Mob/oriT, a mobilizable site-specific recombination system for unmarked genetic manipulation in Bacillus thuringiensis and Bacillus cereus.

BACKGROUND: Bacillus thuringiensis and Bacillus cereus are two important species in B. cereus group. The intensive study of these strains at the molecular level and construction of genetically modified bacteria requires the development of efficient genetic tools. To insert genes into or delete genes from bacterial chromosomes, marker-less manipulation methods were employed.
RESULTS: We present a novel genetic manipulation method for B. thuringiensis and B. cereus strains that does not leave selection markers. Our approach takes advantage of the relaxase Mob02281 encoded by plasmid pBMB0228 from Bacillus thuringiensis. In addition to its mobilization function, this Mob protein can mediate recombination between oriT sites. The Mob02281 mobilization module was associated with a spectinomycin-resistance gene to form a Mob-Spc cassette, which was flanked by the core 24-bp oriT sequences from pBMB0228. A strain in which the wild-type chromosome was replaced with the modified copy containing the Mob-Spc cassette at the target locus was obtained via homologous recombination. Thus, the spectinomycin-resistance gene can be used to screen for Mob-Spc cassette integration mutants. Recombination between the two oriT sequences mediated by Mob02281, encoded by the Mob-Spc cassette, resulted in the excision of the Mob-Spc cassette, producing the desired chromosomal alteration without introducing unwanted selection markers. We used this system to generate an in-frame deletion of a target gene in B. thuringiensis as well as a gene located in an operon of B. cereus. Moreover, we demonstrated that this system can be used to introduce a single gene or an expression cassette of interest in B. thuringiensis.
CONCLUSION: The Mob/oriT recombination system provides an efficient method for unmarked genetic manipulation and for constructing genetically modified bacteria of B. thuringiensis and B. cereus. Our method extends the available genetic tools for B. thuringiensis and B. cereus strains.

Background

The Bacillus cereus group currently includes eight closely related species: B. anthracis, B. cereus, B. thuringiensis, B. cytotoxicus, B. mycoides, B. pseudomycoides, B. weihenstephanensis and B. toyenensis [1-3]. These microbial organisms are widespread in natural environments and have high economic, medical, and biodefense importance. B. cereus is a well-known food poisoning bacterium; B. thuringiensis, which produces insecticidal crystal proteins and is widely used to control agricultural pests [1]. The development of global systems biology tools, such as genome sequencing technologies and DNA microarrays, has stimulated the study of functional genes, biosynthetic gene clusters, and other aspects of cell biology [4, 5]. The intensive study of B. thuringiensis and B. cereus strains at the molecular level and construction of genetically modified bacteria requires the development of efficient genetic tools, especially vectors for targeted gene deletions and insertions.

Gene inactivation via the insertion of an antibiotic-resistance marker into a target gene is frequently used for functional analyses. However, when a single strain is manipulated repeatedly, the small number of convenient selectable markers limits the application of this approach. Moreover, since operons are common in bacterial genomes, the insertion of a marker gene can alter the expression of adjacent genes. Third, genetically modified bacteria containing antibiotic-resistance genes are not desirable in production systems, because the antibiotic resistance represents a contaminant of the final product and carries the risk of horizontal gene transfer of antibiotic-resistance genes to the environment. Therefore, a method of inserting genes into or deleting genes from bacterial chromosomes without leaving selection markers is a significant advantage. The approaches have been established in some microorganisms by the utilization of recombinase-mediated recombination systems. Various site-specific recombination systems are used, e.g., the FLP/FRT recombination system of Saccharomyces cerevisiae [6-8], the Cre/loxP recombination system from Escherichia coli bacteriophage P1 [9, 10], and the Xer/dif recombination system based on endogenous Xer recombinases [11, 12]. In all of these systems, two different or identical recognition sites act as the DNA substrate for the recombinase, and a single recombination site remains within the target locus. The FLP/FRT and Cre/loxP systems require many time-consuming steps, including the construction of an exogenous recombinase FLP or Cre in a replicative plasmid, the introduction of the plasmid, recombinase expression in the transformant, and elimination of the replicative plasmid [7, 10]. Moreover, the FLP/FRT system is not efficient in some slow-growing bacteria [8]. The Xer/dif system utilizes the endogenous recombinase Xer to recognize and resolve dif sites to excise antibiotic resistance genes. However, Xer recombinases and the relevant dif sites differ among bacteria, and some Xer systems include two recombinases [13], while others include one recombinase [12, 14].

Relaxase and oriT are critical for the transfer of both conjugative plasmids and mobilizable plasmids [15]. The origin of transfer, or oriT sequence, is the only component that should be provided by the mobilizable plasmid in cis. The relaxase, which is also called a Mob protein in a mobilizable plasmid, catalyzes the initial and final stages of conjugation. In addition, to their nicking activity necessary for mobilizing plasmids, certain relaxases can catalyze recombination between two oriT sequences, including NikB (R64), TrwC (R388), MobA (R1162), Mob02281 (pBMB0228), and Mob02282 (pBMB0228) [16-19]. This recombination event can mediate the deletion of a target DNA region between two oriT sequences. Accordingly, owing to their functions in conjugation and recombination, relaxases have been used for various purposes, e.g., to construct transfer vectors [20, 21] and for oriT-directed cloning of large bacterial genomic regions [22]. However, relaxase-mediated mechanisms have not been used for unmarked genetic manipulation.

In a previous study, we confirmed that Mob02281 and Mob02282 not only have mobilization ability, but also mediate the resolution and formation of plasmid pBMB0228 from B. thuringiensis strain YBT-1518, the mechanism is oriT site-specific recombination [19]. Mob02281 has a higher mobilization efficiency and recombination ability than Mob02282 [19]; accordingly, we used it to develop novel molecular tools, and demonstrated the potential application of this method to other bacterial taxa.

