Kai Cui1, Haiying Wang1, Shengxi Liao1, Qi Tang2, Li Li1, Yongzhong Cui1, Yuan He1. 1. Research Institute of Resources Insects, Chinese Academy of Forestry, Kunming, 650224, People's Republic of China. 2. Hunan Co-Innovation Center for Utilization of Botanical Functional Ingredients, Hunan Agricultral University, Changsha, 410128, People's Republic of China.
Abstract
Dendrocalamus sinicus is the world's largest bamboo species with strong woody culms, and known for its fast-growing culms. As an economic bamboo species, it was popularized for multi-functional applications including furniture, construction, and industrial paper pulp. To comprehensively elucidate the molecular processes involved in its culm elongation, Illumina paired-end sequencing was conducted. About 65.08 million high-quality reads were produced, and assembled into 81,744 unigenes with an average length of 723 bp. A total of 64,338 (79%) unigenes were annotated for their functions, of which, 56,587 were annotated in the NCBI non-redundant protein database and 35,262 were annotated in the Swiss-Prot database. Also, 42,508 and 21,009 annotated unigenes were allocated to gene ontology (GO) categories and clusters of orthologous groups (COG), respectively. By searching against the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG), 33,920 unigenes were assigned to 128 KEGG pathways. Meanwhile, 8,553 simple sequence repeats (SSRs) and 81,534 single-nucleotide polymorphism (SNPs) were identified, respectively. Additionally, 388 transcripts encoding lignin biosynthesis were detected, among which, 27 transcripts encoding Shikimate O-hydroxycinnamoyltransferase (HCT) specifically expressed in D. sinicus when compared to other bamboo species and rice. The phylogenetic relationship between D. sinicus and other plants was analyzed, suggesting functional diversity of HCT unigenes in D. sinicus. We conjectured that HCT might lead to the high lignin content and giant culm. Given that the leaves are not yet formed and culm is covered with sheaths during culm elongation, the existence of photosynthesis of bamboo culm is usually neglected. Surprisedly, 109 transcripts encoding photosynthesis were identified, including photosystem I and II, cytochrome b6/f complex, photosynthetic electron transport and F-type ATPase, and 24 transcripts were characterized as antenna proteins that regarded as the main tool for capturing light of plants, implying stem photosynthesis plays a key role during culm elongation due to the unavailability of its leaf. By real-time quantitative PCR, the expression level of 6 unigenes was detected. The results showed the expression level of all genes accorded with the transcriptome data, which confirm the reliability of the transcriptome data. As we know, this is the first study underline the D. sinicus transcriptome, which will deepen the understanding of the molecular mechanisms of culm development. The results may help variety improvement and resource utilization of bamboos.
Dendrocalamus sinicus is the world's largest bamboo species with strong woody culms, and known for its fast-growing culms. As an economic bamboo species, it was popularized for multi-functional applications including furniture, construction, and industrial paper pulp. To comprehensively elucidate the molecular processes involved in its culm elongation, Illumina paired-end sequencing was conducted. About 65.08 million high-quality reads were produced, and assembled into 81,744 unigenes with an average length of 723 bp. A total of 64,338 (79%) unigenes were annotated for their functions, of which, 56,587 were annotated in the NCBI non-redundant protein database and 35,262 were annotated in the Swiss-Prot database. Also, 42,508 and 21,009 annotated unigenes were allocated to gene ontology (GO) categories and clusters of orthologous groups (COG), respectively. By searching against the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG), 33,920 unigenes were assigned to 128 KEGG pathways. Meanwhile, 8,553 simple sequence repeats (SSRs) and 81,534 single-nucleotide polymorphism (SNPs) were identified, respectively. Additionally, 388 transcripts encoding lignin biosynthesis were detected, among which, 27 transcripts encoding Shikimate O-hydroxycinnamoyltransferase (HCT) specifically expressed in D. sinicus when compared to other bamboo species and rice. The phylogenetic relationship between D. sinicus and other plants was analyzed, suggesting functional diversity of HCT unigenes in D. sinicus. We conjectured that HCT might lead to the high lignin content and giant culm. Given that the leaves are not yet formed and culm is covered with sheaths during culm elongation, the existence of photosynthesis of bamboo culm is usually neglected. Surprisedly, 109 transcripts encoding photosynthesis were identified, including photosystem I and II, cytochrome b6/f complex, photosynthetic electron transport and F-type ATPase, and 24 transcripts were characterized as antenna proteins that regarded as the main tool for capturing light of plants, implying stem photosynthesis plays a key role during culm elongation due to the unavailability of its leaf. By real-time quantitative PCR, the expression level of 6 unigenes was detected. The results showed the expression level of all genes accorded with the transcriptome data, which confirm the reliability of the transcriptome data. As we know, this is the first study underline the D. sinicus transcriptome, which will deepen the understanding of the molecular mechanisms of culm development. The results may help variety improvement and resource utilization of bamboos.
Currently, due to depleting fossil reserves and increasing emission of greenhouse gases, it is obvious that utilization of renewable feedstock is one necessary step towards a sustainable development of our future [1]. Therefore, the efforts to exploit a variety of potential plant feedstocks for the energy, chemical, and food ingredients have been made particularly from agricultural and forestry biomass resources [2,3,4]. Dendrocalamus sinicus, belonging to Bambusoideae of Gramineae, is the world’s largest bamboo species with strong woody stems (maximal diameter 30 cm and maximal height 33 m), which is mainly distributed in the southwest region of China [5]. It is called Da bamboo by local residents, and its culms yield per unit area is 5–8 times as that of Phyllostachys pubscens that is now popularized as a major economic bamboo species in China [6]. In its native area, D. sinicus is economically important as a raw material for furniture, construction, and industrial paper pulp [7]. Because of easy propagation, fast growth, and high productivity, it is considered as one of the most potential renewable non-woody lignocellulosic feedstocks for bioenergy and biorefinery [8].The culm growth of D. sinicus is extremely amazing: shooting initiate from early June, and height growth of culm end in late August. By the brief three months, new shoots can reach the height and diameter of adult mother bamboo—near to 30 cm of diameter and 30 m of height. To our knowledge, no any plant in this planet has faster growth rate compared with D. sinicus.In terms of the bamboo growth, although some molecular researches were reported, such as the protein expression profiles [9], cloning of a set of cDNA sequences [10,11,12,13,14,15,16], Expressed Sequence Tags (EST) [17], RNA-seq [18,19], monoclonal antibody banks [20] and draft genome [21], the molecular mechanism related to culm development is still unclear. Especially, to date, there was almost no molecular data of D. sinicus except SSR marker development [22], which seriously restricted its variety improvement and resource development.Transcriptomic analyses are extremely efficient methods for identifying differential expression genes at the whole-genome level. In contrast to the traditional fragment analysis techniques, RNAs-seq have some advantages: (1) high efficient and low cost; (2) cataloguing all kinds of transcripts including mRNAs, noncoding RNAs, and small RNAs; (3) investigating the transcriptional structure of genes, splicing patterns, and gene isoforms; (4) studying posttranscriptional modification and mutations; and (5) precisely quantifying gene expression in large-scale at the same time of sequencing. Moreover, RNA-seq is genome-independent and is especially useful for analyzing the transcriptome of a species without complete genome information [23,24].In this study, the high throughput RNA-Seq was performed to elucidate the molecular processes involved in the rapid culm elongation of D. sinicus during an integrated growing season. Also, based on the transcriptome analysis, a series of results were displayed including novo assembly, gene characterization, gene classification, gene enrichment, SSR and SNP marker identification. Given the unique growth characteristics of D. sinicus, this study will lay foundation for deep understanding of bamboo growth.
