Xichao Zhou1,2, Xiuliang Dai2, Xuan Wu2, Ji Ji2,3, Andrew Karaplis4, David Goltzman4, Xiangjiao Yang4,5, Dengshun Miao2. 1. Department of Orthopedics, The First Affiliated Hospital of Soochow University, Suzhou, China. 2. The State Key Laboratory of Reproductive Medicine, the Research Center for Bone and Stem Cells, Department of Anatomy, Histology and Embryology, Nanjing Medical University, Nanjing, China. 3. Department of Fundamentals of Nursing, School of Nursing, Nanjing Medical University, Nanjing, China. 4. The Department of Medicine, McGill University, Montreal, Canada. 5. Rosalind &Morris Goodman Cancer Research Center, Department of Biochemistry, McGill University, Montreal, Quebec, Canada.
Abstract
To investigate whether overexpression of Bmi1 in lymphocytes can stimulate skeletogenesis by improving the osteogenic microenvironment, we examined the skeletal phenotype of EμBmi1 transgenic mice with overexpression of Bmi1 in lymphocytes. The size of the skeleton, trabecular bone volume and osteoblast number, indices of proliferation and differentiation of bone marrow mesenchymal stem cells (BM-MSCs) were increased significantly, ROS levels were reduced and antioxidative capacity was enhanced in EμBmi1 mice compared to WT mice. In PTHrP1-84 knockin (Pthrp(KI/KI)) mice, the expression levels of Bmi1 are reduced and potentially can mediate the premature osteoporosis observed. We therefore generated a Pthrp(KI/KI) mice overexpressing Bmi1 in lymphocytes and compared them with Pthrp(KI/KI) and WT littermates. Overexpression of Bmi1 in Pthrp(KI/KI) mice resulted in a longer lifespan, increased body weight and improvement in skeletal growth and parameters of osteoblastic bone formation with reduced ROS levels and DNA damage response parameters. Our results demonstrate that overexpression of Bmi1 in lymphocytes can stimulate osteogenesis in vivo and partially rescue defects in skeletal growth and osteogenesis in Pthrp(KI/KI) mice. These studies therefore indicate that overexpression of Bmi1 in lymphocytes can stimulate skeletogenesis by inhibiting oxidative stress and improving the osteogenic microenvironment.
To investigate whether overexpression of Bmi1 in lymphocytes can stimulate skeletogenesis by improving the osteogenic microenvironment, we examined the skeletal phenotype of EμBmi1transgenic mice with overexpression of Bmi1 in lymphocytes. The size of the skeleton, trabecular bone volume and osteoblast number, indices of proliferation and differentiation of bone marrow mesenchymal stem cells (BM-MSCs) were increased significantly, ROS levels were reduced and antioxidative capacity was enhanced in EμBmi1mice compared to WT mice. In PTHrP1-84 knockin (Pthrp(KI/KI)) mice, the expression levels of Bmi1 are reduced and potentially can mediate the premature osteoporosis observed. We therefore generated a Pthrp(KI/KI) mice overexpressing Bmi1 in lymphocytes and compared them with Pthrp(KI/KI) and WT littermates. Overexpression of Bmi1 in Pthrp(KI/KI) mice resulted in a longer lifespan, increased body weight and improvement in skeletal growth and parameters of osteoblastic bone formation with reduced ROS levels and DNA damage response parameters. Our results demonstrate that overexpression of Bmi1 in lymphocytes can stimulate osteogenesis in vivo and partially rescue defects in skeletal growth and osteogenesis in Pthrp(KI/KI) mice. These studies therefore indicate that overexpression of Bmi1 in lymphocytes can stimulate skeletogenesis by inhibiting oxidative stress and improving the osteogenic microenvironment.
Numerous studies have demonstrated that the endosteal bone marrow microenvironment and cells of the osteoblast lineage play profound roles, in promoting normal hematopoietic stem and progenitor cell function and in malignancy1, and a number of cellular and molecular components of the hematopoietic stem cell microenvironment or niche have been identified1. In addition, a reciprocal interaction of osteogenic cells and hematopoietic cells has been proposed, in which hematopoietic stem cells (HSCs) also regulate bone marrow mesenchymal stem cell (BM-MSC) induction into osteoblasts thereby participating in the formation of the stem cell niche2. Additionally, BM-MSC-like cells regulate B and T cell lymphopoiesis and likely also myelopoiesis3. It remains unclear however whether hematopoietic cells regulate skeletogenesis in vivo by improving the osteogenic microenvironment.Bmi1 is a member of the PcG (Polycomb group) family of epigenetic regulators4. The Bmi1 locus was initially identified in two independent retroviral tagging screens for oncogenic loci collaborating with the c-Myc proto-oncogene in transgenic mice56. Ablation of the Bmi1 gene in mice leads to posterior transformation, neurological abnormalities, severe hematopoietic defects7 and premature osteoporosis8. At the cellular level, Bmi1 plays a key role in various cancer stem cells and is required for self-renewal and/or expansion of normal adult hematopoietic, neural, lung, mammary epithelial, and perhaps intestinal stem cells and bone marrow mesenchymal stem cells8910111213. From a molecular perspective, Bmi1 is an essential subunit of the PRC1 ubiquitin ligase important for silencing expression of Hox genes14 and negative cell-cycle regulators such as p16Ink4a and p19Arf 1516. These two cell-cycle regulators are encoded by overlapping transcripts from the gene located on chromosome 9p21, a region frequently deleted in humancancers. p16Ink4a inhibits interaction of cyclin D with cell cycle-dependent kinases 4/6 (CDK4/6) to maintain the Rb tumor suppressor in a hypophosphorylated state. This in turn promotes Rb interaction with E2F and represses transcription of genes required for G1-S transition, leading to cell-cycle arrest at G1. On the other hand, p19Arf acts through the p53tumor suppressor and regulates expression of genes involved in cell cycle progression, apoptosis and senescence. Bmi1 inhibits expression of both p16Ink4a and p19Arf to regulate tumor-suppressing functions of Rb and p53, respectively. Bmi1 also plays an important role in the regulation of oxidative stress, by reducing the levels of DNA double-strand breaks induced by oxidative stress and promoting DNA repair1718. Transgenic mice with specific-overexpression of Bmi1 in lymphocytes, neurons or glial cells displayed susceptibility to development of B cell and T-cell lymphomas, intermediate and anterior lobe pituitary tumors or medulloblastomas1920. Previous studies have demonstrated that overexpression of Bmi1 in lymphocytes results in anterior transformation of the axial skeleton along the entire antero-posterior (A-P) axis21, but with no change in the number of vertebrae. This phenotype is directly opposite to the posterior transformation which is found along the entire A-P axis of the axial skeleton in Bmi1 null mice7. Both phenotypes however exhibit variable penetrance, and it is unknown whether overexpression of Bmi1 in lymphocytes can stimulate appendicular bone development by improving the osteogenic microenvironment.Parathyroid hormone related peptide (PTHrP) was initially identified as a humoral factor in hypercalcemia of malignancy, a para-neoplastic syndrome characterized by hypercalcemia and hypophosphatemia2223. MousePTHrP contains 139 residues, with its N-terminal 34 residues homologous to parathyroid hormone (PTH). This PTH-like domain binds to a common PTH/PTHrP receptor (or type I PTH receptor) and stimulates bone formation and/or bone resorption, renal