Results

Relaxase Mob02281 can transfer a target gene into B. thuringiensis and B. cereus strains

To test whether Mob02281 can transfer a target gene into B. thuringiensis and B. cereus strains, the plasmid cry6Aa-pHTMob02281, which contains cry6Aa as a reporter, was constructed. The cry6Aa gene can produce rice-shaped crystals and encodes a 54-kDa protein [23]. The plasmid pHTMob02281 was used in parallel and was treated similarly to cry6Aa-pHTMob02281. Using the conjugative plasmid pAW63::Tn5401, cry6Aa-pHTMob02281 and pHTMob02281 could be transferred to all recipient B. thuringiensis and B. cereus strains with a transfer efficiency ranging from 10−7 to 10−5 transconjugants/donor (Table 1). Based on phase-contrast microscopy, all transconjugants containing cry6Aa-pHTMob02281 produced rice-shaped crystals, and SDS-PAGE showed that all transconjugants containing cry6Aa-pHTMob02281 produced parasporal crystals with a 54-kDa band representing Cry6Aa (Fig. 1).

Table 1

Transfer efficiency of cry6Aa-pHTMob02281 and pHTMob02281 in B. thuringiensis and B. cereus strains

Plasmid donors	Recipients	Efficiency	Plasmid donors	Recipients	Efficiency
	BMB171Str	4.5 × 10−5		BMB171Str	3.4 × 10−5
	YBT1520Str	8.2 × 10−6		YBT1520Str	9.3 × 10−6
cry6Aa-pHTMob02281	CT-43::Kan	3.0 × 10−5	pHTMob02281	CT-43::Kan	2.8 × 10−5
	UW85R	2.3 × 10−5		UW85R	2.7 × 10−5
	BC10987Str	5.3 × 10−6		BC10987Str	7.0 × 10−6

Transfer efficiency = transconjugants/donor cells

Fig. 1

Parasporal crystals and protein expression of cry6Aa in transconjugants. a Phase-contrast microscopy image of parasporal crystals and spores produced in transconjugants. The red arrow indicates the rice-shaped crystals encoded by cry6Aa. The yellow arrow indicates the diamond-shaped crystals encoded by the endogenous crystal genes for YBT1520Str [5] and CT43::Kan [40]. b Protein analysis of the transconjugants by SDS-PAGE. The red arrow indicates the 54-kDa protein produced by cry6Aa. 1 BMB171Str/cry6Aa-pHTMob02281. 2 BMB171Str/pHTMob02281. 3 YBT1520Str/cry6Aa-pHTMob02281. 4 YBT-1520Str/pHTMob02281. 5 CT-43::Kan/cry6Aa-pHTMob02281. 6 CT-43::Kan/pHTMob02281. 7 UW85R/cry6Aa-pHTMob02281. 8 UW85R/pHTMob02281. 9 ATCC 10987Str/cry6Aa-pHTMob02281. 10 ATCC 10987Str/pHTMob02281. M Protein molecular weight marker

Relaxase Mob02281 mediates the excision of the resistance marker between the 24-bp core oriT sites

To decrease the influence of DNA remnants after Mob02281-mediated recombination, we identified the minimal oriT sequence required for Mob02281-mediated recombination. Using the previous recombination system [19], we performed a series of deletions in one or both oriTs (352-bp oriT1 and 370-bp oriT2) of the substrate plasmid pBMBT10. The pBMBmob1 plasmid containing Mob02281 was used as a helper plasmid. As shown in Fig. 2, deletions at the two oriT sites had different effects on recombination activity. Compared with the high recombination frequency observed when the substrate plasmid contains bp 1–352 of oriT1 and bp 1–370 of oriT2, the recombination frequency exhibited a sharp decrease when inverted repeat IR1 and IR2 were deleted from oriT2. Surprisingly, it showed a relatively higher recombination frequency when the substrate plasmid contains bp 1–352 of oriT1 and bp 273–297 of oriT2 having only 24 bp spanning IR6. However, by remaining the 370-bp oriT2 sequence unchanged, the deletion of oriT1 had a strong influence on recombination frequency.

Fig. 2

Effects of oriT deletions on Mob02281-mediated recombination. The 1–352 bp oriT1 and 1–370 bp oriT2 segments are numbered. The structures were shown in [37]. Arrows indicate the presence of inverted repeats (IRs). The nic site is indicated as a vertical arrowhead. The arrangements of the two oriT sequences with or without deletion mutations in each substrate plasmid are listed. Deleted oriT was cloned at the corresponding site into pBMBT10. pBMBmob1 was used as a helper plasmid containing the gene encoding a mobilization protein. The frequency of oriT-specific recombination for each substrate plasmid was estimated following the methods described in [37]

When the substrate plasmid contains bp 258–282 of oriT1 and bp 273–297 of oriT2 (i.e., only 24 bp of inverted repeat sequences, including the nic site), recombination was observed (Fig. 3). A schematic diagram of substrate construction is shown in Fig. 3a. Additionally, fluorescent BMB171 (pBMBTmini + pBMBmob1) cells were observed under phase contrast microscopy and fluorescence microscopy after recombination (Fig. 3b). Single SpcS colonies were confirmed by a restriction analysis (Fig. 3c) and sequencing (Additional file 1: Fig. S1). When the cultures were grown for 20 generations, three SpcS colonies out of 200 total colonies were obtained. Although this was a low level of recombination, it was sufficient to obtain a recombined plasmid. With additional generations, more SpcS colonies were obtained. When the cultures were grown for 100 generations, nine SpcS colonies out of 100 colonies were obtained (Fig. 3d). These results indicate that the Mob02281/mini-oriT (24 bp of oriT1 and 24 bp of oriT2) system can mediate target gene deletion.

