha is expressed in the Zona Limitans Intrathelamica (ZLI) where it is required for the regionalisation of the Thalamus [50,51]. Although the phenotype obtained in shha mutant embryos is not as severe as that observed in smo mutant embryos, we found that the expression of both cxcr4b and brn3a are strongly reduced in this context. These data suggest that Shha is the main Hedgehog ligand involved in habenular neurogenesis (S2 Fig). Birthdating experiments have shown that habenular neurons begin to leave the cell cycle around the end of the first day of development [24]. However, it is not clear from our results with smo and shha mutant embryos at which stage the Hh pathway is required for habenular neurogenesis. To determine the time window during which Hh signalling is required, we used cyclopamine to inhibit Hh signalling starting at various developmental stages up to 24 hpf [52,53]. Embryos treated with ethanol from 16 hpf display robust expression of cxcr4b and brn3a in the habenulae at 36 and 48 hpf, respectively (Fig 5A and 5E). Conversely, cyclopamine treatment from the same stage abolishes the expression of both markers (Fig 5A’ and 5E’); HuC/D labelling was also lost in the habenulae of embryos treated with cyclopamine from 16 hpf but not affected in the epiphysis, in the telencephalon or in neurons in the tectum (Fig 6B–6F’). Blocking Hh signalling from 18 hpf still profoundly affects the habenular expression of cxcr4b and brn3a, although the effect is not as penetrant as upon treatment at the earlier stage with residual expression of the two markers being detected in some embryos (Fig 5B and 5F versus 5B’ and 5F’). Blocking Hh signalling with cyclopamine from 20 hpf and 24 hpf has a far less pronounced effect but still results in a decrease in the expression of cxcr4b or brn3a in the epithalamus (Fig 5C and 5G versus 5C’ and 5G’ and 5D and 5H versus 5D’ and 5H’). Taken together, our results indicate that Hh signalling acts as an obligate regulator of habenular neurogenesis and that the pathway is required continuously starting from between 16–18 hpf until at least 24 hpf for the production of habenular neurons.
Fig 5

Hedgehog signalling is required continuously from 16hpf for correct habenular development.

Whole-mount in situ hybridization against cxcr4b (A-D’) or brn3a (E-H’) showing the epithalamus at 36 or 48 hpf, respectively, in control treated (A-D, E-H) or cyclopamine treated embryos from various stages (A’-D’, E’-H’). Cyclopamine treatment from 16 hpf completely abolishes the expression of cxcr4b (n = 19/21) and brn3a (n = 22/22) in habenular progenitors and neurons respectively. Treatment from 18 hpf results in either a similar abrogation of cxcr4b and brn3a expression (respectively n = 6/11 and n = 6/8) or in a strong decrease (n = 5/11 and n = 2/8, representative pictures in B’ and F’). The expression of cxcr4b and brn3a recovers if embryos are treated at progressively later stages. Although their expression level is significantly reduced, cxcr4b and brn3a are expressed in the habenulae of about half of the embryos treated with cyclopamine from 20 hpf (respectively C’, n = 20/37 and G’, n = 12/22) and in most of the embryos treated from 24 hpf (D’, n = 37/42 and H’, n = 28/34); in the remaining embryos, the expression was not detected (C’, n = 17/37, G’, n = 10/22, D’, n = 5/42 and H’, n = 6/34). For ethanol treated control embryos, the following numbers of embryos were examined: n = 19 (A), n = 3 (B), n = 10 (C), n = 9 (D), n = 19 (E), n = 5 (F), n = 8 (G), n = 7 (H). Embryos are viewed dorsally with anterior up.

Fig 6

Hh signalling is required for the expression of pax6a, neurog1 and neurod4 in the Habenular nuclei.