calcium reabsorption, renal phosphate excretion and increased renal production of 1,25 dihydroxyvitamin D. The remaining sequence of PTHrP shows no similarity to PTH and residues 87–107 form an authentic nuclear localization signal (NLS)24. Thus, in addition to its PTH-like endocrine, paracrine and autocrine actions through the type I PTH receptor, PTHrP is able to localize directly to the nucleus and exert biological activities independent of PTH. PTHrP is widely expressed in various tissues and influences diverse biological functions, including organ and tissue development; cell survival, migration, proliferation and differentiation; and calcium homeostasis222526. The NLS is important for PTHrP to stimulate cell proliferation and inhibit apoptosis in cultured cells242728. The region C-terminal to the NLS is indispensible for at least some of these activities29. To investigate the function of the nuclear localization of PTHrP in vivo, we generated a truncation mutant of PTHrP and characterized a PTHrP knock-in (PthrpKI/KI) mouse model that carries TGA at codon 85 and thus lacks the mid-region and C-terminal region from residues 85 onward, and expresses only PTHrP1–84. This mutant is defective in nuclear localization. The homozygous mice were slight smaller than wild-type littermates at birth but died by 2–3 weeks of age. The mice displayed characteristic premature aging phenotypes, including osteopenia, kyphosis, cachexia, decreased fat deposition, thin skin, and hyperkeratosis of the epidermis. Strikingly, we found a dramatic decrease of Bmi1 expression and nuclear localization in bone tissues and embryonic fibroblasts30. Other studies have shown that nuclear localization of Bmi1 is indispensable for its role in cell transformation and proliferation3132. In this study, we assessed whether overexpression of Bmi1 in lymphocytes can correct the premature aging phenotype and the osteoporotic phenotype in the appendicular skeleton of PthrpKI/KI mice.To examine this issue, we first analyzed the skeletal phenotype of EμBmi1transgenic mice with overexpression of Bmi1 in lymphocytes to determine whether overexpression of Bmi1 in lymphocytes can stimulate skeletal growth by improving the osteogenic microenvironment. We then crossed EμBmi1transgenic mice with PthrpKI/KI mice to generate a PthrpKI/KI mouse overexpressing Bmi1 and compared them with PthrpKI/KI and wild-type littermates to clarify whether overexpression of Bmi1 in lymphocytes can correct or improve premature aging and osteoporotic phenotypes occurring in PthrpKI/KI mice.
Results
Effect of Bmi1 overexpression in lymphocytes on appendicular bone turnover
Previous studies have demonstrated that overexpression of Bmi1 in lymphocytes results in transformation of the axial skeleton, however, it is unknown whether overexpression of Bmi1 in lymphocytes affected bone turnover. At first we confirmed high expression levels of Bmi1 protein and mRNA in bone, spleen and thymus, but not in BM-MSCs in EμBmi1transgenic mice using Western blots and real-time RT-PCR (Fig. 1A,B). We also found that sizes and weights of appendicular bone, spleen and thymus were increased in 8-week-old EμBmi1transgenic mice relative to age-matched wild-type mice (Fig. 1C,D). We then examined the skeletal phenotype of EμBmi1transgenic mice by histology and histochemistry. The results showed that trabecular bone volume, osteoblast number and TRAP positive osteoclast surface in the appendicular skeleton were increased significantly in EμBmi1transgenic mice compared with their wild-type littermates (Fig. 1E–J). These results indicate that overexpression of Bmi1 in lymphocytes resulted in an augmentation of the appendicular bone volume with accelerated coupled bone turnover, but with increased osteoblastic bone formation exceeding increased osteoclastic bone resorption.
Figure 1
Effect of Bmi1 overexpression in lymphocytes on bone turnover.
(A) Western blots of bone, spleen and thymus tissue extracts from 8-week-old wild-type (WT) and EμBmi1 transgenic mice for expression of Bmi1. β-actin was used as loading control for Western blots. (B) Real-time RT-PCR of bone, spleen and thymus tissue extracts from 8-week-old mice for expression of Bmi1 mRNA. Messenger RNA expression assessed by real-time RT-PCR is calculated as a ratio relative to GAPDH, and expressed relative to WT mice. (C) Representative radiographs of the femurs and representative photographs of spleen and thymus from 8-week-old mice. (D) Weights of bone, spleen and thymus from 8-week-old mice. Representative micrographs of paraffin-embedded sections of tibiae stained (E) histochemically for total collagen, (G) with hematoxylin and eosin (H&E) and (I) histochemically for tartrate-resistant acid phosphatase (TRAP). Magnifications are x50 in E, x400 in G and I. (F) Trabecular bone volume (BV/TV, %), (H) Osteoblast number/tissue area (N.Ob/T.Ar, #/mm2), and (J) Osteoclast surface/bone surface (Oc.S/B.S, %) were determined in 8-week-old mice. Each value is the mean ± SEM of determinations in 8 mice of each genotype. *P < 0.05; **P < 0.01; ***P < 0.001 compared with WT mice.
Effect of Bmi1 overexpression in lymphocytes on the proliferation and differentiation of BM-MSCs
To determine whether increased osteoblastic bone formation in EμBmi1transgenic mice was associated with alterations of the proliferation and differentiation of BM-MSCs, we performed CFU-f assays. Cells were stained with methylene blue, cytochemically for ALP, and with alizarin red, to detect total CFU-f, ALP positive CFU-f (CFU-fap) and CFU-f with calcified nodules (CFU-fob), respectively. The results revealed that the percentages of total CFU-f, CFU-fap and CFU-fob areas were increased significantly in EμBmi1transgenic mice when compared with wild-type mice (Fig. 2A–D). We also examined alterations in expression of genes related to osteogenic cell differentiation. We found that gene expression levels of Runx2, ALP, type I collagen and osteocalcin were up-regulated significantly in osteogenic cells derived from EμBmi1transgenic mice (Fig. 2E). These results demonstrated that overexpression of Bmi1 in lymphocytes could promote the proliferation and osteogenic differentiation of BM-MSCs.
Figure 2
Effect of Bmi1 overexpression in lymphocytes on the proliferation and differentiation of BM-MSCs.
(A) Primary bone marrow cells from 8-week-old WT and EμBmi1 transgenic mice were cultured ex vivo in osteogenic differentiation medium for 14-21 days and resulting cultures were stained with methylene blue for total CFU-f, cytochemically for ALP to show ALP positive CFU-f (CFU-fap), and with alizarin red for calcified nodules (CFU-fob). (B) CFU-f areas, (C) CFU-fap areas and (D) CFU-fob areas relative to culture dish area. (E) Real-time RT-PCR of 14-day cultured cell extracts for the expression of Runx2, ALP, type I collagen (Col I) and osteocalcin (OCN). Messenger RNA expression assessed by real-time RT-PCR was calculated as a ratio relative to the GAPDH mRNA level and expressed relative to WT cultures. (F) BM-MSCs derived from wild-type mice were cultured with the conditioned media harvested from either bone marrow cells (WT-BM CM/EμBmi1- BM CM) or spleen cells (WT-Sp CM/EμBmi1-Sp CM) cultures derived from WT and EμBmi1 transgenic mice, and resulting cells were stained with methylene blue and cytochemically for ALP to show CFU-f and CFU-fap. (G) CFU-f areas, and (H) CFU-fap areas relative to culture dish area. *P < 0.05; **P < 0.01; ***P < 0.001 compared with WT cultures.