Fig. 3

Recombination frequency of pBMBTmini. a Structure of the recombination cassette and the resulting product after recombination. Arrows indicate the direction of transcription; spc spectinomycin-resistance gene, Pgfp the promoter of the kanamycin-resistance gene, gfp gene encoding green fluorescent protein. b Observation of BMB171 (pBMBTmini + pBMBmob1) before and after recombination. PC phase-contrast microscopy; GFP fluorescence microscopy. Bar indicates 10 μm. c Restriction enzyme digestion of substrate plasmid before and after recombination; M1 λDNA/HindIII marker; M2 Trans2 K Plus DNA marker.1, before recombination, substrate plasmid pBMBTmini; 2–3, from two single SpcS colonies after recombination; 4, before recombination, substrate plasmid pBMBTmini, digested with BamHI; 5–6, from two single SpcS colonies after recombination, digested with BamHI; v vector, 6.5 kb; nr non-recombined cassette, 2.6 kb. r recombined cassette, 1.3 kb. d Increase of the percentage of antibiotic-resistance excision colonies over the number of generations

Construction of a Ts mobilizable site-specific recombination vector for unmarked genetic manipulation

We confirmed the mobilization ability of the Mob02281 module and site-specific recombination mediated by Mob02281. We then constructed a modular vector, pRec-mob1-Ts, to facilitate the use of these components for the genetic manipulation of B. thuringiensis and B. cereus strains. The crucial element of this modular plasmid is the Mob-Spc cassette, which contains the Mob02281 mobilizable module and a spectinomycin-resistance gene, flanked by the two 24-bp oriT core sites in the same orientation and multiple restriction sites for subcloning the homologous arms of the target gene (Fig. 4).

Fig. 4

Map of the temperature-sensitive-mobilizable recombination vector pRec-mob1-Ts. Arrows indicate the direction of transcription or replication. The Mob-Spc cassette is shown in red, including the spectinomycin-resistance gene (spc), the mob02281 gene, and the two mini-oriT sites (24-bp). The orientations of the replication of E. coli (ori.Ec) and the ampicillin-resistance gene (amp) are shown in light green; the orientations of the replication of B. thuringiensis and the erythromycin-resistance gene (erm) are shown in purple. The purple box flanking ori.Bt (Ts) indicates that the replication orientation of the temperature-sensitive replication region of B. thuringiensis is not known

Construction of an integration vector for unmarked genetic manipulation

To develop a universal integration vector for target gene or gene cluster expression in B. thuringiensis and B. cereus strains, a putative amylase gene was used because it is not essential and is conserved in B. thuringiensis and B. cereus. The amyE upstream and downstream homologous arms separated by the Mob-Spc cassette were constructed to disrupt amylase based on pRec-mob-Ts (Fig. 5a), generating the integration vector plasmid pBMB0260. Then, pBMB0260 was used to transform B. thuringiensis BMB171 by electroporation. BMB0260::MobSpc was obtained by using the spectinomycin-resistance gene as the selection marker. The unmarked mutant strain BMB0260 was then obtained by culturing BMB0260::MobSpc in LB medium at 28 °C; after approximately 30 generations, two spectinomycin-sensitive colonies were obtained and confirmed by PCR using primers outside the homologous arms (Fig. 5b). The PCR product was sequenced to confirm that BMB0260 was constructed by replacing a 297-bp internal amyE gene fragment with a 36-bp segment that contains the 24-bp oriT and two 6-bp restriction sites (Fig. 5c).

Fig. 5

Design and confirmation of amyE disruption in B. thuringiensis BMB171. a Depiction of amyE disruption. b PCR detection with primers amyE-wS and amyE-wA. DNA templates were from: 1 pBMB0260 (negative control); 2 BMB171; 3 amyE gene-disruption strain BMB0260; M Trans2 K Plus II DNA marker; c Sequence analysis of the deletion region of BMB0260

We tested the α-amylase activity of the amyE mutant strain BMB0260 using a starch-plate assay. Two single colonies of BMB0260 exhibited a circle indicating starch hydrolysis that was similar to that of BMB171, which carried an intact amylase gene (Additional file 1: Fig. S2). Based on the genome sequence analysis, we found that there are two putative amylase genes in most B. thuringiensis and B. cereus strains, such as BMB171_C1018 encoding alpha-amylase and BMB171_C3160 encoding cytoplasmic alpha-amylase in BMB171. The deleted BMB171_C1018 gene was a putative alpha amylase, but its α-amylase activity has not been confirmed. This result suggests that this amylase gene has very low or no activity.

Unmarked integration of cry5Ba or cry2Aa at the amylase locus

The plasmids pBMB0261 and pBMB0262 respectively containing cry5Ba gene and cry2Aa expression cassette were used to transform B. thuringiensis BMB171 (Fig. 6a, b). After the Mob-spc insertion mutants were obtained, the unmarked integration mutants were generated following similar methods to those for amyE disruption, and a similar Mob-spc cassette excision event for the two cry integration mutants occurred. The excision frequencies of the MobSpc cassette in BMB0261::MobSpc (3 out of 100 colonies) and BMB0262::MobSpc (2 out of 100 colonies) were similar to that of BMB0260::MobSpc. Using PCR, we confirmed that the cry gene expression cassettes were integrated at the amyE site, together with the oriT fragment, in the unmarked BMB0261 and BMB0262 mutants (Fig. 6c, d). The PCR products were sequenced to confirm that BMB0261 and BMB0262 were properly constructed by integrating the 4646-bp cry5Ba gene and the 3939-bp cry2Aa expression cassette at the amyE locus flanking the 24-bp oriT2/1 site.