Confocal sections (A-F) or 15μm maximum projections (A’-F’) showing the heads of control treated embryos (A-A’, n = 9; C-C’, n = 6; E-E’, n = 6) or those treated from 16 hpf with cyclopamine (B-B’, n = 10, D-D’, n = 7, F-F’, n = 6) after a whole-mount in situ hybridization against pax6a (A,A’,B,B’), neurog1 (C,C’,D,D’) and neurod4 (E,E’,F,F’) (red) and immunostaining against HuC/D protein (green); cell nuclei staining (grey) makes visible brain structures in the confocal sections (A-F). The overall morphology of the head appears normal in cyclopamine treated embryos and the expression of HuC/D does not appear to be affected in the telencephalon (Tel), in the epiphysis (*) nor in the tectum (Tc). In contrast, HuC/D expression is absent or strongly reduced in the habenular domain (Hb, white brackets) of cyclopamine treated embryos. The expression of pax6a is strongly reduced (B-B’, n = 10/10) in the habenular domain (Hb, white brackets) of cyclopamine treated embryos. The expression of neurog1 and neurod4 is also abrogated specifically in the habenular domain of cyclopamine treated embryos (D-D’, n = 7/7, F-F’, n = 6/6). All embryos are at 36 hpf. Embryos are viewed dorsally with anterior up.

Hedgehog signalling is required continuously from 16hpf for correct habenular development.

Whole-mount in situ hybridization against cxcr4b (A-D’) or brn3a (E-H’) showing the epithalamus at 36 or 48 hpf, respectively, in control treated (A-D, E-H) or cyclopamine treated embryos from various stages (A’-D’, E’-H’). Cyclopamine treatment from 16 hpf completely abolishes the expression of cxcr4b (n = 19/21) and brn3a (n = 22/22) in habenular progenitors and neurons respectively. Treatment from 18 hpf results in either a similar abrogation of cxcr4b and brn3a expression (respectively n = 6/11 and n = 6/8) or in a strong decrease (n = 5/11 and n = 2/8, representative pictures in B’ and F’). The expression of cxcr4b and brn3a recovers if embryos are treated at progressively later stages. Although their expression level is significantly reduced, cxcr4b and brn3a are expressed in the habenulae of about half of the embryos treated with cyclopamine from 20 hpf (respectively C’, n = 20/37 and G’, n = 12/22) and in most of the embryos treated from 24 hpf (D’, n = 37/42 and H’, n = 28/34); in the remaining embryos, the expression was not detected (C’, n = 17/37, G’, n = 10/22, D’, n = 5/42 and H’, n = 6/34). For ethanol treated control embryos, the following numbers of embryos were examined: n = 19 (A), n = 3 (B), n = 10 (C), n = 9 (D), n = 19 (E), n = 5 (F), n = 8 (G), n = 7 (H). Embryos are viewed dorsally with anterior up.

Hh signalling is required for the expression of pax6a, neurog1 and neurod4 in the Habenular nuclei.

Confocal sections (A-F) or 15μm maximum projections (A’-F’) showing the heads of control treated embryos (A-A’, n = 9; C-C’, n = 6; E-E’, n = 6) or those treated from 16 hpf with cyclopamine (B-B’, n = 10, D-D’, n = 7, F-F’, n = 6) after a whole-mount in situ hybridization against pax6a (A,A’,B,B’), neurog1 (C,C’,D,D’) and neurod4 (E,E’,F,F’) (red) and immunostaining against HuC/D protein (green); cell nuclei staining (grey) makes visible brain structures in the confocal sections (A-F). The overall morphology of the head appears normal in cyclopamine treated embryos and the expression of HuC/D does not appear to be affected in the telencephalon (Tel), in the epiphysis (*) nor in the tectum (Tc). In contrast, HuC/D expression is absent or strongly reduced in the habenular domain (Hb, white brackets) of cyclopamine treated embryos. The expression of pax6a is strongly reduced (B-B’, n = 10/10) in the habenular domain (Hb, white brackets) of cyclopamine treated embryos. The expression of neurog1 and neurod4 is also abrogated specifically in the habenular domain of cyclopamine treated embryos (D-D’, n = 7/7, F-F’, n = 6/6). All embryos are at 36 hpf. Embryos are viewed dorsally with anterior up. To determine if Hh signalling lies upstream of the Pax6a>Neurog1/Neurod4 cassette we have described above, embryos were treated with cyclopamine from 16 hpf and the expression of pax6a, neurog1 and neurod4 was analysed by in situ hybridisation. Comparing lateral views of control and cyclopamine treated embryos shows that the expression of pax6a, neurog1 and neurod4 appear specifically affected in the dorsal part of the diencephalon (S3 Fig). To understand better the changes induced by cyclopamine treatment, we analysed the expression of these three same genes (pax6a, neurog1 and neurod4) together with the expression of HuC/D protein at the level of the epithalamus by confocal imaging. As shown in Fig 6, while the expression of pax6a is globally similar between control and cyclopamine treated embryos in the telencephalon or the epiphysis, expression in the habenular territory is strongly reduced when Hh signalling is abrogated (Fig 6A and 6A’ versus 6B and 6B’). Staining for cell nuclei indicate that the size of the prospective habenulae is significantly decreased in cyclopamine treated embryos suggesting that the loss of pax6a expression in the dorsal epithalamus is partly due to reduced tissue size (Fig 6A–6F). Nonetheless, the residual habenular progenitors also display decreased pax6a expression. Similarly, the expression of the two bHLH proneural genes, neurog1 and neurod4, is also severely affected in the epithalamus (Fig 6C–6F versus 6C’–6F’). Together these results suggest that a Hh, Pax6a, Neurog1/Neurod4 cascade is required for habenular neurogenesis.