Materials and Methods
Plant materials
Culm samples were collected from natural population of D. sinicus located at Ninger county in Yunnan province of China (23°07′~23°09′ N, 101°04′~101°08′ E), where the D. sinicus distributed typically. The sampling site belongs to public forest, and this field sampling was permitted by Ninger County Government. Based on the depiction by Banik (2015) [25], the internodal elongation begins at the basal portion of the culm and then gradually proceeds to the top, that is, elongation is mainly due to the intercalary meristem present at the node. Development, maturation, and aging gradually completed from basal to top internodes. Thus, the basal internode represents the higher lignified degree compared with middle and top internodes. In intercalary growth, the immature axis increases in length by the elongation of cells in zones of secondary meristems each located just above the node. Thus, different internode represents different developmental condition. Therefore, basal culms from different internode originated from a same bamboo were harvested. A total of nine internodes were selected and triplicate replicate was mixed. Samples were washed with deionized water, and wiped with filter paper, then, immediately frozen in liquid nitrogen and stored at −80°C until analysis.
RNA extraction, library construction and RNA-seq
Total RNA of each sample was isolated separately using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. The purified RNA concentration was quantified by a spectrophotometer (UV-Vis Spectrophotometer, Quawell Q5000, San Jose, CA, USA), and the purity and degradation of total RNA were checked on 1% agarose gels before proceeding. For maximizing the diversity of transcriptional units, RNA from each sample was mixed into a single pool. The mRNA-seq library was constructed using Illumina’s TruSeq RNA Sample Preparation Kit (Illumina Inc, San Diego, CA, USA). Shortly, mRNA was purified by oligo (dT) magnetic beads. After purification, the mRNA was fragmented into small pieces using divalent cations under elevated temperature and the cleaved RNA fragments were used for first strand cDNA synthesis using reverse transcriptase and random primers. This was followed by second strand cDNA synthesis using DNA polymerase I and RNaseH. Then, cDNA fragments were perfored an end repair process and ligation of adapters. The product was purified and enriched with PCR to create the final cDNA library [26]. Finally, the cDNA library was sequenced by the Illumina HiSeq™ 2000 sequencing platform.
Analysis of Illumina sequencing results
The raw reads from mRNA-seq were filtered by discarding the reads with adaptor contamination, masking low-quality reads with ambiguous ‘N’ bases and removing the reads in which more than 10% bases had a Q-value <20 [27]. The clean reads were assembled into contigs using the Trinity program [28]. In the Trinity method, an optimized k-mer length of 25 was used for de novo assembly. According to the paired-end information of the sequences, the contigs were linked into transcripts. Subsequently, the transcripts were clustered based on nucleotide sequence identity, and the longest transcripts in the cluster units were regarded as unigenes to eliminate redundant sequences.
Functional annotation
A BLASTx search (E≤10−5) with unigenes was performed against protein databases such as non-redundant protein (Nr), SwissProt, KEGG and Cluster of Orthologous Groups of proteins (COG), and the best aligning results used to determine sequence direction of unigenes. ESTScan was used to predict its coding regions and sequence direction if a unigene was not aligned in any of the above databases [29]. To reflect the molar concentration of a transcript by normalizing for RNA length and for the total read number, the expression abundance of the unigenes was represented using the number of fragments per kilobase of transcript per million fragments mapped (FPKM) [30]. Functional annotation by gene ontology terms (GO, http://www.geneontology.org) was analyzed by Blast2GO [31] and WEGO [32] software. The KEGG pathways annotation was performed using Blastall software against the KEGG database. KEGG pathways were retrieved from KEGG web server (http://www.genome.jp/kegg/).
Detection of SSR and SNP markers
To dig the potential SSR markers, the assembled sequences were searched using MISA software (http://pgrc.ipk-gatersleben.de/misa/). The parameters were designed for the identification of perfect dinucleotide motifs with a minimum of six repeats, and tri-, tetra-, penta-, and hexanucleotide motifs with a minimum of five repeats [33,34]. Also, SOAPsnp was used to detect the single-nucleotide polymorphism (SNP) in the transcript. The program can assemble consensus sequence for the genome of a newly sequenced individual based on the alignment of the raw sequencing reads on the Unigenes. The SNPs can then be identified on the consensus sequence through the comparison with the Unigenes [35].
Gene validation and expression analysis
To validate the transcript sequence and analyze the temporal expression, six genes were mined from the D. sinicus transcriptome database including PsbA, PsaB, PetB, PetF, Lhca2 and F5H. Of which, the first five genes were involved in photosynthesis and the last one gene was associated with lignin biosynthesis. The expression level of genes in different internodes was detected by Real-time qPCR, and UBQ (Ubiquitin) gene used to as the internal control. The mRNA was reverse transcribed into complementary DNA (cDNA) according to the instruction of the Superscript III First-Strand Synthesis System (Invitrogen, Carlsbad, USA). The primers used for qPCR were designed using primer premier 3.0 (http://bioinfo.ut.ee/primer3-0.4.0/) and synthesized from Sangon Biotech Company (Shanghai, China). The corresponding gene names, sequences and primers used for RT-qPCR analysis were displayed in File S1. The qPCR reaction was implemented according to the protocol of SYBR® Premix DimerEraser™ (TaKaRa, Dalian, China) by 7300 Real Time PCR System (Applied Biosystems, CA, USA). The cycling conditions of PCR reaction were recommended by the manufacturer (30 s at 95°C, 40 cycles of 95°C for 5 s, and 60°C for 31 s). Three biological replicates of each sample and triplicates of each reaction were performed.