Fig. 6

Construction of crystal protein gene insertion mutants BMB0261 and BMB0262. Depiction of cry5Ba (a) and cry2Aa (b) insertion. PCR detection with primers amyE-wS and amyE-wA (c) and 5B-S and 5B-A (lanes 1–4) or 2A-S and 2A-A (lanes 5–8) (d); DNA templates were from: 1, pBMB0261 (negative control); 2 and 6, BMB171; 3–4, mutant BMB0261; 5, pBMB0262 (negative control); 7–8, mutant BMB0262; M Trans2 K Plus II DNA marker. e Scanning electron microscopy image of parasporal crystals in unmarked cry integrate mutants. 1, BMB171/cry5Ba-pHT304; 2–3, BMB0261; 4, YBT-1518; 5, BMB171/cry2Aa-pHT304; 6–7, BMB0262; 8, CT-43; 9, BMB171. The arrows indicate the diamond-shaped crystals encoded by cry5Ba and the round-shaped crystals encoded by cry2Aa. Bar indicates 1 μm

Based on phase-contrast microscopy and scanning electron microscopy of the two cry integration mutants, the BMB0261 strains produced diamond-shaped crystals, and the BMB0262 strains produced round-shaped crystals (Fig. 6e; Additional file 1: Fig. S3A). Compared with the recombinant strains BMB171/cry5Ba-pHT304 and BMB171/cry2Aa-pHT304, in which the cry genes were cloned into the pHT304 vector, and the resulting plasmids were used to transform BMB171, the crystals produced by BMB0261 and BMB0262 were much smaller. This may be because the copy number of the plasmid vector pHT304 is much higher than a one-copy chromosome. Based on SDS-PAGE, protein expression is lower in BMB0261 and BMB0262 than the recombinant stains BMB171/cry5Ba-pHT304 and BMB171/cry2Aa-pHT304, which supports this interpretation (Additional file 1: Fig. S3B). The development of the integration strains BMB0261 and BMB0262, results in bacterial production of insecticidal crystal proteins, especially for cry5Ba, which is silent in its original strain YBT-1518.

Unmarked disruption of a seryl-AMP synthetase gene in zwittermicin A biosynthetic gene cluster

To test whether this Mob/oriT recombination system could be used for the unmarked disruption in B. cereus, the zmaJ gene, which encodes seryl-AMP synthetase involved in (2S) amino malonyl-ACP formation in the zwittermicin A (ZmA) biosynthetic gene cluster [24] was selected as a deletion target. Plasmid pBMB0263 was constructed to disrupt zmaJ using pRec-mob-Ts (Fig. 7a). The unmarked integration mutants were generated following similar methods to those for amyE disruption and cry gene insertion. The unmarked integration mutants were confirmed by PCR using primers outside the homologous arms (Fig. 7b). The excision frequencies of the MobSpc cassette in BMB0263::MobSpc (3 out of 100 colonies) were similar to that of BMB0260::MobSpc. The PCR product was sequenced to confirm that BMB0263 was constructed by replacing a 1341-bp internal zmaJ gene fragment with a 36-bp segment containing the 24-bp oriT and two 6-bp restriction sites. As shown in Fig. 7c, using high resolution LC–MS to detect the production of ZmA, the zmaJ deletion mutant BMB0263 cannot produce ZmA, unlike UW85R. Thus, gene deletion via Mob-mediated recombination is feasible in B. cereus. In addition, complementation of zmaJ via pEMB0603-zmaJ to BMB0263 rescued the wild-type phenotype.

Fig. 7

Design and confirmation of zmaJ disruption in B. cereus UW85R. a Depiction of zmaJ disruption. b PCR detection with primers zmaJ-wS and zmaJ-wA. DNA templates were from: 1, UW85R; 2, zmaJ gene-disrupted strain BMB0263; 3, pBMB0263 (negative control); M, DNA Marker III. c LC–MS detection of a molecular weight corresponding to ZmA in the culture supernatants. The molecular weight corresponding to ZmA is indicated by a rectangular frame

Discussion

Several B. thuringiensis and B. cereus strains have low electroporation efficiency or are not competent for transformation [25, 26], thus rendering DNA transfer by conjugation is the method of choice. To test the mobilization ability of Mob02281 into various B. thuringiensis and B. cereus strains, the previously constructed mobilizable plasmid pHTMob02281, which contains Mob02281 with oriT1, was used [19]. The successful transfer of pHTMob02281 into various B. thuringiensis and B. cereus strains was confirmed. Thus, pHTMob02281 can be used as a mobilizable shuttle vector for gene expression. We also confirmed its mobilization ability during the construction of an in-frame zmaJ deletion mutant in B. cereus UW85R. Therefore, this Mob02281/oriT system provides an alternative approach for genetic manipulations in these strains, which have rather low electroporation efficiencies.

Using this approach, the spectinomycin-resistant gene can be used to screen the Mob-Spc cassette integration mutants at the target locus. Antibiotics can be added to the medium to ensure that the excision of the cassette does not occur prematurely. Increasing the number of generations can increase the recombination frequency, and the excision of the Mob-Spc cassette occurs at the optimum growth temperature for B. thuringiensis and B. cereus strains.

We temporarily inserted an antibiotic resistance cassette flanked by pBMB0228 oriT sites oriented as direct repeats into a specific genomic region and subsequently removed it using the Mob/oriT system. The absence of the antibiotic resistance markers assures that cell physiology is not altered by known or unrecognized activities of resistance genes or antibiotic drugs. The cry5Ba gene is a nematicidal protein gene, but it is silent in its original strain YBT-1518 [23], and cry2Aa cassette encodes proteins that form insecticidal crystal proteins active against lepidopteran and dipteran larvae [27]. Using this unmarked system, we constructed cry5Ba and cry2Aa integration strains in B. thuringiensis BMB171. The two strains with cry integration can be used as genetically modify bacteria for the production the insecticidal crystal proteins because they avoid contamination and the risk of antibiotic resistance gene transfer to the environment. Although the protein expression is lower in the two strains with cry integration than the recombinant strains containing the cry genes maintained in a plasmid vector because the copy number of a one-copy chromosome is much less than the plasmid vector, the protein production can be improved by replacing the original promoter with a strong promoter to express the cry genes. In the long term, the cry gene integrated in the chromosome is much stable than maintained in a plasmid vector. Thus, Mob/oriT system provides an efficient marker-free approach for constructing genetically modify bacteria.

The zmaJ gene within the operon of the ZmA biosynthetic gene cluster was selected as a target for deletion. Complementation of zmaJ to the zmaJ deletion strain rescued the wild-type phenotype. This result suggests that the 36-bp DNA remnants after Mob02281-mediated recombination did not affect the expression of other genes in the operon.