Hedgehog signalling is required cell autonomously for habenular neurogenesis

The marker studies presented here indicate that Hh signalling is required for the generation of habenular progenitors and post-mitotic habenular neurons. However, it is not clear if the reception of Hh is autonomously required in this process. To address this question we created mosaic embryos containing clones of cells unable to respond to Hh signalling. For this, cells from rhodamine-dextran loaded embryos produced by crosses between identified smo heterozygotes carrying the Tg(huC:GFP) were transplanted into wild type hosts; the transgene Tg(huC:GFP) recapitulates the expression of the endogenous huC gene in the epithalamus [25,31]. Both donor and host embryos were then grown to 48 hpf at which stage donors were genotyped and hosts were fixed for analysis. As expected, cells transplanted from wild type or smo heterozygous embryos were able to integrate into the epithalamus, being found in either the habenulae or epiphysis with an approximately equal frequency (Fig 7A and 7C). Furthermore, transplanted cells detected in the habenula expressed GFP from the Tg(huC:GFP) transgene indicating that they had become post-mitotic habenular neurons (Fig 7A). Cells incorporated into the epiphysis also expressed GFP if they differentiated as projection neurons but remained GFP-negative if they developed as photoreceptors (data not shown; [49]). Conversely, while cells transplanted from homozygous smo mutant embryos were capable of becoming epiphysial projection neurons, they were systematically excluded from becoming habenular neurons (Fig 7B and 7C). We conclude that while Hh signalling does not appear to be required for projection neuron development in the epiphysis, activation of the Hh pathway is required in an autonomous fashion for correct habenular neurogenesis.
Fig 7

Autonomous reception of Hedgehog signals is required for habenular neurogenesis.

Confocal sections through the epithalamus of wild type host embryos containing transplanted cells from wild type (A) or smo donors (B). Donors carried the Tg(huC:GFP), which appears in white, and transplanted cells appear in red; red cells that are not white in B are epiphysial photoreceptors (white arrow). Host embryos were immunolabelled with an anti-HuC/D antibody (in blue) that highlights the habenular neurons (Hb) and projection neurons in the epiphysis (ep). Embryos are viewed dorsally with anterior up. A histogram indicates the number of embryos incorporating cells from wild type or smo mutant donors into either the habenulae or epiphysis (C). Unlike cells transplanted from wild type donors (white arrowheads in A), those from homozygous smo mutants are systematically excluded from becoming habenular neurons; transplanted cells from either donor can become epiphysial projection neurons.

Autonomous reception of Hedgehog signals is required for habenular neurogenesis.