We then assessed whether the enhanced proliferation and osteogenic differentiation abilities of BM-MSCs from EμBmi1transgenic mice were associated with osteogenic molecules released by lymphocytes overexpressing Bmi1. For this purpose we harvested the conditioned media from either bone marrow (BM-CM) or spleen cell (Sp-CM) cultures derived from EμBmi1transgenic mice and wild-type mice, respectively, and added them to cultures of BM-MSCs derived from wild-type mice. We found that the percentages of total CFU-f and CFU-fap areas were increased significantly in the cultures with BM-CM or Sp-CM from EμBmi1transgenic mice compared with those from wild-type mice (Fig. 2F–J). These results suggest that lymphocytes with Bmi1 overexpression could release osteogenic molecules to stimulate the proliferation and osteogenic differentiation of BM-MSCs.
Effect of Bmi1 overexpression in lymphocytes on the expression of serum proteins in transgenic mice
To identify the proteins secreted by Bmi1 overexpression lymphocytes that promote osteoblastic bone formation and osteoclastic bone resorption, we conducted protein expression profiling, comparing the differences of serum protein expression levels between the wild-type and EμBmi1transgenic mice. Cluster analysis was performed and 5 proteins were identified which were significantly increased in the serum of EμBmi1transgenic mice compared with their wild-type littermates: these were follistatin (FLRG), chemokine (C-C motif) receptor 6 (CCR6), placental growth factor 2 (PlGF-2), insulin-like growth factor binding protein 7 (IGFBP-7) and interleukin-15 (IL-15) (Fig. 3A,B and Table 1). The mRNA expression levels of IGFBP-7, PlGF-2, CCR6, FLRG and IL-15 in thymus and spleen were also significantly up-regulated as demonstrated by real-time RT-PCR (Fig. 3C,D). Whether these factors function as osteogenic factors in the bone microenvironment is currently under investigation. We also detected 11 proteins that were significantly decreased in the serum of EμBmi1transgenic mice compared with their wild-type littermates (Fig. 3A,B and Table 1).
Figure 3
Effect of Bmi1 lymphocyte overexpression on the expression of serum proteins.
(A) Representative graphs of serum protein arrays of wild-type (WT) and EμBmi1 transgenic mice performed by Raybiotech Biotin Label-based Mouse Antibody Array. (B) Graph of cluster analysis. Real-time RT-PCR of (C) thymus and (D) spleen tissue extracts from 8-week-old WT and EμBmi1 transgenic mice for the expression of follistatin (FLRG), chemokine (C-C motif) receptor 6 (CCR6), placental growth factor 2 (PlGF-2), insulin-like growth factor binding protein 7 (IGFBP-7) and interleukin-15 (IL-15). Messenger RNA expression assessed by real-time RT-PCR was calculated as a ratio relative to the GAPDH mRNA level and expressed relative to WT mice. *P < 0.05; **P < 0.01 compared with WT mice.
Table 1
Serum proteins with significant differences between EμBmi1 and WT mice.
Effect of Bmi1 overexpression in lymphocytes on redox homeostasis
Previous studies have demonstrated that Bmi1 deficiency led to significant mitochondrial dysfunction accompanied by a sustained increase in ROS. To assess whether the enhanced proliferation and osteogenic differentiation abilities of BM-MSCs caused by Bmi1 overexpression in lymphocytes were associated with reduced ROS production or enhanced antioxidant capacity, we examined ROS levels, malondialdehyde (MDA) content, total antioxidant capacity (T-AOC) and superoxide dismutase (SOD) activity in different tissues from 8-week-old EμBmi1transgenic mice and their wild-type littermates. We found that ROS levels and MDA content were decreased significantly (Fig. 4A,B), whereas the T-AOC in thymus, spleen, and plasma and SOD activity in bone marrow cells, thymus, spleen, kidney tissues and plasma were increased significantly in EμBmi1transgenic mice compared with wild-type mice (Fig. 4C,D). These results demonstrated that overexpression of Bmi1 in lymphocytes could maintain a lower levels in ROS in different tissues by enhancing antioxidant capacity.
Figure 4
Effect of Bmi1 lymphocyte overexpression on redox homeostasis.
(A) ROS levels in bone marrow (BM), thymus, spleen and kidney from 8-week-old WT and EμBmi1 transgenic mice. Results of biochemical analysis of BM, thymus, spleen, kidney extracts and plasma from 8-week-old mice for (B) malonaldehyde (MDA) content, (C) total antioxidant capacity (T-AOC) and (D) superoxide dismutase (SOD) activity. Each value is the mean ± SEM of determinations in 5 mice of each genotype. *P < 0.05; **P < 0.01 compared with WT mice.
Overexpression of Bmi1 in lymphocytes extended the lifespan of Pthrp
mice and improved their growth
We then compared PthrpKI/KI mice overexpressing Bmi1 in lymphocytes (EμKI) with PthrpKI/KI mice and wild-type littermates. We first examined the effect of Bmi1 overexpression in lymphocytes on the lifespan and skeletal growth of PthrpKI/KI mice. Our results showed that the mean survival time of about 2 weeks of the PthrpKI/KI mice was prolonged to about 3 weeks in the EμKI mice (Fig. 5B). The body size and weight, and sizes of thymus and spleen were significantly increased in EμBmi1transgenic mice, but were reduced in both PthrpKI/KI and EμKI mice compared to their wild-type littermates; however they were increased significantly in EμKI mice compared to PthrpKI/KI mice (Fig. 5A–D). We also found that the length of long bones, the width of the cartilage growth plates and the percentage of Ki67 positive chondrocytes were clearly increased in EμBmi1transgenic mice, but were reduced significantly in both PthrpKI/KI and EμKI mice compared to wild-type mice; nevertheless these parameters were increased significantly in EμKI mice compared to PthrpKI/KI mice (Fig. 5E–J). These results demonstrated that overexpression of Bmi1 in lymphocytes can extend the lifespan of PthrpKI/KI mice and improved their growth including skeletal growth.
Figure 5
Bmi1 overexpression in lymphocytes extended the lifespan of Pthrp/KI mice and improved their growth.
(A) Whole-body view of 2-week-old WT, EμBmi1, PthrpKI/KI (KI) and EμKI mice. (B) Survival curves of 4 genotype mice. (C) Representative photographs of spleen and thymus from 2-week-old mice. (D) Body weight of 2-week-old mice. (E) Representative radiographs of the femurs from 2-week-old mice. (F) Femur length of 2-week-old mice. Representative micrographs from paraffin-embedded sections of tibias stained (G) with H&E and (H) immunohistochemically for Ki67. (I) The width of the cartilaginous growth plates. (J) The percentage of Ki67-positive chondrocytes relative to total chondrocytes. Magnification is x100 in G and x400 in H. Each value is the mean ± SEM of determinations in 5 mice of each group. *P < 0.05; **P < 0.01; ***P < 0.001 compared with WT mice. ##P < 0.01; ###P < 0.001 compared with KI mice.