In all current site-specific recombination systems, including the FLP/FRT system [6-8], Cre/loxP system [9, 10], Xer/dif system [11, 12], and Relaxase/oriT system [16, 28], a single recombination site remains within the target region, and undesired recombination might occur between recombination sites that accumulate after multiple rounds of gene disruption. In the Cre/loxP system, Cre recombinase activity was limited to produce defined recombination events in strains containing multiple loxP sites [10]. The combination of these systems may resolve these issues when multiple genes are manipulated in a target strain. In this study, to minimize undesired recombination using the Mob02281/oriT system, we used the original promoter, rather than an inducible strong promoter, to express Mob02281.

A TnpI-mediated recombination system has been used to construct genetically engineered B. thuringiensis strains. The cry1C gene is introduced and maintained in a plasmid vector whose antibiotic resistance genes are flanked by two internal resolution sites. The antibiotic resistance genes of the plasmid are then eliminated by TnpI-mediated recombination between the two internal resolution sites [29]. However, the long-term stability of cry1C expression is an issue. Moreover, this method has not been assessed with respect to gene deletion. In B. anthracis, the Cre/loxP system can be used to efficiently inactivate individual genes and facilitate large deletions [10]. In this approach, two temperature-sensitive plasmids are electroporated into the target strain. One contains a resistance cassette flanked by loxP sites and is used to temporarily insert the resistance gene into a selected genomic region based on homologous sequences. The other expresses the Cre recombinase and is used to remove the resistance gene after recombination between loxP sites [10]. This process cannot be applied to some wild-type B. cereus group strains in which electroporation are inefficient.

We also tested the recombination ability of the Mob02281/oriT system in other bacterial taxa; its inefficiency in E. coli indicated that it might have specific host requirements. However, in addition to Mob02281, certain relaxases can catalyze site-specific recombination between two oriT copies, including NikB of plasmid R64 [16], TrwC of plasmid R388 [17], MobA of plasmid R1162 [18] from Gram-negative bacteria, MobB and MobE of plasmid pAMα1 [30], and the Mobs of plasmid pE194 and pT181 [31] from Gram-positive bacteria. Therefore, future studies should examine various relaxase/oriT elements to extend the applications of this alternative recombination system for unmarked genetic manipulations to a wider range of taxa, including both Gram-negative and Gram-positive bacteria.

Conclusions

The Mob/oriT mobilizable recombination system can be exploited for unmarked genetic manipulation and construction of genetically modify bacteria in B. thuringiensis and B. cereus. Using this system, the recombination vectors were constructed and the application was tested by in-frame deletion in B. thuringiensis and B. cereus and insertion the interested gene into chromosome in B. thuringiensis. We also confirmed the putative amylase gene can be used as integration site for gene expression in B. thuringiensis and B. cereus.

Methods

Bacterial strains, plasmids, growth conditions, and DNA manipulations

The strains and plasmids used in this study and their sources are listed in Table 2. E. coli was cultured in LB medium at 37 °C, and all B. thuringiensis and B. cereus strains were cultured in LB medium at 28 °C. Spectinomycin, tetracycline, erythromycin, kanamycin, ampicillin, rifampin, and streptomycin were added to the media at final concentrations of 100, 10, 25, 50, 100, 100, and 100 μg/mL, respectively. All regular DNA manipulations were carried out following standard methods [32]. All recombinant plasmids were constructed in E. coli, and plasmids were extracted from E. coli according to the methods of Sambrook and Russell [32]. PCR products were confirmed by DNA sequencing. Primers used for PCR amplification are listed in Table 3.

Table 2

Bacterial strains and plasmids used in this study

Strains or plasmids	Descriptiona	Reference
Bacillus thuringiensis strains
AW48	Derivative of wild-type isolate HD73 cured of pHT73, containing pAW63::Tn5401, Tetr	[36]
BMB0260	Mutant of strain BMB171 in which the amyE gene is interrupted by in-frame deletion	This study
BMB0261	Mutant of strain BMB171 in which the cry5Ba gene is inserted in the amyE locus	This study
BMB0262	Mutant of strain BMB171 in which the cry2Aa expression cassette is inserted in the amyE locus	This study
BMB171	Acrystalliferous mutant of B. thuringiensis	[39]
BMB171Str	Streptomycin spontaneous mutant strain of BMB171, Strr	This study
YBT-1520Str	Streptomycin spontaneous mutant strain of B. thuringiensis serovar kurstaki YBT-1520, Strr	This study
CT-43	No flagellum, containing cry2Aa expression cassette and thuringiensin synthesis cluster	[40]
CT-43::Kan	Mutant of strain CT-43 in which the thuE gene is interrupted by the kanamycin-coding gene, also named BMB0545, Kanr	[41]
Bacillus cereus strains
ATCC 10987Str	Streptomycin spontaneous mutant strain of B. cereus ATCC 10987, Strr	This study
UW85	Wild type B. cereus strain, ZmA producing	[24]
UW85R	Rifampin spontaneous mutant resistance strain of B. cereus UW85, Rifr	This study
BMB0263	Mutant of strain UW85R in which the zmaJ gene is interrupted by in-frame deletion	This study
Escherichia coli strains
DH5α	F-φ80lacZΔM15 Δ(lacZYA-argF) U169 deoR recA1 endA1 hsdR17 (rk-,mk+) phoA supE44 λ- thi-1 gyrA96 relA1	Invitrogen
Plasmids
pAW63::Tn5401	A self-transmissible plasmid generated by insertion of the tetracycline-resistance transposon Tn5401 in pAW63, Tetr	[36]
pBMB0215	A recombinant plasmid harboring a 4.6-kb HindIII fragment including cry5Ba	[23]
pBMB0228	17,706-bp endogenous plasmid in strain YBT-1518	[19, 42]
pBMBmob1	pEMB0603 containing a 1.8-kb BamHI/SphI fragment carrying mob02281	[19]
pBMBT10	pHT315 containing the recombination cassette with bp 1–352 of oriT1 and bp 1–370 of oriT2	[19]
pBMBT11	pHT315 containing the recombination cassette with bp 1–352 of oriT1 and bp 156–370 of oriT2	This study
pBMBT12	pHT315 containing the recombination cassette with bp 1–352 of oriT1 and bp 273–370 of oriT2	This study
pBMBT13	pHT315 containing the recombination cassette with bp 1–352 of oriT1 and bp 273–297 of oriT2	This study
pBMBT14	pHT315 containing the recombination cassette with bp 65–282 of oriT1 and bp 1–370 of oriT2	This study
pBMBT15	pHT315 containing the recombination cassette with bp 188–282 of oriT1 and bp 1–370 of oriT2	This study
pBMBT16	pHT315 containing the recombination cassette with bp 258–282 of oriT1 and bp 1–370 of oriT2	This study
pBMBTmini	pHT315 containing the recombination cassette as in pBMBT10 [19] with the 24-bp core sequence of oriT1 and 24-bp core sequence of oriT2	This study
pEMB0603	E. coli and B. thuringiensis shuttle vector, Ampr, Kanr	[35]
pEMB0603-zmaJ	pEMB0603 containing a 2.1 kb EcoRI/SalI fragment carrying the coding sequence of the seryl-AMP synthetase gene ZmaJ with the promoter of kanamycin resistance gene	This study
pHT315	E. coli and B. thuringiensis shuttle vector, Ampr, Ermr	[43]
pHT304	E. coli and B. thuringiensis shuttle vector, Ampr, Ermr	[43]
pHT304Ts	E. coli and B. thuringiensis shuttle vector, containing a temperature-sensitive replicon in B. thuringiensis, Ampr, Ermr	[35]
pHTMob02281	pHT304 containing a 1.8-kb HindIII fragment carrying mob02281 and oriT1	This study
pIC333	An efficient mini-Tnl0 delivery vector in B. subtilis, Spcr, Ermr	[33]
pRec-mob1-Ts	pHT304Ts containing the Mob-Spc cassette and 24-bp core oriT recombination sequence, Ampr, Ermr, Spcr	This study