Confocal sections through the epithalamus of wild type host embryos containing transplanted cells from wild type (A) or smo donors (B). Donors carried the Tg(huC:GFP), which appears in white, and transplanted cells appear in red; red cells that are not white in B are epiphysial photoreceptors (white arrow). Host embryos were immunolabelled with an anti-HuC/D antibody (in blue) that highlights the habenular neurons (Hb) and projection neurons in the epiphysis (ep). Embryos are viewed dorsally with anterior up. A histogram indicates the number of embryos incorporating cells from wild type or smo mutant donors into either the habenulae or epiphysis (C). Unlike cells transplanted from wild type donors (white arrowheads in A), those from homozygous smo mutants are systematically excluded from becoming habenular neurons; transplanted cells from either donor can become epiphysial projection neurons.

Discussion

Habenular nuclei act as a major relay component of a conserved conduction system between the forebrain and midbrain, and have been implicated in modulating different behaviours in a variety of animal models. However, in contrast to others structures in the diencephalon, the development of the habenulae and the mechanisms involved in the generation and differentiation of habenular neural progenitors have not been studied in detail. Here, we present the characterisation of a cassette of transcription factors, Pax6a/Neurog1/NeuroD4, that is required for habenular neurogenesis. We show that Hedgehog (Hh) signalling is required upstream of the expression of Pax6a, which is itself necessary for the expression of a pair of proneural bHLH genes. Pharmacological inhibition of the Hh pathway from 16 hpf results in the complete loss of habenular neurons, and our data show that Hh signalling is required continuously at least until 24h for the specification of dorsal habenular neuronal progenitors. Finally, cell-transplantation experiments indicate that Hh is required autonomously for the generation of habenular neurons.

Hh signalling in the development of the diencephalon

The developing diencephalon is composed of three so-called prosomeres that give rise to the prethalamus rostrally (p3), the thalamus and epithalamus (p2) and the pretectum (p1) caudally [54]. Between the p3 and p2 region is a transverse domain, the zona limitans intrathalamica (ZLI), that expresses Hh signals and acts as an organiser for diencephalon development and regionalisation (for review, see [55,56]). Hedgehog signalling from this region promotes the robust expression of regionally specific genes on both sides of the ZLI that establish the molecular identity of both the pre-patterned prethalamus and thalamus [50,51]. In contrast to its well-documented role in prethalamus and thalamus, the function of Hh signalling in the development of the most dorsal part of the p2 prosomere, the epithalamus, has been largely neglected. In a study that addressed the role of Sonic hedghog (Shh) in the mouse thalamus, no significant defects in habenular morphology were reported in Shh mutants (Fig 4 in [57]). Similarly, Vue and colleagues did not report any alterations in the epithalamus after reduction of Hh signalling although they found that increased Hh signalling in the diencephalon induces an expansion of markers for the thalamic progenitor domain at the expense of some markers for the pretectum and habenula [58]. More recently, two studies proposed that enhanced Shh signalling in the ZLI might account for the diencephalic defects observed in Pax6 mutant embryos [45,59]. Chatterjee and colleagues reported an increase in the expression of the pineal marker otx5 in the absence of Hh signalling in zebrafish embryos [45]. The authors also analysed the expression of cxcr4b in the epithalamus but it is not clear, however, whether the changes detected concern the habenulae or the epiphysis (Fig 8 in [45]) as this gene is also expressed in epiphysial projection neurons at 28 hpf (S4 Fig). Altogether, our results from markers analysis and transplants experiments indicate that Hedgehog signalling is absolutely required in zebrafish for the development of the dorsal habenular nuclei but not for the specification of the epiphysis. Thus, Hh signalling seems to have differential roles within the epithalamus on the habenular and the epiphysis. Previous studies have suggested that Smoothened mediates Hh signalling from all zebrafish Hh signals [60]. A study showed that Shha/Sonic Hedgehog and Shhb/Twhh (Tiggy-winkle hedgehog) act redundantly during the specification of prethalamus identity while the induction of the thalamus seems to rely only on Shha [51]. Although cxcr4b and brn3a expression are strongly reduced in shha mutants, we found that both markers are still detected in this context, a phenotype weaker than that observed in smo mutant in which cxcr4b and brn3a expression are fully abolished in the habenulae. This result suggests that the requirement for hedgehog signalling during habenular neurogenesis mainly relies on Shha but might also involve the partially redundant activity of Shhb. Our results from cyclopamine treatment suggest that the Hh pathway acts early in the development of the habenulae. Indeed, cyclopamine treatment interferes with the production of the earliest habenular progenitors/neurons only if it is performed starting at 16 hpf; brn3+ neurons and cxcr4b+ progenitors are detected in only a few embryos treated from 18 hpf and in about half of embryos treated from 20 hpf. We previously described that the first HuC+ habenular neurons appear at 30 hpf and express cxcr4b from 28 hpf [25]. Thus, Hh signalling is required about 12 hours before the appearance of the first neurons in the dorsal habenula. From this result, one could suggest that Hh signalling plays an early role in patterning the epithalamus, being required to specify the territory from which habenular progenitors will emerge, for instance. The observed decrease in the global size of prospective habenular domain upon cyclopamine treatment (Fig 6) might support this hypothesis. However, the fact that Hh signalling is required continuously for the generation of habenular neurons suggests that Hh signalling is not only acting to pattern the diencephalon.