Bmi1 overexpression in lymphocytes improved the premature osteoporosis of Pthrp
mice
To determine whether Bmi1 overexpression in lymphocytes could improve the premature osteoporosis of PthrpKI/KI mice, we examined the effect of Bmi1 overexpression in lymphocytes on bone volume and osteoblastic indices in PthrpKI/KI mice. BMD (Fig. 6A,C), trabecular, epiphyseal and cortical bone volumes (Fig. 6A,C–F), trabecular bone number (Fig. 6A,G), osteoblast numbers (Fig. 6I,J), and ALP (Fig. 6K,L), and type I collagen (Col I) positive areas (Fig. 6M,N) were increased significantly in EμBmi1transgenic mice, but were reduced significantly in both PthrpKI/KI and EμKI mice compared to wild-type mice; however these parameters were increased significantly in EμKI mice compared to PthrpKI/KI mice. We also examined the alterations in expression of genes related to osteoblastic differentiation. The alterations in the expression of transcripts for Runx2, ALP, type 1 collagen, and osteocalcin, as assessed by real-time RT-PCR, were consistent with the alterations observed by histomorphometry (Fig. 6Q). These results demonstrated that overexpression of Bmi1 in lymphocytes could improve the premature osteoporosis in PthrpKI/KI mice by increasing osteoblastic bone formation.
Figure 6
Bmi1 lymphocyte overexpression improved the premature osteoporosis of Pthrp/KI mice.
(A) Representative longitudinal and cross-sectional images of three-dimensional reconstructed distal ends of femurs and midshaft diaphyses from 2-week-old WT, EμBmi1, KI and EμKI mice utilizing micro-CT. Quantitative histomorphometry for (B) BV/TV, (C) bone mineral density (BMD), (D) epiphyseal volume, (E) cortical bone volume, (F) trabecular number (Tb.N), and (G) trabecular separation (Tb.Sp). Representative micrographs of paraffin-embedded sections of tibias stained (E) histochemically for total collagen, (G) with H&E, and (K) histochemically for alkaline phosphatase (ALP) and (O) TRAP, and immunohistochemically for Col I (M). Magnification is x50 in E, and is x400 in G, K and O. Quantitative histomorphometry for (J) N.Ob/T.Ar, the percentage of (L) ALP positive and (N) Col I positive area, and (P) osteoclast surface (Oc.S/B.S) were determined in 2-week-old mice. (Q) RT-PCR of 14-day-old bone tissue extracts for the expression of Runx2, ALP, type I collagen (Col I) and osteocalcin (OCN). Messenger RNA expression assessed by RT-PCR was calculated as a ratio relative to the GAPDH mRNA level and expressed relative to WT mice. Each value is the mean ± SEM of determinations in 5 mice of each genotype. *P < 0.05; **P < 0.01; ***P < 0.001 compared with WT mice. #P < 0.05; ##P < 0.01: ###P < 0.001 compared with KI mice.
To determine whether the effect of Bmi1 overexpression in lymphocytes on the alteration of the bone volume of PthrpKI/KI mice is associated with an alteration of osteoclastic bone resorption, we examined the effect of Bmi1 overexpression in lymphocytes on osteoclastic bone resorption of PthrpKI/KI mice by histochemistry and computer-assisted image analysis. We found that the TRAP positive osteoclast surface was increased in EμBmi1mice, but was decreased significantly in PthrpKI/KI mice compared to wild-type mice. However, it was significantly increased in EμKI mice compared to PthrpKI/KI mice (Fig. 6O,P). These results demonstrated that although Bmi1 overexpression in lymphocytes increased bone volume in PthrpKI/KI mice, this was not by decreasing osteoclastic bone resorption.
Bmi1 overexpression in lymphocytes reduced the oxidative stress and DNA damage repair responses of Pthrp
mice
In order to determine whether the improved PthrpKI/KI premature aging and decreased osteoporosis phenotypes observed after overexpression of Bmi1 in lymphocytes were associated with inhibition of oxidative stress, ROS levels in bone marrow cells, spleen and thymus and the antioxidant enzyme gene and protein expression levels in bone tissue were examined. ROS levels in bone marrow cells, spleen and thymus were reduced in EμBmi1mice, but were increased in both PthrpKI/KI and EμKI mice compared to wild-type mice, however they were decreased in EμKI mice relative to PthrpKI/KI mice (Fig. 7A). In contrast, the gene expression levels of antioxidant enzymes including SOD1/2/3, GSR and GPX1, and protein expression levels of SOD1 and Sirt1 were up-regulated significantly in EμBmi1mice, but were down-regulated in PthrpKI/KI mice compared to wild-type mice, however they were up-regulated in EμKI mice relative to PthrpKI/KI mice (Fig. 7B–E). These results demonstrated that PTHrP NLS and C-terminus deficiency induced oxidative stress in various tissues, whereas overexpression of Bmi1 in lymphocytes could reduce oxidative stress in PthrpKI/KI mice.
Figure 7
Bmi1 overexpression in lymphocytes reduced the oxidative stress and DNA damage responses of Pthrp mice.
(A) ROS levels in BM, thymus and spleen from 2-week-old WT, EμBmi1, KI and EμKI mice. (B) RT-PCR of bone tissue extracts from 2-week-old mice for expression of SOD1, SOD2, SOD3, glutathione reductase (GSR) and glutathione peroxidase1 (GPX1). Messenger RNA expression assessed by RT-PCR is calculated as a ratio relative to GAPDH, and expressed relative to WT mice. Western blots of long bone extracts from 2-week-old mice for expression of (C) SOD1, Sirtuin 1 (Sirt1), (F) γ-H2AX, Bmi1, p53, p16, Bcl-2 and caspase-3. β-actin was used as loading control for Western blots. (D) SOD1, (E) Sirt1, (G) Bmi1, (H) γ-H2AX, (I) p53, (J) p16, (K) Bcl-2 and (L) caspase-3 protein levels were assessed by densitometric analysis calculated as a ratio relative to β-actin protein levels and expressed relative to levels of 2-week-old WT mice. Each value is the mean ± SEM of determinations in 5 mice of each genotype. *P < 0.05; **P < 0.01; ***P < 0.001 compared with WT mice. #P < 0.05; ##P < 0.01; ###P < 0.001 compared with KI mice.
We then determined whether reducing oxidative stress by overexpression of Bmi1in lymphocytes in PthrpKI/KI mice also inhibited DNA damage responses, by examining expression levels in bone tissue of the DNA double-strand break marker γH2AX, of DNA damage-related proteins Bmi1, p16 and p53, and of apoptotic regulating molecules including Bcl-2 and caspase-3. We found that the expression levels of γH2AX, p16, p53 and caspase-3 were down-regulated in EμBmi1mice, but were up-regulated in both PthrpKI/KI and EμKI mice compared to wild-type mice; however they were lower in EμKI mice relative to PthrpKI/KI mice (Fig. 7F,H,I, J,L). In contrast, the protein expression levels of Bmi1 and Bcl-2 were up-regulated significantly in bone of EμBmi1mice, but were down-regulated in bone of PthrpKI/KI and EμKI mice compared to wild-type mice, although they were higher in bone of EμKI mice relative to PthrpKI/KI mice (Fig. 7F,G,K). These results demonstrated that PTHrP NLS and C-terminus deficiency enhanced DNA damage responses in bone tissue whereas overexpression of Bmi1 in lymphocytes could inhibit DNA damage responses in bone of PthrpKI/KI mice.