a Amp ampicillin resistance, Erm erythromycin resistance, Kan kanamycin resistance, Tet tetracycline resistance, Spc spectinomycin resistance, Str streptomycin resistance, Rif rifampin resistance

Table 3

Primers used in this study

Primers	Sequencea (5′–3′)	Construct(s) or use
oriT1-1S	CGAGAATTCGTAAGCGGAACGAAGTG	PCR amplification of bp 1–352, 65–282 and 188–282 of oriT1
oriT1-65S	CGAGAATTCTGTTAAAACGGTTACCGTTTTG
oriT1-352A	CAGGTCGACCTACATGAGCCACGATCAATC
oriT1-282A	CAGGTCGACTTTGGTCTAGCACGTTATACC
oriT1-188A	CAGGTCGACGACTTTGTCCGAACCTACAAG
oriT2-1S	TATGCATGCCAAAGGTACCGGACCGAACC	PCR amplification of bp 1–370, 156–370 and 273–370 of oriT2
oriT2-370A	CAGAAGCTTGAACGTGAGCCATGAGCGAG
oriT2-156S	TATGCATGCGAAGGGGGTCAAGGGGAATT
oriT2-273S	TATGCATGCATTTGGTATAACGTGCTAGAC
oriT1-24-S	TATGAATTCTTTGGTATAACGTGCTAGACCAAATCTGACGCTCAGTGG	pBMBT13, pBMBT16 and pBMBTmini
oriT2-24-A	CCCAAGCTTTATGGTCTAGCACGTTATACCAAAAAATGTCACTAATATT
MS	GAATTCGGATCCGAGCTCCTCGAGAGATCTTTTGGTCTAGCACGTTATACCAAAGTGTGTTCTTAATATTGTATG	pRec-mob1-Ts
MA	CGCGTCGACGCATGCGATTACAACAAGTCTATTCAG
SS	CGCGCATGCTCTGACGCTCAGTGGAAC
SA	GTCGACCCATGGGCTAGCGGTACCCGGGTTTGGTATAACGTGCTAGACCATACTATGCAAGGAACAATTTC
amyE-up-S	CGCGAATTCATGCGTTTCTCTCGGATAATTGG	BMB0260, BMB0261 and BMB0262
amyE-up-A	CTCGGATCCCTTCCGTCTAAATCAACTTC
amyE-down-S	CGCGTCGACGTTAACATCACCTGGGATTC
amyE-down-A	GCCAAGCTTTCATCTACGCTTCCTTTTAACTG
amyE-wS	GTGCCAATCCTGGTGTCATC
amyE-wA	GAAAATCCTCTTCCTAACCTG
5B-S	GGGTATACAAGAAGGTTGGG	cry5Ba detection
5B-A	CGTTTTCTGGTACAAGTTCC
2A-S	GCCGAATTCGATGTTGATTCTTAGAGCAATG	BMB0262
2A-A	GGCGAATTCGGTTAACTTGAAATGATTTCTCC
zmaJ-up-S	CGGGAATTCCATTGGTAGACCAGGATTTGC	BMB0263
zmaJ-up-A	CATGGATCCTCCACCTTCACGTAAAAGACG
zmaJ-down-S	CGGGGTACCGTACTTGCCTTATTAGGTTCCG
zmaJ-down-A	CACGTCGACACTTACACGAAGTGGTGGTG
zmaJ-wS	CAGCTGCTGATGTGTTTTTGG
zmaJ-wA	CTCAACTACCATAATAGTGTC
pKan-S	CCGGAATTCCATTTGAGGTGATAGGTAAG	pEMB0603-zmaJ
pKan-zmaJ-A	TATACATGTACTCATTTTAATAACCTCCTTTCTCTAGACCCCAAGAAGCTAATTATAAC
pKan-zmaJ-S	ATTAGCTTCTTGGGGTCTAGAGAAAGGAGGTTATTAAAATGAGTACATGTATACAAAAG
zmaJ-A	ACGCGTCGACTTATGAATCTTTACTGCTTTC

aRestriction sites included in oligonucleotide sequences are italicized

Transformation of E. coli and B. thuringiensis

E. coli transformation was carried out using CaCl2-treated competent cells, as described by Sambrook [32]. B. thuringiensis transformation was performed by electroporation with the Bio-Rad Gene Pulser (Hercules, CA, USA) with previously described settings [25].