Alignment and phylogenetic tree building
Hidden Markov Model (HMM) was performed to identify the Shikimate O-hydroxycinnamoyltransferase (HCT) genes of the D. sinicus transcriptome. The profile of the HCT condensation domain (cl19241) used for the HMM search (HMMER 3.1, http://hmmer.janelia.org/) was downloaded from the Pfam database (http://pfam.sanger.ac.uk/).A total of 27 HCT sequences were got with an E-value threshold of 0.1. The phylogenetic tree was constructed by neighbor-joining method with 1000 bootstrap trials in MEGA5.0 software.
Results
Transcriptome sequencing and de novo assembly
For getting a broad gene library related to culm development, RNA of nine developmental stages of culms was pooled. A total of 65.08 million raw reads and 4.59 gigabase pairs (Gbp) with an average GC content of 53.21% were obtained by a stringent quality check. The reads with Q ≥ 20 and no ambiguous “N” were defined as high-quality reads. Using SOAPdenovo [36], 54,807,622 high-quality reads were assembled into 240,630 contigs after removal of adaptor sequences and exclusion of contaminated or short reads. By the Trinity de novo assembly program, short-read sequences were assembled into 81,744 unigenes with a mean length of 723 bp, of which, 63,130 unigenes (77.23%) with length 200–1000 bp, 14,161 unigenes (17.32%) with length 1000–2000 bp, and 4453 unigenes (5.45%) with length > 2000 bp (Table 1). The N50 values of contigs and unigenes were 310 bp and 1095 bp, respectively. The number of reads based on the relative position in gene (5′-3′) presented normal distribution (Fig 1). There was a positive relationship between the length of a given unigene and the number of reads (Fig 2), indicating a randomly fragmented transcriptome in this study. What’s more, the raw paired-end sequence data with FASTQ format was deposited in the NCBI Sequence Read Archive (SRA) database with accession number SRA302259, facilitating the access and use of the D. sinicus transcriptome sequencing data.
Table 1
Length distribution of contigs, scaffolds and unigenes.
Nucleotides length (bp)
Contigs
Unigenes
0–200
170,136
0
200–300
28,593
21,969
300–400
14,630
14,537
400–500
6,951
7,786
500–600
4,047
5,326
600–700
2,822
4,244
700–800
2,135
3,549
800–900
1,758
3,059
900–1000
1,392
2,660
1000–1500
4,239
9,087
1500–2000
2,033
5,074
2000–2500
975
2,356
2500–3000
443
1,093
> = 3000
476
1,004
Total number
240,630
81,744
Total length (bp)
59,576,539
59,137,193
N50 length (bp)
310
1,095
Mean length (bp)
248
723
Fig 1
The distribution of the number of reads based on the relative position in gene (5′-3′).
Fig 2
The dependence of unigene lengths on the number of reads assembled into each unigene.
Functional annotation and classification
A threshold of 10−5 was adopted by performing a BLASTX search against diverse protein databases, including the NCBI nonredundant protein (Nr) database, NCBI non-redundant nucleotide sequence (Nt) database, UniProt/Swiss-Prot, Kyoto Encyclopedia of Genes and Genomes (KEGG), Cluster of Orthologous Groups of proteins (COG) and Gene Ontology (GO), and 78.71% of unigenes (64,338) were annotated. According to the BLASTX results, 56,587 (69.22%) unigenes showed significant similarity to Nr protein database, and 61,256 (74.94%) unigenes had homologous proteins in the Nt database. Furthermore, 35,262 (43.14%) unigenes matched the proteins in the Swiss-Prot database (Table 2). Total of 22,569 (40%) unigenes displayed significant homology with sequences of Oryza, and 18% and 14% of the mapped sequences have a high similarity with sequences of Brachypodium distachyon and Setaria italica, respectively. Interestingly, only 509 unigenes (1%) have a high similarity with sequences of P. edulis (Fig 3).
Table 2
Functional annotation of the D. sinicus transcriptome.
Annotated databases
Unigenes
Percentage of unigenes
nr_Annotaion
56,587
69.22%
nt_Annotaion
61,256
74.94%
swissprot_Annotaion
35,262
43.14%
kegg_Annotaion
33,920
41.50%
COG_Annotaion
21,009
25.70%
GO_Annotaion
42,508
52.00%
Total
64,338
78.71%
Fig 3
Species distribution of the BLAST hits in Nr dababase.
56,587 BLASTX-hit unigenes were calculated.
Species distribution of the BLAST hits in Nr dababase.
56,587 BLASTX-hit unigenes were calculated.Overall, GO was used to classify the functions of the assembled transcripts and describe gene products in terms of their associated biological processes, cellular components, and molecular functions [37]. According to GO classification, 42,508 unigenes were divided into the three categories including 52.57% in biological processes, 28.81% in cellular components, and 18.62% in molecular functions (Fig 4). The four largest biological processes were cellular processes, metabolic processes, response to stimulus, and biological regulation. Under the cellular components, the major classifications were cell, cell part, organelle, and membrane. The most of the genes were classified into the molecular functions of binding, catalytic activity, transporter activity, and nucleic acid binding transcription factor activity. These results indicated that culm development was involved in many fundamentally biological regulation and metabolism.
Fig 4
Functional annotation of assembled sequences based on gene ontology (GO) categorization.
The unigenes are summarized into three main categories: cellular component, molecular function and biological process.
Functional annotation of assembled sequences based on gene ontology (GO) categorization.
The unigenes are summarized into three main categories: cellular component, molecular function and biological process.To predict and classify possible functions, 21,009 of 81,744 (25.70%) unigenes were assigned to the COG database based on Nr annotation, and 25 different functional classes were formed (Fig 5). Of them, the largest group is the cluster for general function prediction (7,720, 36.75%), followed by transcription (5,968, 28.41%), replication, recombination and repair (4,945, 23.54%), translation, ribosomal structure and biogenesis (4,820, 22.94%), cell cycle control, cell division, chromosome partitioning (4,375, 20.82%), cell wall/membrane/envelope/ biogenesis (4,230; 20.13%), and signal transduction mechanisms (4,090, 19.47%), etc. Furthermore, 3450 (16.42%) unigenes were assigned to carbohydrate transport and metabolism. Nevertheless, only 22 and 11 unigenes were assigned to extracellular structures and nuclear structure, respectively.
Fig 5
Clusters of orthologous groups (COG) classification.
In total, 21,009 of the 81,744 sequences with Nr hits were grouped into 25 classifications.
Clusters of orthologous groups (COG) classification.