Effect of oxidative stress on Bmi1 expression levels and nuclear localization
To assess whether the reductions of Bmi1 expression and nuclear localization observed in PthrpKI/KI mice were associated with oxidative stress, embryonic fibroblasts from wild-type and PthrpKI/KI mice were treated with H2O2 or H2O2 combined with the antioxidant NAC, and Bmi1 expression and nuclear localization were examined by immunofluoresent cell staining and computer-assisted image analysis. We found that H2O2 treatment significantly reduced Bmi1 protein expression in wild-type mice and significantly reduced both Bmi1 protein expression and Bmi1 nuclear localization in PthrpKI/KI mice (Fig. 8A,B). Treatment with NAC rescued H2O2-induced reductions in Bmi1 expression in wild-type mice and rescued H2O2-induced reductions of Bmi1 expression and nuclear localization in PthrpKI/KI mice (Fig. 8A,B). These results demonstrated that the decreases in Bmi1 expression and nuclear localization caused by PTHrP NLS and C-terminus deficiency may be mediated via oxidative stress.
Figure 8
Effect of oxidative stress on Bmi1 expression levels and nuclear localization.
(A) Representative micrographs of immunofluoresent staining in embryonic fibroblasts from wild-type and PthrpKI/KI mice treated with H2O2 or with H2O2 combined with the antioxidant NAC (H2O2 + NAC). (B) Quantified Bmi1 indicates fluoresence intensity (integrated optical density, IOD/ area). Each value is the mean±SEM of determinations in 5 mice of each genotype. **P < 0.01 compared with WT cultures; #P < 0.05; ##P < 0.01 compared with control cultures; &P < 0.05; &&P < 0.01 compared with H2O2 treated cultures.
Discussion
BM-MSCs and other cells of the osteoblast lineage appear to form an essential component of the hematopoietic stem cell niche contributing to the proliferation of HSCs and progenitor cells and also regulating B and T cell lymphopoiesis3. Conversely HSCs and progenitors appear to regulate BM-MSC induction into osteoblasts. Thus HSCs are able to direct mesenchymal differentiation towards the osteoblastic lineage under basal conditions, but HSCs isolated from animals subjected to an acute stress (e.g., bleeding or 5-FU) were significantly better at inducing osteoblastic differentiation in vitro and in vivo than were HSCs obtained from control animals. The molecular basis for this activity appeared to be the production of bone morphological protein 2 (BMP2) and BMP6 by HSCs2. Additionally the non-adherent mononuclear bone marrow population was able to significantly and robustly provide osteoprogenitors for treatment of osteogenesis imperfecta33. We therefore explored in detail whether osteogenesis could be enhanced by hematopoietic cells, notably lymphocytes, that were genetically engineered to convey a potential stimulator of the bone microenvironment, the polycomb protein Bmi1. For this purpose we employed a transgenicmouse model that overexpressed Bmi1 only in lymphocytes, and not in osteogenic cells. Our results revealed that Bmi1 overexpression in lymphocytes enhanced bone turnover and resulted in an augmentation of bone volume with increased osteoblastic bone formation relative to increased osteoclastic bone resorption. We also demonstrated in vitro that increased osteogenesis induced by Bmi1 overexpression in lymphocytes resulted from stimulation of the proliferation of BM-MSC and their differentiation into osteoblasts as shown by increased total CFU-f, ALP-positive and calcified CFU-f forming efficiency. Furthermore, osteoblastic differentiation related genes, including Runx2, ALP, type I collagen and osteocalcin, were up-regulated. These results indicate that Bmi1 overexpression in lymphocytes can stimulate osteogenesis.To examine the mechanism whereby Bmi1 overexpression in lymphocytes stimulates osteogenesis, we showed that the conditioned medium from either bone marrow cell or spleen cell cultures derived from EμBmi1transgenic mice significantly increased the percentages of total CFU-f and of ALP-positive areas relative to those from wild-type mice. These results suggest that lymphocytes with Bmi1 overexpression can release osteogenic mediators which can stimulate the proliferation and differentiation of BM-MSCs along the osteoblast lineage.To attempt to identify the osteogenic mediators secreted by lymphocytes overexpressing Bmi1, we performed a serum protein array and cluster analysis and 5 proteins were identified which were significantly increased in EμBmi1transgenic mice relative to their wild-type littermates. These proteins were identified as follistatin (FLRG), chemokine (C-C motif) receptor 6 (CCR6), placental growth factor 2 (PlGF-2), insulin-like growth factor binding protein 7 (IGFBP-7) and interleukin-15 (IL-15). Previous studies have suggested that 4 of the 5 proteins identified by the protein array, including FLRG, CCR6, PIFG and IGFBP-7, are involved in osteogenesis34353637, whereas IL-15 is a pleiotropic proinflammatory cytokine that appears to help mediate pathological bone loss38. The mechanisms whereby these factors function as osteogenic factors in the bone microenvironment is currently under investigation.Bmi1 null mice display numerous abnormalities including a severe defect in stem cell self-renewal and a shortened lifespan781139. Besides the de-repression of the Ink4a/Arf locus which mediates many aspects of the Bmi1 deficient phenotypes40, protection against oxidative stress emerges as another important pathway downstream of Bmi1. Targeted deletion of Bmi1 resulted in an accumulation of ROS levels, both in knockout mouse models and in humanCD34+ cells transduced with lentiviral Bmi1 RNAi vectors1841. The induction of ROS caused by Bmi1 deficiency could be counteracted by treatment with antioxidants such as N-acetylcysteine (NAC)18. Therefore, in view of the fact that Bmi1 functions not only through inhibiting p16 and p19 signalling pathways, but also by protecting against oxidative stress18, we asked whether the enhanced proliferation and osteogenic differentiation capabilities of BM-MSCs, caused by Bmi1 overexpression in lymphocytes, were associated with reduced ROS production or enhanced antioxidant capacity. Our results demonstrated that Bmi1 overexpression in lymphocytes significantly reduced ROS levels and MDA content and increased the T-AOC and SOD activities in bone marrow cells, thymus, spleen, and kidney tissues and in plasma. ROS levels may be increased in human mesenchymal stem cells as part of aging, and previous studies have demonstrated that high concentrations of ROS inhibited the proliferation and differentiation of human and mouse mesenchymal stem cells, reduced osteoblast activity and decreased bone formation42434445, however if ROS levels are down-regulated, the proliferative ability of human mesenchymal stem cells is restored46. Expression of ROS scavengers is a protective mechanism, and human mesenchymal stem cells express high basal levels of the ROS scavenger glutathione, which enables them to maintain low intracellular ROS levels when exposed to high levels of ROS in culture47. Our results suggest that overexpression of Bmi1 in lymphocytes can maintain a lower level in ROS in several tissues including bone tissue by enhancing antioxidant capacity. This may then contribute to enhanced proliferation and differentiation of BM-MSCs, and accelerated osteoblastic bone formation.In PTHrP1–84 knockin (PthrpKI/KI) mice, which are missing the NLS and the C-terminal region of PTHrP, the expression of Bmi1 is reduced, which can potentially mediate the growth arrest and premature osteoporosis observed30. We therefore asked whether Bmi1 