Plasmid construction

To decrease the influence of DNA remnants after Mob02281-mediated recombination, we identified the minimal oriT sequence required for Mob02281-mediated recombination. Using the previous recombination system [19], we performed a series of deletions in one or both oriTs (352-bp oriT1 and 370-bp oriT2) of the substrate plasmid pBMBT10.

The substrate plasmids pBMBT11, pBMBT12, pBMBT13, pBMBT14, pBMBT15, pBMBT16 and pBMBTmini was constructed with a similar organization to that of pBMBT10 [19]. The truncated oriT1 fragments containing bp 1–352, 65–282 and 188–282 were respectively amplified from pBMB0228 using the primer pair oriT1-1S/oriT1-352A, oriT1-65S/oriT1-282A, oriT1-188S/oriT1-282A. The truncated oriT2 fragments containing bp 1–370, 156–370 and 273–370 were respectively amplified from pBMB0228 using the primer pair oriT2-1S/oriT2-370A, oriT2-156S/oriT2-370A and oriT2-273S/oriT2-370A. Plasmids pBMBT11, pBMBT12 and pBMBT13 were constructed by remaining the bp 1–352 oriT1 unchanged, and respectively containing the bp 156–370, 273–370, and 273–297 of oriT2. Plasmids pBMBT14, pBMBT15 and pBMBT16 were constructed by remaining the bp 1–370 of oriT2 unchanged, and respectively containing the bp 65–282, 188–282 and 258-282 of oriT1. Plasmid pBMBTmini contains 24-bp core oriT1 and 24-bp core oriT2 sequences. The two 24-bp core oriT sequences in the same orientation flanking a spectinomycin-resistance marker were amplified with the primer pair oriT1-24-S/oriT1-24-A using pBMBT10 as a template. Other construction steps of these substrate plasmids were similar to those described previously for the construction of pBMBT10 [19].

The mobilizable module, which comprised the mob02281 gene and a 352-bp oriT1 region overlapping its promoter, was amplified from pBMB0228 using the primer pair MS/MA, and the spectinomycin-resistance gene (a selection marker) was amplified from pIC333 [33] using the primer pair SS/SA. The 1.9- and 1.3-kb PCR products were digested with EcoRI/SphI and SphI/SalI, respectively, and cloned into the EcoRI/SalI sites of the Ts vector pHT304Ts, generating the Ts mobilizable site-specific recombination vector pRec-mob-Ts. Multiple restriction sites were introduced into pRec-mob-Ts with primers by PCR amplification.

To generate the complementation plasmid pEMB0603-zmaJ, the promoter of kanamycin resistance gene was amplified from pBMBT10 using the primer pair pKan-S/pKan-zmaJ-A, and the coding region of the zmaJ gene was amplified from B. cereus UW85 genomic DNA using the primer pair pKan-zmaJ-S/zmaJ-A. Using overlap PCR with the primer pair pKan-S/zmaJ-A, a PCR fragment containing the coding region of zmaJ and a promoter of the kanamycin resistance gene was generated. Then, this 2.1-kb PCR fragment was digested with EcoRI/SalI and inserted into the same sites of the shuttle vector pEMB0603, resulting in plasmid pEMB0603-zmaJ.

Construction of unmarked mutant strains BMB0260, BMB0261, BMB0262, and BMB0263

To generate the amyE mutant strain BMB0260, two primer pairs, amyE-up-S/amyE-up-A and amyE-down-S/amyE-down-A, were used to amplify the upstream and downstream homologous arms of the amyE gene from BMB171 genomic DNA. The 566- and 529-bp fragments were digested with EcoRI/BamHI and SalI/HindIII, respectively, and cloned into the corresponding sites of pRec-mob-Ts one by one, generating pBMB0260.

To demonstrate that the Mob/oriT recombination system could be used to introduce a gene of interest, plasmids pBMB0261 and pBMB0262, containing cry5Ba and cry2Aa (together referred to as cry genes), were constructed based on the integrative vector pBMB0260. The cry5Ba gene was digested with HindIII from its plasmid pBMB0215 [23] and inserted into the HindIII site of pBMB0260. The cry2Aa expression cassette containing orf1, orf2 and cry2Aa [34] was amplified using the primer pair 2A-S/2A-A from B. thuringiensis CT-43, digested with EcoRI, and inserted into the EcoRI site of pBMB0260. The resulting plasmids pBMB0261 and pBMB0262 contains cry genes and could be integrated into the amyE locus via the amyE homologous arms (Fig. 6a, b).

To generate the zmaJ mutant strain BMB0263, two primer pairs, zmaJ-up-S/zmaJ-up-A and zmaJ-down-S/zmaJ-down-A, were used to amplify the upstream and downstream homologous arms of the zmaJ gene from B. cereus UW85 genomic DNA. The 675- and 940-bp fragments were digested with EcoRI/BamHI and KpnI/SalI, respectively, and cloned into the corresponding sites of pRec-mob-Ts one by one, generating pBMB0263 (Fig. 7a).

Using spectinomycin, mutants containing the Mob-Spc cassette were selected following a general method used for B. thuringiensis gene knockout [35]. Briefly, the Ts plasmids pBMB0260, pBMB0261, pBMB0262, and pBMB0263 were used to transform B. thuringiensis BMB171 by electroporation. The transformant BMB171/pBMB0263 was used as the donor strain, AW48 carrying the conjugative plasmid pAW63::Tn5401 was used as the helper strain, and B. cereus UW85R was used as the recipient strain. Triparental mating yielded the transconjugant UW85R/pBMB0263. The correct colonies BMB171/pBMB0260, BMB171/pBMB0261, BMB171/pBMB0262, and B. cereus UW85R/pBMB0263 were cultivated in LB medium containing spectinomycin (40 µg/mL) at 28 °C for 8 h. These strains were incubated at 42 °C for 4 days to generate the Mob-Spc cassette integrated mutants and eliminate unintegrated Ts plasmids.