In total, 21,009 of the 81,744 sequences with Nr hits were grouped into 25 classifications.By KEGG database, gene functions and interactions focused on biochemical pathways can be more easily identified and categorized. A BLASTx with E < 10−5 was performed against the KEGG database, 33,920 unigenes (41.5%) had significant matches and were assigned to 128 KEGG pathways (S1 Table). In the all categories, the pathways with highest unigene representation were Metabolic pathways (ko01100, 9375 unigenes, 27.64%), followed by RNA transport (ko03013, 4041 unigenes, 11.91%), mRNA surveillance pathway (ko03015, 3424 unigenes, 10.09%) and Endocytosis (ko04144, 3227 unigenes, 9.51%).
SSR and SNP marker detection
A total of 7,353 sequences containing 8,553 SSRs were identified from 81,744 unigenes, with 997 unigene sequences containing more than one SSR, and 487 unigene sequences containing SSR present in compound formation. Among them, the number of trinucleotide motifs and dinucleotide motifs were the maximum, accounting for 53.83 and 31.12%, respectively (Table 3). In addition, the most abundant repeat type was AG/CT (1,941), followed by CCG/CGG (1,669), AGG/CCT (918), AGC/CTG (748), GA (611), respectively. However, in the all unigene sequences, the number of quad-, penta- and hexa-nucleotide motifs was less than 5% (Fig 6).
Table 3
Frequency of SSRs.
Motif length
Repeat numbers
Total
%
4
5
6
7
8
9
10
>10
Mono
0
0
0
0
0
0
0
642
642
7.51
Di
0
0
887
503
432
360
336
144
2662
31.12
Tri
0
3083
1134
338
42
0
2
5
4604
53.83
Quad
0
153
31
0
1
1
3
0
189
2.21
Penta
306
43
6
0
0
0
0
0
355
4.15
Hexa
96
3
1
0
0
0
0
1
101
1.18
Total
402
3282
2059
841
475
361
341
792
8553
%
4.70
38.37
24.07
9.83
5.55
4.22
3.99
9.26
Fig 6
The distribution of SSR motif length.
By detection of 81,744 Unigenes (total length 59,137,193 bp) sequence information, a total of 81,534 SNPs were identified with the frequency of 1/725, including transition 52,462 and transversion 29,072. A/G and C/T are the main types, accounting for 32.43% and 31.91% of all the SNPs, respectively. Other four kinds of nucleotide variations (A/C, A/T, C/G and G/T) accounting for 8.89%, 8.03%, 9.85% and 8.88%, respectively (Table 4).
Table 4
Statistics of SNP types.
Transition
Number
Transversion
Number
A-G
26,443
A-C
7,250
C-T
26,019
A-T
6,551
C-G
8,031
G-T
7,240
Total
52,462
29,072
Functional genes involved in lignin biosynthesis
As is well known, the lignin content of bamboo is higher than most herbaceous plants [38], which may be due to the differences in the number or level of expression of key enzymes involved in lignin biosynthesis [18]. In the present study, 388 unigenes encoding 16 key enzymes, from the 81,744 unigenes, were identified involved in lignin biosynthesis (Table 5 and Fig 7). The numbers of putative unigenes related to lignin biosynthesis were compared based on Da bamboo of this study, Ma bamboo transcriptome data, Moso bamboo cDNA Database, and rice genes identified from the genome sequences, of which, genes encoding peroxidase remarkably had the most abundance. From the rice genome database [39], we found abundant of transcripts including 26 4-coumarate-CoA ligase (4CL), 23 laccase and 20 phenylalanine ammonia-lyase (PAL). These three genes are also abundant involved in lignin synthesis of Moso bamboo, Ma bamboo and Da bamboo. Particularly, some transcripts encoding Coumaroylquinate (coumaroylshikimate) 3'-monooxygenase (C3' H) and Shikimate O-hydroxycinnamoyltransferase (HCT) identified in Da bamboo, while they did not exist in other species. Similarly, 13 transcripts encoding Ferulate-5-hydroxylase (F5H) were found in Da bamboo, and only one of this gene was identified in Ma bamboo whereas it did not exist in Moso bamboo and rice. It would partially contribute to the increased Da bamboo lignin content in comparison to other species. There were transcripts encoding 5-hydroxyconiferyl aldehyde O-methyltransferase (AldOMT) in Moso bamboo and rice. However, AldOMT did not found in Da bamboo and Ma bamboo, which indicated that other genes encoding alternative methyltransferases, substituting for AldOMT activity, may exist in Da bamboo and Ma bamboo [18]. Also, 8 transcripts encoding Coniferyl-aldehyde dehydrogenase (CoAD) were found in Da bamboo and Ma bamboo, respectively. However, this transcript did not found in Moso bamboo. Da bamboo and Ma bamboo belong to Dendrocalamus, and Moso bamboo belongs to Phyllostachys. Thus, the difference of transcript number possibly represents lignin metabolism distinction in different genus. Among four species, the transcripts encoding Phenylalanine/tyrosine ammonia-lyase (PTAL) were found except rice, implying that PTAL might play an exclusive function in lignin biosynthesis of bamboo.
Table 5
Number of genes found in the bamboos and rice genome that encode key enzymes involved in the lignin biosynthesis pathway.
bThe results were cited from Bamboo Genome Database (www.bamboogdb.org).
cThe results were cited from Yu et al. (2002).
Fig 7
The diagram of metabolic pathway involved in lignin biosynthesis.
It was completed according to Baucher et al. (1998) [71]. All metabolic enzymes predicted in D. sinicus transcriptome were marked with red font. 4CL: 4-coumarate CoA ligase; C3H: Coumarate 3-hdroxylase; C3′H: Coumaroylquinate (coumaroylshikimate) 3′-monooxygenase; C4H: Cinnamate 4-hydroxylase; CAD: Cinnamyl alcohol dehydrogenase; CCoAOMT: Caffeoyl-CoA 3-O-methyltransferase; CCR: Cinnamoyl-CoA reductase; COMT: Caffeic acid 3-O-methyltransferase; F5H: Ferulate 5-hydroxylase; HCT: Hydroxycinnamoyl-CoA: shikimate/quinate hydroxycinnamoyltransferase; PAL: Phenylalanine ammonia lyase; PTAL: Phenylalanine/tyrosine ammonia-lyase; PER: Peroxidase.
aThe results were cited from Liu et al. (2012);bThe results were cited from Bamboo Genome Database (www.bamboogdb.org).cThe results were cited from Yu et al. (2002).
The diagram of metabolic pathway involved in lignin biosynthesis.