Hh signalling and Pax6 cross-regulation in the development of the diencephalon

The homeobox transcription factor Pax6 is expressed in a highly dynamic pattern in the anterior neural plate during development and this is consistent with a suggested requirement for this gene in different step of forebrain development [61]. Early studies in the mouse reported that Pax6 is required for normal development and regionalisation of the diencephalon [62,63]. Our previous work suggested that zebrafish Pax6a and Pax6b could act as pre-pattern genes in the diencephalon by defining a large domain in which other factors, such as the proneural factor Neurog1, would further specify sub-domains of neurogenesis [46]. Recently, mouse Pax6 has been shown to control the patterning of the diencephalon through the cell autonomous repression of Shh expression in the ZLI [59]. Similarly, Chatterjee et al showed that Pax6 positively regulates the size of the epithalamus through a spatio-temporal control of Shh expression in both mouse and zebrafish [45]; in the latter model, this function apparently involves the redundant action of both Pax6a and Pax6b. In the present study, we show that only one of the two zebrafish pax6 genes, pax6a, is required for habenular neurogenesis. Thus, although Pax6a and Pax6b are redundantly required upstream of Shh to restrict its expression in the ZLI, only Pax6a appears to be required downstream of Hh signalling to activate the expression of the proneural genes neurog1 and neuroD4. These results suggest that Pax6 is reiteratively used during habenular development and that the duplicated pax6 genes in zebrafish have acquired specific function. Whether Hh signalling positively regulates pax6a expression directly is difficult to address; our results only suggest that Hh signalling acts positively upstream of Pax6a expression. This contrasts with the negative control of Pax6 by Shh described in other developmental systems. For instance, Shh has been shown to negatively regulate Pax6 expression in the spinal cord [64]. In the chick diencephalon, however, Shh has been shown to control Pax6 expression in opposite ways on either side of the ZLI, as it is required for the maintenance of expression in the prethalamus but inhibits expression in the thalamus [50].

Links between Hedgehog and other signalling pathways during habenular neurogenesis

Whether Hh signalling interacts with other pathways known to be involved in habenular development is an open question. For instance, it has been shown that Fgf8 is required for the development of the habenulae in both mouse and zebrafish [65,66]. Furthermore, previous work has suggested cross-regulation between the Fgf and Shh pathways in mouse [67] and zebrafish [68]; in contrast, Martinez-Ferre et al. found no alteration in SHH expression in the ZLI of FGF8 mouse mutants [65]. Wnt signalling has also recently been implicated in the development of the dorsal habenular nuclei [41,69]. Mutations in wntless, a conserved gene involved in the transport of Wnt ligands, lead to a strong reduction in the size of the dorsal habenulae [41]. This defect correlates with a reduction in the epithalamic expression of neurog1 and in the pool of cxcr4b expressing habenular progenitors; the effect of the wls mutation on the expression of pax6a is subtle at best, suggesting that Wls acts downstream of or in parallel with Pax6a to control neurog1 expression [41]. Interestingly, no change in the expression of several targets of Hedgehog signalling (oligo2 and nkx2.2) or fgf8 is detected in wls mutants, suggesting that these pathways lie upstream of Wnt signalling in this context. Further investigation will be necessary to address specifically how the Hedgehog, Fgf and Wntless-dependant Wnt pathways act during habenular development.