The expected mutant strains, which were resistant to spectinomycin (100 μg/mL), but sensitive to erythromycin (25 μg/mL), were collected and confirmed by PCR using appropriate primers and sequencing. Finally, the mutant strains BMB0260::Mob-Spc, BMB0261::Mob-Spc, BMB0262::Mob-Spc and BMB0263::Mob-Spc were obtained.

The mutant strains with Mob-Spc cassette integration were cultivated at 28 °C for 24 h to excise the Mob-Spc cassette via recombination mediated by Mob02281, which is encoded by the Mob-Spc cassette. To increase the population of mutant strains from which the Mob-Spc cassette was excised, bacterial suspensions were diluted 1000-fold in fresh LB liquid medium every 8 h. The expected unmarked mutant strains, which were sensitive to spectinomycin (100 μg/mL), were collected and confirmed by PCR using primers outside the homologous arms and sequenced. Finally, the expected mutant strains BMB0260, BMB0261, BMB0262, and BMB0263 were obtained.

Plasmid transfer

To test the mobilization ability of Mob02281 into various B. thuringiensis and B. cereus group strains, the previously constructed mobilizable plasmid pHTMob02281, which contains Mob02281 with oriT1, was used [19]. To facilitate phenotypic observations of DNA that is transferred to the recipient strains, the plasmid cry6Aa-pHTMob02281, which contains cry6Aa as a reporter, was constructed and used to transform B. thuringiensis BMB171. As recipient strains, we used B. thuringiensis BMB171Str, B. thuringiensis CT-43::Kan, and B. thuringiensis serovar kurstaki YBT-1520Str, as well as the closely related species B.cereus strains UW85R and ATCC 10987Str. It should be noted that B. thuringiensis CT-43::Kan and YBT-1520Str have rather low electroporation efficiencies [25].

Conjugation assays were conducted following the protocols described by Andrup et al. [36]. In brief, overnight cultures of donor, recipient, and helper strains were incubated at 28 °C in LB medium with appropriate antibiotics. Equal quantities of donor, recipient, and helper cells in logarithmic growth were mixed and incubated in 7 mL of pre-warmed LB medium, without antibiotics, at 28 °C with moderate shaking (180 rpm). After mating proceeded for 3 h, appropriate dilutions were plated on selective medium to determine the number of transconjugants. Control donors, recipients, and helper strains were grown separately and tested in parallel. Transfer frequencies were calculated as the ratio of transconjugants to donor cells. Each experiment was performed in triplicate.

Recombination assays

Recombination assays were conducted following previously described methods [19]. To test the efficiency of Mob02281-mediated recombination, the substrate plasmids pBMBT11, pBMBT12, pBMBT13, pBMBT14, pBMBT15, pBMBT16 and  pBMBTmini was respectively introduced to BMB171 containing the helper plasmid pBMBmob1. The resulting colonies were grown with erythromycin and kanamycin and plated on erythromycin and kanamycin plates by dilution, and the resulting single colonies were transferred onto spectinomycin-containing plates after 20, 40, 60, 80, and 100 generations. Every 8 h (approximately 10 generations) [29], bacterial suspensions were diluted 1000-fold in 10 mL of fresh LB liquid medium. Recombination frequency was estimated as the number of spectinomycin-sensitive colonies. Each experiment was performed in triplicate.

Microscopic observations

For observations of the number of fluorescent cells under phase-contrast and fluorescence microscopy, all B. thuringiensis strains were cultivated in LB liquid medium at 28°C. The morphology of the strains was observed with an Olympus photomicroscope (Tokyo, Japan).

To observe the production of parasporal crystals under phase-contrast microscopy, all strains were sporulated using a previously described method [37]. Briefly, strains were cultured in ICPM liquid medium (0.6 % peptone, 0.5 % glucose, 0.1 % CaCO3, 0.05 % MgSO4, and 0.05 % KH2PO4 (pH 7.0)) for 36 h at 28°C. The spores and crystals were collected and washed three times with 1 M NaCl solution and three times with water [37]. These samples were also used to detect crystal protein expression by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Under phase-contrast microscopy, spores are phase-bright, and crystals are phase-dark [35]. For scanning electron microscopy with a Quanta200 (FEI, Hillsboro, OR, USA), the lysed cell samples were treated following the methods described by Shao et al. [37].

Detection of zwittermicin A (ZmA) by liquid chromatography mass spectrometry

High-resolution liquid chromatography mass spectrometry (LC–MS) was performed using an Agilent 1260 LC device (Agilent, USA) equipped with a C18 reverse-phase column (100 × 1.8 mm; particle size, 3.5 μm). The mobile phase consisted of chromatography grade water containing 0.1 % formic acid in pump B and chromatography grade acetonitrile in pump A. The 1uL of 36-h culture supernatants of UW85R and ZmA mutants were loaded. The elution step was performed under an acetonitrile concentration of 5 % for 5 min at a flow rate of 0.3 mL/min. The diode array detection was performed at 210 nm. MS was performed using the Q-TOF(quadrupole-time of flight) MS G6540A system (Agilent) equipped with a dual-source electrospray ionization (ESI) ion source operated in positive-ion mode. Calibration was performed with standard references of mass 121.0509 and 922.0098. The source parameters were as follows: gas temperature of 350 °C, gas flow rate of 8 L/min, and nebulizer stress of 35 lb/in2 (gauge). The capillary, fragmenter, skimmer, and octopole radio frequency (RF) peak voltage were set at 4000, 150, 65, and 750 V, respectively, for the scan source. The quadrupole was set to pass ions from m/z 100 to 1000. The MS scan rate was set to two spectra/s. Data were analyzed using Agilent MassHunter qualitative analysis software. Based on the molecular formula C13H28N6O8 of ZmA, the theoretical m/z of [M + H]+ 397.2046 (±20 ppm) was extracted to detect ZmA in each sample [24, 38].