It was completed according to Baucher et al. (1998) [71]. All metabolic enzymes predicted in D. sinicus transcriptome were marked with red font. 4CL: 4-coumarate CoA ligase; C3H: Coumarate 3-hdroxylase; C3′H: Coumaroylquinate (coumaroylshikimate) 3′-monooxygenase; C4H: Cinnamate 4-hydroxylase; CAD: Cinnamyl alcohol dehydrogenase; CCoAOMT: Caffeoyl-CoA 3-O-methyltransferase; CCR: Cinnamoyl-CoA reductase; COMT: Caffeic acid 3-O-methyltransferase; F5H: Ferulate 5-hydroxylase; HCT: Hydroxycinnamoyl-CoA: shikimate/quinate hydroxycinnamoyltransferase; PAL: Phenylalanine ammonia lyase; PTAL: Phenylalanine/tyrosine ammonia-lyase; PER: Peroxidase.Given many transcripts encoding HCT exclusively presented in Da bamboo, we searched its domain using database, and found that HCT contain a condensation domain. Thus, a phylogenetic tree was constructed by alignments of the protein sequences containing condensation domain, which can examine the phylogenetic relationship between the condensation domain proteins in D. sinicus and other plants (Fig 8). Based on the phylogenetic tree, twenty-seven sequences identified from D. sinicus were divided into two clades (A and B). In clade A, seventeen sequences were mainly classed to dicotyledon, however, in clade B, ten sequences were generally grouped with monocotyledon including Elaeis guineensis and Phoenix dactylifera, implying the structural or functional diversity of HCT unigenes in D. sinicus.
Fig 8
Phylogenic analysis of Shikimate O-hydroxycinnamoyltransferase.
Two clades (A and B) that represent different likely enzymatic function of 27 D. sinicus unigenes were pointed. In the Fig, unigene number was denoted using underline. Besides D. sinicus transcriptome data, other protein sequences encoding Shikimate O-hydroxycinnamoyltransferase were obtained from NCBI. To distinctly display the relationship between D. sinicus and other species, the species name of each sequence was marked out, and the corresponding accession numbers were as follows: Amborella trichopoda, XP_011620549.1; , XP_013719902.1; Camelina sativa, XP_010478899.1; Cucumis melo, XP_008466864.1; C. sativus, NP_001295843.1; Glycine max, XP_003543709.1; Gossypium raimondii, XP_012445417.1; Elaeis guineensis, XP_010942061.1; Fragaria vescasubsp.vesca, XP_011467012.1; Jatropha curcas, XP_012071524.1; Malus domestica, XP_008380698.1; Nelumbo nucifera, XP_010256176.1; Nicotiana sylvestris, XP_009789449.1; Phaseolus vulgaris, AGV54440.1; Phoenix dactylifera, XP_008790160.1; Populus euphratica, XP_011031277.1; P. trichocarpa, XP_006368492.1; Pyrus × bretschneideri, XP_009344995.1; Sesamum indicum, XP_011073311.1; Solanum tuberosum, XP_006343633.1; S. lycopersicum, XP_004235891.1; Tarenaya hassleriana, XP_010545447.1; Trifolium pretense, ACI16630.1; Vitis vinifera, XP_002268988.1; Zea mays, XP_008673748.1.
Phylogenic analysis of Shikimate O-hydroxycinnamoyltransferase.
Two clades (A and B) that represent different likely enzymatic function of 27 D. sinicus unigenes were pointed. In the Fig, unigene number was denoted using underline. Besides D. sinicus transcriptome data, other protein sequences encoding Shikimate O-hydroxycinnamoyltransferase were obtained from NCBI. To distinctly display the relationship between D. sinicus and other species, the species name of each sequence was marked out, and the corresponding accession numbers were as follows: Amborella trichopoda, XP_011620549.1; , XP_013719902.1; Camelina sativa, XP_010478899.1; Cucumis melo, XP_008466864.1; C. sativus, NP_001295843.1; Glycine max, XP_003543709.1; Gossypium raimondii, XP_012445417.1; Elaeis guineensis, XP_010942061.1; Fragaria vescasubsp.vesca, XP_011467012.1; Jatropha curcas, XP_012071524.1; Malus domestica, XP_008380698.1; Nelumbo nucifera, XP_010256176.1; Nicotiana sylvestris, XP_009789449.1; Phaseolus vulgaris, AGV54440.1; Phoenix dactylifera, XP_008790160.1; Populus euphratica, XP_011031277.1; P. trichocarpa, XP_006368492.1; Pyrus × bretschneideri, XP_009344995.1; Sesamum indicum, XP_011073311.1; Solanum tuberosum, XP_006343633.1; S. lycopersicum, XP_004235891.1; Tarenaya hassleriana, XP_010545447.1; Trifolium pretense, ACI16630.1; Vitis vinifera, XP_002268988.1; Zea mays, XP_008673748.1.Generally, the transcript number involved in lignin biosynthesis in Moso bamboo is smaller than that in Da bamboo and Ma bamboo. The significant difference among Da bamboo, Ma bamboo and Moso bamboo is not surprising because the 10,608 Moso FL-cDNAs actually represent only one third to one fourth of the estimated total of Moso bamboo genes. Also, the Moso FL-cDNA libraries were constructed from shoots, leaves and roots from germinating seeds which were not the most representative tissues for high lignin content, while Da bamboo and Ma bamboo materials used for the transcriptome sequencing covered as many tissues as possible including culms of different developing periods [18]. The above results mean that the unique features of gene expression involved in lignin biosynthesis of Da bamboo.
Functional genes involved in transcription factor and photosynthesis
According to the previous research, many transcription factor families play key roles in plant growth, development and immunity [40,41,42]. After BLASTn analysis, many unigenes were putatively identified as transcription factors, including ERF, Myb, Zinc finger, WRKY, Homeobox, bZIP, bHLH, NAC, MADS, etc (Table 6). Remarkably, Zinc finger had the most abundance in Ma bamboo and Da bamboo, while ERF was the most abundant in Moso bamboo. In the Da bamboo, the order of the number of transcription factor was as follows: Zinc finger, bHLH, Myb, WRKY, Homeobox, NAC, ERF, MADS, bZIP and CBF/NF-Y/archaeal histone, which was completely different from that of Moso bamboo, and was slightly different when compared with Ma bamboo. Taking into account that Da bamboo and Ma bamboo belong to sympodial bamboo and Moso bamboo was classified as scattered bamboo, the distinctions of abundance and order of the number of transcription factor might reflect the species differences.
Table 6
The most abundant transcription factors found in D. sinicus transcriptome.