Asymmetric habenular neurogenesis

The habenulae have emerged as a model to understand how left-right (LR) asymmetry develops in the brain. We have previously shown that Nodal signalling biases the timing of habenular neurogenesis so that habenular progenitors and early born neurons appear initially on the left [25]. The functional relevance of the asymmetry in the pool of early born habenular neurons remains unclear as robust asymmetry of molecular markers and connectivity is still detected in the habenulae when Nodal is absent or bilateral, although the orientation of the asymmetry is randomised [70,71]. Nonetheless, this Nodal-dependant asymmetry in neurogenesis might have a subtle and as yet unrecognised impact on habenular asymmetry. For instance, the early asymmetric neurogenesis could partly contribute to the residual asymmetry in habenular projection to the IPN that remains after parapineal ablation in zebrafish embryos [18,19]. A recent study suggests that Nodal mediated asymmetric neurogenesis in zebrafish could be a vestige of an ancestral role of Nodal in driving habenular asymmetry in early vertebrates [72]. Indeed, in the catshark and lamprey, two species that either lack a parapineal or display a non-lateralised parapineal respectively, habenular asymmetry is conserved and develops solely through a Nodal-dependant mechanism. Thus, understanding how Nodal drives asymmetry in the timing of habenular neurogenesis in zebrafish is important as it might reveal mechanisms by which habenular asymmetry is established in early vertebrates. How the Nodal pathway imposes an asymmetry in the timing of habenular neurogenesis is not known yet. In the light of our results, we can speculate that this function of Nodal could involve modulation of Hh signalling. For instance, it is known that in the neural tube both the concentration and the duration of Hh signalling can be integrated by neural progenitors to promote different neural fates [73]. It is possible, therefore, that left-sided Nodal signalling in the epithalamus might result in progenitors of the left and right habenular neurons being exposed to slightly different concentration of Hh signals or for a different length of time, which could trigger a subtle heterochrony in their differentiation. Addressing this possibility will require investigating left and right differences in expression of endogenous read-outs or reporter transgenes for the Hh pathway over time. Alternatively, Nodal could indirectly affect the response of left habenular progenitors to Hh signals through the modulation of others signalling pathway. One such candidate is the Notch pathway that is known to potentiate Hh responsiveness in neural progenitors [74,75]. Other putative targets of the Nodal pathway could be the Fgf or Wntless-dependant Wnt pathways as these have also been implicated in the development of the dorsal habenulae, as mentioned above. A better understanding of which epithalamic cells receive Nodal signals and what are the Nodal pathway targets genes involved should help address how Nodal signalling biases the genetic programme of early neurogenesis that we describe here.

Ventral versus dorsal habenula

The habenular nuclei are composed of a ventral and a dorsal domain that are homologous to the medial and lateral sub-domains of mammals [16]. In our study, we show a requirement for Hh signalling upstream of a Pax6/Neurog1/NeuroD4 cassette for the generation of neural progenitors of the dorsal habenular. It remains to be addressed whether these actors are also required for the specification of the ventral habenula. However, as the ventral and a dorsal habenulae arise from different pool of progenitor at the thalamic-epithalamic border [16,69], it is clearly possible that their development requires a different combination of proneural genes and their upstream regulators.

Expression of pax6a and Tg(neurog1:GFP) co-localises in dorsal habenulae.