overexpression in lymphocytes could improve the growth arrest and premature osteoporosis in PthrpKI/KI mice. To address this issue, we crossed EμBmi1transgenic mice with PthrpKI/KI mice to generate a PthrpKI/KI mice overexpressing Bmi1 in lymphocytes and compared them with PthrpKI/KI and wild-type littermates. We found that overexpression of Bmi1 in PthrpKI/KI mice resulted in mice with a longer lifespan, and with increased body weight and thymus and spleen weight. Chondrocyte proliferation was accelerated resulting in augmented width of growth plates and improvement in skeletal growth. Bone volume was increased due to increased osteoblast number and activity but not due to reduced osteoclastic bone resorption. Our results therefore demonstrated that Bmi1 overexpression in lymphocytes can improve premature aging and skeletal growth retardation, and enhance osteogenesis.Our previous work has implicated Bmi1 down-regulation and p16 and p21 up-regulation, leading to G1 cell-cycle arrest and senescence30 as part of the underlying mechanism for the premature aging and the osteoporotic phenotype caused by PTHrP NLS and C terminus deficiency. In the present study, we asked whether the improvement in premature aging and osteoporosis caused by Bmi1 lymphocyte overexpression in PthrpKI/KI mice was associated with inhibition of oxidative stress. We examined ROS levels in bone marrow cells, spleen and thymus and the gene and protein expression levels of antioxidant enzymes in osseous tissue. ROS levels were found to be increased in bone marrow cells, spleen and thymus and expression levels of antioxidant enzymes including SOD1/2/3, GSR and GPX1 were up-regulated in PthrpKI/KI mice overexpressing Bmi1in lymphocytes. Sirt1, a class III protein deacetylase, is a crucial cell survival protein, which is also involved in combating oxidative stress48 and was also up-regulated. We previously demonstrated that Bmi1 deficient mice displayed an osteoporotic phenotype with a significant down-regulation of Sirt1 protein expression, whereas treatment of BM-MSCs with resveratrol, a Sirt1 activator, rescued osteogenesis defects caused by Bmi1 deficiency8. Previous work has also shown that Sirt1haploinsufficiency resulted in a significant reduction in bone mass characterized by decreased bone formation and increased marrow adipogenesis49. Recently, we reported that overexpression of Sirt1 in BM-MSCs enhanced osteoblastic bone formation and partially rescued the defects in skeletal growth and osteogenesis in the Bmi1 deficient mice by inhibiting oxidative stress50. Our results in the current study therefore are consistent with those observations and indicate that PTHrP NLS and C-terminus deficiency induces oxidative stress in various tissues, whereas overexpression of Bmi1 in lymphocytes reduces oxidative stress in PthrpKI/KI mice at least in part mediated by Sirt1.We previously reported that in Bmi1 deficient mice, an increase in ROS coincided with an increase in DNA damage and an activation of DNA damage repair pathways; furthermore, treatment with NAC or targeting of CHK2 at least partially restored some of the phenotypes18. We therefore asked whether PTHrP NLS and C-terminus deficiency also increased DNA damage and repair responses, as does the down-regulation of Bmi1, and whether the increased DNA damage repair response occurring in PthrpKI/KI mice was reduced by Bmi1 overexpression in lymphocytes. Our results demonstrated that the expression levels of the DNA double-strand break marker γH2AX, and DNA damage-related proteins including p16, p53 and caspase-3 were up-regulated significantly in bone tissue of PthrpKI/KI mice. When Bmi1 expression levels were increased in PthrpKI/KI mice by crossing them with Bmi1transgenic mice, the DNA damage response pathway-related protein expression levels were down-regulated significantly. These results demonstrated that PTHrP NLS and C-terminus deficiency enhanced DNA damage responses, whereas overexpression of Bmi1 in lymphocytes could inhibit DNA damage responses in PthrpKI/KI mice.We also assessed whether the reductions of Bmi1 expression and nuclear localization observed in PthrpKI/KI mice was associated with oxidative stress. Thus, embryonic fibroblasts from wild-type and PthrpKI/KI mice were cultured with H2O2 or H2O2 combined with the antioxidant NAC, and Bmi1 expression and nuclear localization were examined by immunofluoresent cell staining and computer-assisted image analysis. Our results demonstrated that H2O treatment significantly reduced Bmi1 expression levels in wild-type mice and significantly reduced both Bmi1 expression levels and nuclear localization in PthrpKI/KI mice, whereas NAC treatment rescued H2O2-induced Bmi1 down-regulation in wild-type mice and rescued H2O2-induced reductions of Bmi1 expression and nuclear localization in PthrpKI/KI mice. Previous studies also demonstrated that H2O2 can down regulate Bmi1 expression and subsequently up regulate p16 expression in wild-type astrocytes, whereas the treatment of NAC effectively restored Bmi1 expression in ATM- deficient astrocytes51. These results suggest that the reductions of Bmi1 expression and nuclear localization caused by PTHrP NLS and C-terminus deficiency may be mediated through oxidative stress. The precise mechanism whereby the PTHrP NLS and C-terminus regulate Bmi1 expression and nuclear localization mediated through oxidative stress remains to be investigated.In summary, in this study, we employed a genetically modified mouse model that overexpressed Bmi1 only in lymphocytes, but not in osteogenic cells, and demonstrated that Bmi1 overexpressing lymphocytes can release osteogenic factors and reduce ROS levels to stimulate the proliferation of BM-MSCs and their differentiation into osteoblasts, subsequently leading to accelerated osteoblastic bone formation. Furthermore, we generated PthrpKI/KI mice that overexpress Bmi1 in lymphocytes and demonstrated that overexpression of Bmi1 in lymphocytes could stimulate osteogenesis and partially rescue the defects in skeletal growth and osteogenesis in PthrpKI/KI mice. Overexpression of Bmi1 in lymphocytes can therefore improve the osteogenic microenvironment and stimulate osteogenesis at least partly by inhibiting oxidative stress. This may therefore provide a new therapeutic approach for regulating bone formation.
Materials and Methods
Derivation and genotyping of mice
EμBmi1transgenic mice that overexpress Bmi1 in lymphocytes were generated and genotyped as described previously1921. The Bmil gene was cloned in a transgene vector linking the gene to the pim-1 promoter, the immunoglobulin enhancer (Eμ) and a Moloney murineleukaemia virus (MoMuLV) Jong terminal repeat (LTR)21. The PthrpKI/KI mice (C57BL/6J hybrid background) used in this study were generated and characterized as we previously described30. EμBmi1transgenic mice and Pthrp+/KI mice were fertile and were crossed to generate a PthrpKI/KI overexpressing Bmi1 (EμKI) mice. All experimental animals were maintained in a specific pathogen free [SPF] facility and exposed to a 12-h light, 12-h dark cycle. To minimize bias, the animals we used in a group are sex-matched littermates. Animals did not receive any specific treatment. Before sacrifice, animals were anaesthetized with 2% chloral hydrate at a dose of 20 ul/g to minimize suffering. All animal experiments were carried out in compliance with, and approval by, the Institutional Animal Care and Use Committee of Nanjing Medical University. The protocol was approved by the Committee on the Ethics of Animal Experiments of Nanjing Medical University (Permit Number: NJMU2012008).