Category of domain
Number
Moso bambooa
Ma bamboob
Da bamboo
ERF
71
74
121
Myb
41
212
157
Zinc finger (Including C2H2, CCCH, GATA, PHD and LIM)
39
419
772
WRKY
37
102
157
Homeobox
33
134
156
bZIP
27
41
36
bHLH
22
126
206
NAC
22
97
145
CBF/NF-Y/archaeal histone
15
25
29
MADS
12
62
85
aThe results were cited from Peng et al. (2010);
bThe results were cited from Liu et al. (2012).
aThe results were cited from Peng et al. (2010);bThe results were cited from Liu et al. (2012).A total of 109 transcripts encoding photosynthesis were identified (Fig 9A), including photosystem I and II, cytochrome b6/f complex, photosynthetic electron transport and F-type ATPase, and 24 transcripts were characterized as antenna proteins that regarded as the main tool for capturing light of plants (Fig 9B), which imply that culms involve in the photosynthesis during its height development, and that culm photosynthesis plays a certain role in the biomass production. In addition, to confirm the reliability of transcriptome data, the expression level of 14 unigenes, including PsbA, PsaB, PetB (chloroplast-encoded genes involved in photosynthesis), PetF, Pgk, Lhca2, Lhca3, Lhca6 (nuclear-encoded genes involved in photosynthesis), AtpC (nuclear-encoded genes involved in Calvin cycle), and F5H, CAD, COMT, 4CL, HCT (associated with lignin biosynthesis) were detected using real-time quantitative PCR (Fig 10). The results showed the expression level of 14 genes accorded with the transcriptome data.
Fig 9
Unigenes of D. sinicus involved in photosynthesis (A) and antenna protein (B).
The pathways are originated from KEGG. The enzymes detected in D. sinicus transcriptome were marked with red frame in the pathway. 1.18.1.2: Ferredoxin-NADP+ reductase; 1.10.9.1: cytochrome b6-f complex iron-sulfur subunit; 3.6.3.14: F-type H+-transporting ATPase subunit a; PsbA: photosystem II P680 reaction center D1 protein; PsbC: photosystem II CP43 chlorophyll apoprotein; PsbB: photosystem II CP47 chlorophyll apoprotein; PsbK: photosystem II PsbK protein; PsbM: photosystem II PsbM protein; PsbH: photosystem II PsbH protein; PsbI: photosystem II PsbI protein; PsbO: photosystem II oxygen-evolving enhancer protein 1; PsbP: photosystem II oxygen-evolving enhancer protein 2; PsbQ: photosystem II oxygen-evolving enhancer protein 3; PsbR: photosystem II 10kDa protein; PsbS: photosystem II 22kDa protein; PsbT: photosystem II PsbT protein; PsbW: photosystem II PsbW protein; PsbY: photosystem II PsbY protein; PsbZ: photosystem II PsbZ protein; Psb28: photosystem II 13kDa protein; PsaA: photosystem I P700 chlorophyll a apoprotein A1; PsaB: photosystem I P700 chlorophyll a apoprotein A2; PsaC: photosystem I subunit VII; PsaD: photosystem I subunit II; PsaE: photosystem I subunit IV; PsaF: photosystem I subunit III; PsaG: photosystem I subunit V; PsaH: photosystem I subunit VI; PsaI: photosystem I subunit VIII; PsaK: photosystem I subunit X; PsaL: photosystem I subunit XI; PsaN: photosystem I subunit PsaN; PsaO: photosystem I subunit PsaO; PetB: cytochrome b6; PetD: cytochrome b6-f complex subunit 4; PetA: apocytochrome f; PetC: cytochrome b6-f complex iron-sulfur subunit; PetE: plastocyanin; PetF: ferredoxin; PetH: ferredoxin—NADP+ reductase; beta: F-type H+-transporting ATPase subunit beta; alpha: F-type H+-transporting ATPase subunit alpha; gamma: F-type H+-transporting ATPase subunit gamma; delta: F-type H+-transporting ATPase subunit delta; b: F-type H+-transporting ATPase subunit b; Lhca: light-harvesting complex I chlorophyll a/b binding protein; Lhcb: light-harvesting complex II chlorophyll a/b binding protein.
Fig 10
RT-qPCR validations of 14 genes involved in photosynthesis and lignin synthesis pathways.
Different letters indicate differences at P ≤ 0.05 based on the LSD (least significant difference) test. Data are means of three replicates and each replicate was measured three times. The gene names and the primers used for RT-qPCR analysis are shown in Table 7. AtpC: F-type H+-transporting ATPase subunit c; CAD: Cinnamoyl alcohol dehydrogenase; COMT: Caffeic acid-3-O-methyltransferase; HCT: Shikimate O-hydroxycinnamoyltransferase; PsbA: photosystem II P680 reaction center D1 protein; PsaB: photosystem I P700 chlorophyll a apoprotein A2; PetB: cytochrome b6; PetF: ferredoxin; Lhca2: light-harvesting complex I chlorophyll a/b binding protein 2; Lhca3: light-harvesting complex I chlorophyll a/b binding protein 3; Lhca6: light-harvesting complex I chlorophyll a/b binding protein 6; F5H: ferulate-5-hydroxylase; 4CL: 4-coumarate-CoA ligase.
Unigenes of D. sinicus involved in photosynthesis (A) and antenna protein (B).
The pathways are originated from KEGG. The enzymes detected in D. sinicus transcriptome were marked with red frame in the pathway. 1.18.1.2: Ferredoxin-NADP+ reductase; 1.10.9.1: cytochrome b6-f complex iron-sulfur subunit; 3.6.3.14: F-type H+-transporting ATPase subunit a; PsbA: photosystem II P680 reaction center D1 protein; PsbC: photosystem II CP43 chlorophyll apoprotein; PsbB: photosystem II CP47 chlorophyll apoprotein; PsbK: photosystem II PsbK protein; PsbM: photosystem II PsbM protein; PsbH: photosystem II PsbH protein; PsbI: photosystem II PsbI protein; PsbO: photosystem II oxygen-evolving enhancer protein 1; PsbP: photosystem II oxygen-evolving enhancer protein 2; PsbQ: photosystem II oxygen-evolving enhancer protein 3; PsbR: photosystem II 10kDa protein; PsbS: photosystem II 22kDa protein; PsbT: photosystem II PsbT protein; PsbW: photosystem II PsbW protein; PsbY: photosystem II PsbY protein; PsbZ: photosystem II PsbZ protein; Psb28: photosystem II 13kDa protein; PsaA: photosystem I P700 chlorophyll a apoprotein A1; PsaB: photosystem I P700 chlorophyll a apoprotein A2; PsaC: photosystem I subunit VII; PsaD: photosystem I subunit II; PsaE: photosystem I subunit IV; PsaF: photosystem I subunit III; PsaG: photosystem I subunit V; PsaH: photosystem I subunit VI; PsaI: photosystem I subunit VIII; PsaK: photosystem I subunit X; PsaL: photosystem I subunit XI; PsaN: photosystem I subunit PsaN; PsaO: photosystem I subunit PsaO; PetB: cytochrome b6; PetD: cytochrome b6-f complex subunit 4; PetA: apocytochrome f; PetC: cytochrome b6-f complex iron-sulfur subunit; PetE: plastocyanin; PetF: ferredoxin; PetH: ferredoxin—NADP+ reductase; beta: F-type H+-transporting ATPase subunit beta; alpha: F-type H+-transporting ATPase subunit alpha; gamma: F-type H+-transporting ATPase subunit gamma; delta: F-type H+-transporting ATPase subunit delta; b: F-type H+-transporting ATPase subunit b; Lhca: light-harvesting complex I chlorophyll a/b binding protein; Lhcb: light-harvesting complex II chlorophyll a/b binding protein.