Confocal sections (A-C) of the head of a Tg(-8.4neurog1:GFP) embryo at 36 hpf after whole-mount immunostaining against GFP (A, green), in situ hybridization against pax6a (B, red) and Immunostaining against HuC/D (D, magenta); cell nuclei staining (in blue) makes brain structures visible in A, B, D, and merges are shown in C (A+B) and E (A+D). The Tg(-8.4neurog1:GFP) transgene is expressed in the epithalamus, both in epiphyseal (ep) and habenular neurons (Hb, white brackets), as well as other brain structures such as the telencephalon (Tel) and the tectum (Tc). The expression of Tg(-8.4neurog1:GFP) recapitulates endogenous neurog1 expression in habenular progenitors (described previously in [25]), although it can also be detected in newly-born HuC+ habenular neurons, probably due to persistence of the fluorescent reporter which acts as a short term lineage label (E). The expression of pax6a overlaps broadly with most of the Neurog1:GFP+ neurons in both the left and right habenulae (n = 15/15; C). (TIF) Click here for additional data file.

Sonic Hedgehog ligand (Shha) is required for habenular development.

Whole-mount in situ hybridization against cxcr4b at 36 hpf (A,A’,B,B’) or brn3a at 48 hpf (C,C’,D,D’) showing heads (A-D) or the epithalamus (A’-D’) of wild type (A,A’,C,C’) or shha embryos (B,B’,D,D’). While the expression of cxcr4b and brn3a is detected in the habenulae of all the wild type siblings (n = 8 and n = 14 respectively), the expression of both genes is strongly reduced in the epithalamus of shha mutant embryos (B,B’, n = 12/13 and D,D’, n = 6/6). Embryos are viewed dorsally with anterior up. (TIF) Click here for additional data file.

Hh signalling is required for the expression of pax6a, neurog1 and neurod4 in the epithalamus.

Whole-mount in situ hybridization against pax6a (A,B), neurog1 (C,D) and neurod4 (E,F) showing the head of control treated embryos (A, n = 10; C, n = 12; E, n = 8) or those treated from 16 hpf with cyclopamine (B, n = 10; D, n = 13; F, n = 9) in a lateral view of embryonic heads; all embryos are at 36 hpf and shown with anterior to the left. The expression of pax6a, neurog1 and neurod4 appears perturbed in the most dorsal part of the diencephalon subdivision (black brackets), while their expression does not appear significantly changed more ventrally or in other brain regions, such as the telencephalon (show as a *). (TIF) Click here for additional data file.

Hedgehog signalling is not required for cxcr4b expression in epiphysial projection neurons.

Whole-mount in situ hybridization against cxcr4b at 28 hpf showing heads (A,B; lateral view) or the epithalamus (A’,B’; dorsal view with anterior up) of wild type (A,A’) or smo embryos (B,B’). At 28 hpf, cxcr4b is expressed on both side of the epithalamic midline (*) in epiphysial projection neurons in both wild type siblings (n = 9/9) and smo mutant embryos (n = 8/8). At this stage, cxcr4b is either only expressed in few left habenular neurons or not expressed yet in the habenulae. This expression could be detected in some wild type siblings (A’, black brackets, n = 3/9) but never in the habenulae of smo mutant embryos (B’, n = 8/8). (TIF) Click here for additional data file.
  75 in total

1.  Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons.

Authors:  H C Park; C H Kim; Y K Bae; S Y Yeo; S H Kim; S K Hong; J Shin; K W Yoo; M Hibi; T Hirano; N Miki; A B Chitnis; T L Huh
Journal:  Dev Biol       Date:  2000-11-15       Impact factor: 3.582

Review 2.  Expression patterns of homeobox and other putative regulatory genes in the embryonic mouse forebrain suggest a neuromeric organization.

Authors:  L Puelles; J L Rubenstein
Journal:  Trends Neurosci       Date:  1993-11       Impact factor: 13.837

3.  The habenula encodes negative motivational value associated with primary punishment in humans.

Authors:  Rebecca P Lawson; Ben Seymour; Eleanor Loh; Antoine Lutti; Raymond J Dolan; Peter Dayan; Nikolaus Weiskopf; Jonathan P Roiser
Journal:  Proc Natl Acad Sci U S A       Date:  2014-07-28       Impact factor: 11.205