Radiography and Micro-computed tomography
For radiography, the left femur from 8-week-old wild-type and EμBmi1mice or 2-week-old wild-type, EμBmi1, PthrpKI/KI and EμKI mice were removed and dissected free of soft tissue, and fixed overnight in 70% ethanol. X-ray images were obtained using a Faxitron machine (Model 805; Faxitron X-ray Corporation) under constant conditions (22 kV, 4 min exposure), and using Kodak X-Omat TL film (Eastman Kodak Company). For the measurement of bone mineral density (BMD), a PIXImus densitometer (Lunar PIXImus Corporation) was used (5 min image acquisition with a precision of 1% CV for skeletal BMD). The PIXImus software automatically calculated the BMD and recorded data in Microsoft Excel files (Microsoft Corporation). After radiography and BMD measurement, the left femur were analyzed sequentially, as described previously, using micro-computed tomography with a Skyscan 1072 scanner and associated analysis software (Skyscan)30. Two-dimensional images were used to generate three-dimensional renderings using the 3D Creator software supplied with the instrument (SkyScan).
Histology
The right tibias were removed from mice, fixed overnight at 4 °C in PLP fixative (2% paraformaldehyde containing 0.075 M-lysine and 0.01 M-sodium periodate), and histologically processed as described previously52. The tibias were decalcified in EDTA and glycerol solution for 7–10 days. The decalcified tibias were dehydrated and embedded in paraffin, after which 5 μm sections were cut on a rotary microtome. The sections were stained with haematoxylin and eosin, or histochemically for total collagen and alkaline phosphatase (ALP) activity and tartrate-resistant acid phosphatase (TRAP), or were used for immunohistochemistry as described below.
Histochemical staining for collagen, ALP and TRAP
Total collagen was detected in paraffin-embedded sections as described previously53. Dewaxed sections were exposed to 1% Sirius red in saturated picric acid for 1 h. After washing with distilled water, sections were counterstained with haematoxylin and mounted with Biomount medium. Enzyme histochemical analysis was performed for the determination of ALP activity, as described previously54. Briefly, following pre-incubation overnight with 1% magnesium chloride in 100 mM- Tris-maleate buffer (pH 9.2), dewaxed sections were incubated for 2 h at room temperature in 100 mM-Tris-maleate buffer containing naphtholAS-MX phosphate (0.2 mg/ml; Sigma) dissolved in ethylene glycol monomethyl diethyl ether (Sigma-Aldrich) as a substrate, and fast red TR (0.4 mg/ml; Sigma) as a stain for the reaction product. After washing with distilled water, the sections were counterstained with methyl green nuclear counter stain(Vector Laboratories) and mounted with Kaiser’s glycerol jelly. TRAP enzyme histochemical analysis was performed on paraffin sections using a modification of a previously described protocol55. Dewaxed sections were pre-incubated for 20 min in buffer containing 50 mM-sodium acetate and 40 mM-sodium tartrate at pH 5.0. The sections were incubated for 15 min at room temperature in the same buffer containing 2.5 mg/ml of naphtholAS-MX phosphate (Sigma) in dimethylformamide as a substrate, and 0.5 mg/ml of fast garnet GBC(Sigma) as a colour indicator for the reaction product. After washing with distilled water, the sections were counterstained with methyl green and mounted with Kaiser’s glycerol jelly.
Immunohistochemical staining
Immunohistochemical staining was performed as described previously52 with Affinity-purified goat anti-mouse type I collagen antibody (Southern Biotechnology Associates, Birmingham, AL, USA) and polyclonal Rabbit anti-Ki67 (Abcam, Cambridge, UK). Briefly, dewaxed and rehydrated paraffin-embedded sections were incubated with methanol:hydrogen peroxide (1:10) to block endogenous peroxidase activity and then washed in Tris-buffered saline (pH 7.6). The slides were then incubated with the primary antibodies overnight at room temperature. After rinsing with Tris-buffered saline for 15 minutes, tissues were incubated with secondary antibody (biotinylated goat anti-rabbit IgG diluted 1:200, Sigma-Aldrich, St. Louis, MO). Sections were then washed and incubated with the Vectastain Elite ABC reagent (Vector Laboratories, Inc. Ontario, Canada) for 45 minutes. Staining was developed using 3,3-diaminobenzidine (2.5 mg/ml) followed by counterstaining with Mayer’s Hematoxylin.
Biochemistry assays
Fresh long bones, thymus, spleen, and kidney were removed from mice and homogenated with cold 0.86% physiological saline. After centrifugation at 2500 rpm, 4 °C for 10 min, the supernatants were collected and used for biochemical assays. Total antioxidant activities (T-AOC), malonaldehyde (MDA) and superoxide Dismutase (SOD) content were measured by chemical chromometry according to the manufacturer’s instructions.
Flow cytometry analysis for intracellular ROS
For analysis of intracellular ROS, total long bone marrow cells, thymus, spleen and kidney cells from 8-week-old wild-type and EμBmi1mice or 2-week-old wild-type, EμBmi1, PthrpKI/KI and EμKI mice were incubated with 5 mM diacetyldichlorofluorescein (DCFDA) (Invitrogen) and incubated in a shaker at 37 °C for 30 min, followed immediately by flow cytometry analysis in a FACS calibur flow cytometer (Becton Dickinson, Heidelberg, Germany)18.
Serum isolation and protein array analysis
Blood was harvested from 8-week-old wild-type or EμBmi1transgenic mice and serum was isolated by centrifugation at 3000 rpm for 5 min. Serum protein arrays were performed using Biotin Label-based Mouse Antibody Array I (Raybiotech) according to the manufacturer’s instructions. Briefly, the arrays were blocked, incubated with 100 μL serum samples overnight, then incubated with biotin-conjugated antibodies (1/250) for 2 hours and with HRP-linked secondary antibody (1/1000) overnight. The membranes were incubated with chemiluminescent substrate and exposed to X-ray film for 15 minutes before development. Quantitative array analysis was performed using Array Vision Evaluation 8.0 (GE Healthcare Life Science). Cluster analysis (hierarchical clustering) of the standard value of the pass volcano plot (differential protein expression) was performed and sample proteins of close relationship were clustered together.
CFU-f assay and cytochemical staining
Tibiae and femurs of 8-week-old wild-type and EμBmi1mice were removed under aseptic conditions, and bone marrow cells were flushed out with DMEM containing 10% FCS, 50 mg/mL ascorbic acid, 10 mM β-glycerophosphate, and 10−8 M dexamethasone. Cells were dispersed by repeated pipetting, and a single-cell suspension was achieved by forcefully expelling the cells through a 22-gauge syringe needle. Total bone marrow cells (106) were cultured in 36-cm2 petri dishes in 5 mL of the above-mentioned medium, which was changed every 4 days, and cultures were maintained for 10 to 18 days. At the end of the culture period, cells were washed with PBS, fixed with PLP fixative, and stained with methyl blue or cytochemically for ALP or with alizarin Red for calcified nodules. Following staining, quantitation of total colony (CFU-f) area, of ALP-positive (CFU-Fap) area and alizarin red positive (CFU-fob) area was performed using computer-assisted image analysis as we described previously52. CFU-f assays were also performed with 20% conditioned media harvested from either bone marrow cell (BM-CM) or spleen cell (Sp-CM) cultures derived from EμBmi1transgenic mice and wild-type mice, respectively.