RT-qPCR validations of 14 genes involved in photosynthesis and lignin synthesis pathways.
Different letters indicate differences at P ≤ 0.05 based on the LSD (least significant difference) test. Data are means of three replicates and each replicate was measured three times. The gene names and the primers used for RT-qPCR analysis are shown in Table 7. AtpC: F-type H+-transporting ATPase subunit c; CAD: Cinnamoyl alcohol dehydrogenase; COMT: Caffeic acid-3-O-methyltransferase; HCT: Shikimate O-hydroxycinnamoyltransferase; PsbA: photosystem II P680 reaction center D1 protein; PsaB: photosystem I P700 chlorophyll a apoprotein A2; PetB: cytochrome b6; PetF: ferredoxin; Lhca2: light-harvesting complex I chlorophyll a/b binding protein 2; Lhca3: light-harvesting complex I chlorophyll a/b binding protein 3; Lhca6: light-harvesting complex I chlorophyll a/b binding protein 6; F5H: ferulate-5-hydroxylase; 4CL: 4-coumarate-CoA ligase.
Table 7
Quantitative PCR validation of the RNA-seq.
Gene ID
Description
Primer
Forward (5’- 3’)
Reverse (5’- 3’)
CL15529.Contig1
Photosystem II P680 reaction center D1 protein
GCTTGTTACATGGGTCGTGA
CTTCCTTGACCGATTGGGTA
CL12609.Contig1
Photosystem I P700 chlorophyll a apoprotein A2
GGGATTACAATCCGGAACAG
AAAGGCCCAAGGTATGGAAT
Unigene28575
Cytochrome b6
GGGTCGCAATGGCTTTATT
TCCACGGTCGAACTACCAG
CL8876.Contig4
Ferredoxin
GCCCTTGCCGTTTATTAGC
TGCCAAACAGCTTTTCGTT
Unigene21914
F-type H+-transporting ATPase subunit c
TCTTTCCTAAAAGCGGTGGA
CAATGCAATAGCTTCGGTGA
CL11294.Contig1
Light-harvesting complex I chlorophyll a/b binding protein 2
CCCCAAATGAGGTGTACGTT
CATGCATTGCTCCACAATTA
CL1328.Contig1
Light-harvesting complex II chlorophyll a/b binding protein 3
GGTCTTGGGTTTGCATTGTG
GGCGAAAGCATTCATGTTG
CL9897.Contig1
Light-harvesting complex II chlorophyll a/b binding protein 6
GACTCAGAGAAGCAGCAGCA
CATGCAAGCAATGAAGCAAC
CL756.Contig1
Phosphoglycerate kinase
ACATTTCAACGGGAGGTGGT
GTTGAAGAGGGGCAAACAAG
CL1818.Contig1
Ferulate-5-hydroxylase
TTAGTTCTCGGGCCGTTAAT
CACCCACAAGCAAAAATATCAC
CL4150.Contig1
Cinnamoyl alcohol dehydrogenase
CGAGGTAGTCAAGATGGATT
ACAGCTCACGAGCATGTACC
CL9744.Contig2
Caffeic acid-3-O-methyltransferase
TTCCTCTTGTTGCTGCTCCT
AGGGAGAAACCATGGCATTA
CL15267.Contig1
4-coumarate-CoA ligase
TCGCGACATCCAAACTATGA
GTCTAGGCACTGAAGCAACA
Unigene31843
Shikimate O-hydroxycinnamoyltransferase
TTCGACCGCACGGTAATCA
AGACTGACGATGCGCTGCTT
Discussion
The significance of the BLAST comparison depends in part on the length of the query sequence, and short reads obtained from sequencing would rarely be matched to known genes [43]. In the present study, 78.71% of unigenes were annotated, which is relative high in contrast to other uncharacterized plant such as Litsea cubeba (56.00%) [37], Siraitia grosvenorii (59.90%) [26], P. heterocycla (69.75%) [19] and D. latiflorus (78.90%). The unmapped unigenes can be ascribed to the short sequence reads generated by the sequencing technology and the relatively short sequences of the resulting unigenes, most of which probably lack the conserved functional domains [44]. There are other possible reasons that some of these unigenes might be non-coding RNAs [18], and that the insufficient sequences of bamboo in public databases also influence the annotation efficiency [44]. Given the existence of species-specific genes, even among the species with high genomic synteny, many genes had big difference in their syntenic regions [45]. Thus, although the draft genome of moso bamboo [21], transcriptome data of other bamboo species [18,19] were reported, the present study is necessary to elucidate the clum development of D. sinicus.Thiel et al. (2003) [46] indicated that approximately 3–7% of expressed genes contain putative SSR motifs, mainly within the un-translated regions of the mRNA. SSRs within gene sequences may have different putative functions, for example, SSR variations in 59-untranslated regions (UTRs) could regulate gene expression by affecting transcription and translation; SSR expansions in the 39-UTRs cause transcription slippage and produce expanded mRNA; intronic SSRs can affect gene transcription, mRNA splicing, or export to cytoplasm; SSRs within genes should be subjected to stronger selective pressure than other genomic regions [47]. In the present study, approximately 9% of the 7,353 unigenes contain single sequence repeat (SSR), which is similar to that of Ma bamboo (12.8%), and is much smaller than that of Moso bamboo (24%) and rice (44%). This result might be related to species difference and sampling strategy.The synthesis of monolignols, lignin precursor, is implicated in many enzymatic reactions, which involves the general phenylpropanoid pathway starting with the deamination of phenylalanine and leading to the production of hydroxycinnamoyl CoA esters [48]. Although lignin is the most abundant phenylpropanoid derived from the hydroxycinnamoyl-CoA esters, the latter are also the precursors of a wide range of end products including flavonoids, anthocyanins and condensed tannins, which vary according to species, cell type and environmental signals [49]. In order to produce monolignols, hydroxycinnamoyl-CoA esters undergo successive hydroxylation and O-methylation of their aromatic rings involving the following enzymatic activities: shikimate O-hydroxycinnamoyltransferase (HCT); caffeoyl shikimate esterase (CSE); p-coumarate 3-hydroxylase (C3′H); caffeoyl CoA 3-O-methyltransferase (CCoAOMT); ferulate 5-hydroxylase (F5H) and caffeate/5-hydroxyferulate O-methyltransferase (COMT) [50,51].HCT uses p-coumaroyl-CoA and caffeoyl-CoA as preferential substrates to transfer an acyl group to the acceptor compound shikimic acid, yielding p-coumaroyl shikimate. Usually, the differential expression of HCT gene was involved in defense against abiotic and biotic stress, for example, down regulation of HCT gene of Leymus chinensis's leaves resulted from mechanical wounding [52], and down regulation of HCT gene was found when compared the susceptible with resisitant genotypes to leaf miner (Leucoptera coffella) [53]. Hoffmann et al. (2004) [54] pointed out that silencing of the HCT gene induced a dwarf phenotype and changes in