4.  The habenula is crucial for experience-dependent modification of fear responses in zebrafish.

Authors:  Masakazu Agetsuma; Hidenori Aizawa; Tazu Aoki; Ryoko Nakayama; Mikako Takahoko; Midori Goto; Takayuki Sassa; Ryunosuke Amo; Toshiyuki Shiraki; Koichi Kawakami; Toshihiko Hosoya; Shin-ichi Higashijima; Hitoshi Okamoto
Journal:  Nat Neurosci       Date:  2010-10-10       Impact factor: 24.884

5.  Sonic hedgehog signaling controls thalamic progenitor identity and nuclei specification in mice.

Authors:  Tou Yia Vue; Krista Bluske; Amin Alishahi; Lin Lin Yang; Naoko Koyano-Nakagawa; Bennett Novitch; Yasushi Nakagawa
Journal:  J Neurosci       Date:  2009-04-08       Impact factor: 6.167

6.  Distinct roles of segregated transmission of the septo-habenular pathway in anxiety and fear.

Authors:  Takashi Yamaguchi; Teruko Danjo; Ira Pastan; Takatoshi Hikida; Shigetada Nakanishi
Journal:  Neuron       Date:  2013-04-18       Impact factor: 17.173

7.  Hedgehog signalling from the zona limitans intrathalamica orchestrates patterning of the zebrafish diencephalon.

Authors:  Steffen Scholpp; Olivia Wolf; Michael Brand; Andrew Lumsden
Journal:  Development       Date:  2006-02-01       Impact factor: 6.868

8.  Habenula circuit development: past, present, and future.

Authors:  Carlo A Beretta; Nicolas Dross; Jose A Guiterrez-Triana; Soojin Ryu; Matthias Carl
Journal:  Front Neurosci       Date:  2012-04-23       Impact factor: 4.677

9.  Notch activity modulates the responsiveness of neural progenitors to sonic hedgehog signaling.

Authors:  Jennifer H Kong; Linlin Yang; Eric Dessaud; Katherine Chuang; Destaye M Moore; Rajat Rohatgi; James Briscoe; Bennett G Novitch
Journal:  Dev Cell       Date:  2015-04-30       Impact factor: 12.270

10.  The teratogenic Veratrum alkaloid cyclopamine inhibits sonic hedgehog signal transduction.

Authors:  J P Incardona; W Gaffield; R P Kapur; H Roelink
Journal:  Development       Date:  1998-09       Impact factor: 6.868

View more
  6 in total

1.  Convergence of signaling pathways underlying habenular formation and axonal outgrowth in zebrafish.

Authors:  Sara Roberson; Marnie E Halpern
Journal:  Development       Date:  2017-06-15       Impact factor: 6.868

2.  Behavioral alterations of zebrafish larvae after early embryonic exposure to ketamine.

Authors:  Luís M Félix; Luís M Antunes; Ana M Coimbra; Ana M Valentim
Journal:  Psychopharmacology (Berl)       Date:  2016-12-08       Impact factor: 4.530

Review 3.  Development and connectivity of the habenular nuclei.

Authors:  Sara Roberson; Marnie E Halpern
Journal:  Semin Cell Dev Biol       Date:  2017-11-06       Impact factor: 7.727

4.  Generation of a Triple-Transgenic Zebrafish Line for Assessment of Developmental Neurotoxicity during Neuronal Differentiation.

Authors:  Junko Koiwa; Takashi Shiromizu; Yuka Adachi; Makoto Ikejiri; Kaname Nakatani; Toshio Tanaka; Yuhei Nishimura
Journal:  Pharmaceuticals (Basel)       Date:  2019-09-24

5.  The Role of Neurod Genes in Brain Development, Function, and Disease.

Authors:  Svetlana Tutukova; Victor Tarabykin; Luis R Hernandez-Miranda
Journal:  Front Mol Neurosci       Date:  2021-06-09       Impact factor: 5.639

Review 6.  Transcription Factors of the bHLH Family Delineate Vertebrate Landmarks in the Nervous System of a Simple Chordate.

Authors:  Lenny J Negrón-Piñeiro; Yushi Wu; Anna Di Gregorio
Journal:  Genes (Basel)       Date:  2020-10-26       Impact factor: 4.096

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.