Western blot analysis
Proteins were extracted from bone tissue, thymus and spleen of 8-week-old wild-type and EμBmi1mice or from bone tissue from 2-week-old wild-type, EμBmi1, PthrpKI/KI and EμKI mice, and proteins were quantitated using a protein assay kit (Bio-Rad, Mississauga, Ontario, Canada). Protein samples (30 μg) were fractionated by SDS-PAGE and transferred to nitrocellulose membranes. Immunoblotting was carried out as described (9) using primary antibodies against Bmi1 (Millipore), SOD1 (Abcam), Sirt1 (Abcam), γ-H2AX (Ser139) (Cell Signaling Technology), p53 (Cell Signaling Technology), p16 (Santa Cruz Biotechnology, Inc.), Bcl-2 (Santa Cruz Biotechnology,Inc.), caspase-3 (Cell signaling technology), and β-actin (Bioworld Technology, St. Louis Park, MN, USA). For standard Western blotting detection, blots were incubated with HRP-conjugated antibody. Bands were visualized using ECL chemiluminescence (Pierce, Rockford, IL, USA) and quantitated by Scion Image Beta 4.02 (Scion Corporation, NIH).
Quantitative real-time RT-PCR
RNA was isolated from mouse bone tissue, excluding the growth plate, using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Real time RT-PCR were performed as described previously56 and the primer sequences used for the real-time PCR are presented in Table 2.
Table 2
Sequences of primers employed for RT-PCR.
Name
S/AS
Sequence
Tm (°C)
bp
Runx2
S
GTGACACCGTGTCAGCAAAG
55
356
AS
GGAGCACAGGAAGTTGGGAC
ALP
S
CTTGCTGGTGGAAGGAGGCAGG
55
393
AS
GGAGCACAGGAAGTTGGGAC
COL-I
S
TCTCCACTCTTCTAGTTCCT
55
269
AS
TTGGGTCATTTCCACATGC
OCN
S
CAAGTCCCACACAGCAGCTT
55
370
AS
AAAGCCGAGCTGCCAGAGTT
Bmi1
S
ATCCCCACTTAATGTGTGTCCT
55
393
AS
CTTGCTGGTCTCCAAGTAACG
SOD1
S
GGTGAACCAGTTGTGTTGTC
56
203
AS
CCGTCCTTTCCAGCAGTC
SOD2
S
CAGACCTGCCTTACGACTATGG
56
113
AS
CTCGGTGGCGTTGAGATTGTT
SOD3
S
CCTTCTTGTTCTACGGCTTGC
56
142
AS
TCGCCTATCTTCTCAACCAGG
GSR
S
GACACCTCTTCCTTCGACTACC
56
116
AS
CCCAGCTTGTGACTCTCCAC
GPX1
S
AGTCCACCGTGTATGCCTTCT
56
105
AS
GAGACGCGACATTCTCAATGA
FLRG
S
TGCTGCTACTCTGCCAGTTC
62
130
AS
GTGCTGCAACACTCTTCCTTG
CCR6
S
CCTGGGCAACATTATGGTGGT
63
123
AS
CAGAACGGTAGGGTGAGGACA
PLGF-2
S
GAACGGCTCGTCAGAGGTG
62
187
AS
ACAGTGCAGATTCTCATCGCC
IGFBP7
S
CTGGTGCCAAGGTGTTCTTGA
60
90
AS
CTCCAGAGTGATCCCTTTTTACC
IL-15
S
ACATCCATCTCGTGCTACTTGT
61
113
AS
GCCTCTGTTTTAGGGAGACCT
GAPDH
S
TGGATTTGGACGCATTGGTC
55
211
AS
TTTGCACTGGTACGTGTTGAT
Real-time RT-PCR primers used with their name, orientation (S, sense; AS, antisense), sequence, annealing temperature (Tm), and length of amplicon (bp).
Computer-assisted image analysis
After H&E staining or histochemical or immunohistochemical staining of sections from each group, images of fields were photographed with a Sony digital camera. Images of micrographs from single sections were digitally recorded using a rectangular template, and recordings were processed and analyzed using Northern Eclipse image analysis software as described2556.
MEF culture and treatment
The primary WT and PTHrP KI MEFs were isolated from E13.5 Pthrp+/KI female mice. Briefly, pregnant mice were sacrificed, the uterus exposed, and embryonic mice obtained. The internal tissues and head were removed and then the bodies of the embryos were minced in 1 ml trypsin, and the minced tissue placed in a 37 °C shaker for 1 hour. After 1 h, the digested tissues were plated on 10 cm × 10 cm dishes and cultured in Dulbecco’s modified Eagle’s medium/F-12 medium, supplemented with 10% fetal bovine serum, 5 μg/ml streptomycin and 5 units/ml penicillin. The cells were maintained in a 5% CO2atmosphere at 37 °C. The cells were passaged after 3 days and then every 4 days. F1 offspring cells were digested and placed on chamber slidesfor experimental use. After cell attachment, 200 μM H2O2 or 200 μM H2O2 plus 500 μM NAC (N acetyl-semi-ammonia acid) were added to the cultured cells on slide chambers for 2 days. DNA was extracted from the heads of the embryos for genotype identification.
Immunofluorescent cell staining
The cells on slide chambers were fixed for 40 min, then washed for 10 min in PBS 3 times, blocked for 30 min at room temperature in PBST (10% normal donkey serum, 0.2% Triton X-100) and then washed in PBS for 10 min, 3 times. Bmi1 antibody (Abgent USA) was added into the slide chambers at a dilution of 1 to 50 in PBS (2% donkey serum, 0.2% Triton X-100) and incubated overnight at 4 °C. Slides were then washed in PBS for 10 min, 3 times. Donkey anti-rabbit second antibody (Alexa Fluor F488, life technologies, USA) was then added at a dilution of 1 to 800 in PBS. Slides were then incubated for 1 hour at room temperature, washed in PBS for 10 min, 3 times, and DAPI was then used for nuclear counterstaining. Slides were then mounted and photos taken. The mean fluorescence intensity was analyzed using Image pro plus software which provided the integrated optical density (IOD) over a given area.
Statistical Analysis
Data from image analysis were presented as mean ± SEM. Statistical comparisons were made using a two-way ANOVA, for two group comparison, and Bonferroni test was used after ANOVA, with P < 0.05 being considered significant.
Additional Information
How to cite this article: Zhou, X. et al. Overexpression of Bmi1 in Lymphocytes Stimulates Skeletogenesis by Improving the Osteogenic Microenvironment. Sci. Rep.
6, 29171; doi: 10.1038/srep29171 (2016).
Authors: Anna V Molofsky; Ricardo Pardal; Toshihide Iwashita; In-Kyung Park; Michael F Clarke; Sean J Morrison Journal: Nature Date: 2003-10-22 Impact factor: 49.962
Authors: Yingben Xue; Zengli Zhang; Andrew C Karaplis; Geoffrey N Hendy; David Goltzman; Dengshun Miao Journal: J Bone Miner Res Date: 2005-06-20 Impact factor: 6.741
Authors: T L Clemens; S Cormier; A Eichinger; K Endlich; N Fiaschi-Taesch; E Fischer; P A Friedman; A C Karaplis; T Massfelder; J Rossert; K D Schlüter; C Silve; A F Stewart; K Takane; J J Helwig Journal: Br J Pharmacol Date: 2001-11 Impact factor: 8.739
Authors: J E Henderson; N Amizuka; H Warshawsky; D Biasotto; B M Lanske; D Goltzman; A C Karaplis Journal: Mol Cell Biol Date: 1995-08 Impact factor: 4.272