lignin composition, suggesting that HCT catalyzes the reactions both immediately preceding and following the insertion of the 3-hydroxyl group by C3H into monolignol precursors. In this study, due to specific expression of HCT compared to other bamboos and rice, we conjecture that it might involve in the high lignin content and giant culm in D. sinicus.In comparison to most other eukaryotes, plant genomes contain a higher proportion of recently duplicated genes [55]. These duplicates are mostly derived from segmental, whole genome duplication, and tandem duplication events [56,57]. Except segmental duplication and whole genome duplication, tandem duplication, which produces duplicates that are located in close proximity, has contributed significantly to the expansion of plant gene families [58,59]. Compared with the whole genome duplication, tandem duplications have more frequent occurrence and are responsible for much of the gene copy number and allelic variation within a population [60,61]. Although each tandem duplication event only affects a small number of genes, tandemly duplicated genes constitute approximately 14% of all duplicates in Arabidopsis [58]. In particular, genes involved in stress responses have an elevated probability of retention in a single-lineage fashion following tandem duplication, suggesting that these tandem duplicates are likely important for adaptive evolution to rapidly changing environments [62]. For example, in the Eucalyptus grandis, of the tandem duplicated genes EgrHCT1-5, only EgrHCT4 and 5 are likely to be associated with developmental lignification; the other three have only residual expression in xylem and are inducible by abiotic stresses to different levels, suggesting neo- or subfunctionalization following duplication from a common ancestor [62]. In the present study, HCT gene families were divided into obviously different and regular clades, which is likely consistent with gene tandem duplication. This needs further study by quantitative analysis of gene expression.Like as arbor species with stem, bamboos have culm that originated from the mother rhizome. The culm is covered by numerous overlapping sheaths that will shed off with the culm development. The growth process of culm is very strange. It initially hid under the ground surface, however, after growth starting, reached full height within a single growth season at an amazing elongation rate, e.g. for some bamboos, of over 100 cm per day [63]. It was also observed that culm did not show any diameter increment during or after the elongation period. The diameter with which it emerges remains unchanged throughout its life [25]. Because it is leafless and enwrapped by the rigid and nontransparent sheath during the culm development, the action of reserve nutrients was considered as the main source for the growth of bamboo culm and rhizome [25]. However, the transcripts encoding photosynthesis identified from culms indicated that culms photosynthesis associated with its height development.Woody tissue photosynthesis has been hypothesized to have enabled the maintenance of biodiversity and terrestrial plant productivity throughout the Pleistocene, when atmospheric CO2 concentrations were only c. 200 ppm [64]. Even today, with atmospheric CO2 concentrations c. 400 ppm, recycling of CO2 by woody tissue photosynthesis can instantaneously offset between 7% and 98% of carbon loss in stems and branches of different species in summer, with a median of 72% [65,66]. The contribution of the woody tissue photosynthesis to the overall tree carbon balance largely differs between and even within tree species, depending on size, age and environment [67]. Irradiance is considered to be one of the major limiting factors because photosynthesis requires adequate photosynthetically active radiation to pass through the epidermal, peridermal, and/or rhytidomal layers to reach the light harvesting complexes of the chloroplasts [65,66,68]. In general, the productive months of culm emergence have days of longer photoperiod. Thus, it appears that the period of culm emergence also depend on climatic condition of locality [25]. Heavy shade of upper tree canopy inhibits bamboo regeneration and growth. It has been observed that clumps growing in the open sites produce culms of much better quality and quantity than the clumps growing under heavy shade [69]. Given that the leafless culm enwrapped by sheath and the culm usually grown under crowns, it seems that culms hardly capture enough light for assimilating carbon. According to views reported by Ávila et al. (2014) [65], the stem photosynthesis can be distinguished to two types: stem net photosynthesis (SNP), which includes net CO2 fixation by stems with stomata in the epidermis and net corticular CO2 fixation in suberized stems, and stem recycling photosynthesis (SRP), which defines CO2 recycling in suberized stems. It is widely accepted that the respiration of stem inner tissues is the CO2 source for SRP; however, labeled carbon transported upward by a xylem sap from roots to leaves is fixed in branches of Platanus occidentalis [70] and in detached branches of Populus deltoids [71], suggesting strongly that CO2 recycled by SNP or SRP may come also from the roots. Because development, maturation, and aging gradually performed from basal to top internodes, the expression pattern of functional gene among internodes diversified, which involved in up-regulated type, down-regulated type, fluctuant type, and discontinuous type. By real-time quantitative PCR analysis (Fig 10), discontinuous expression were displayed in some unigenes, including PsbA (chloroplast-encoded gene related to photosynthesis), AtpC (nuclear-encoded genes involved in Calvin cycle), and CAD, COMT, HCT (associated with lignin biosynthesis), indicating that the comlex expression pattern of genes resulted in development of D. sinicus. As has been noted, both SNP and SRP might involve in bamboo development. What’s more, the contribution rate of stem photosynthesis accounting for culm development and the carbon source of stem photosynthesis await further investigation.