Literature DB >> 27281207

The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

Tomas T Richardson1, Omar Harran1, Heath Murray1.   

Abstract

DNA replication is tightly controlled to ensure accurate inheritance of genetic information. In all organisms, initiator proteins possessing AAA+ (ATPases associated with various cellular activities) domains bind replication origins to license new rounds of DNA synthesis. In bacteria the master initiator protein, DnaA, is highly conserved and has two crucial DNA binding activities. DnaA monomers recognize the replication origin (oriC) by binding double-stranded DNA sequences (DnaA-boxes); subsequently, DnaA filaments assemble and promote duplex unwinding by engaging and stretching a single DNA strand. While the specificity for duplex DnaA-boxes by DnaA has been appreciated for over 30 years, the sequence specificity for single-strand DNA binding has remained unknown. Here we identify a new indispensable bacterial replication origin element composed of a repeating trinucleotide motif that we term the DnaA-trio. We show that the function of the DnaA-trio is to stabilize DnaA filaments on a single DNA strand, thus providing essential precision to this binding mechanism. Bioinformatic analysis detects DnaA-trios in replication origins throughout the bacterial kingdom, indicating that this element is part of the core oriC structure. The discovery and characterization of the novel DnaA-trio extends our fundamental understanding of bacterial DNA replication initiation, and because of the conserved structure of AAA+ initiator proteins these findings raise the possibility of specific recognition motifs within replication origins of higher organisms.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27281207      PMCID: PMC4913881          DOI: 10.1038/nature17962

Source DB:  PubMed          Journal:  Nature        ISSN: 0028-0836            Impact factor:   49.962


The master bacterial DNA replication initiator, DnaA, is a highly conserved multifunctional protein that utilises distinct domains to achieve its two key DNA binding activities. DnaA recognises double-stranded DNA using a helix-turn-helix motif (domain IV), whereas an ATP-dependent DnaA filament interacts with a single DNA strand using residues within the initiator specific motif (ISM; an α-helical insertion that distinguishes the family of replication initiators) of the AAA+ domain (domain III) (Extended Data Fig. 1a-d)4,5. In contrast to DnaA, bacterial replication origins are diverse; they contain variable numbers of DnaA-boxes and seemingly lack a common architecture6,7. Therefore, the sequence information within oriC that directs DnaA filament assembly onto a single DNA strand is unknown.
Extended Data Figure 1

Structure of DnaA proteins.

(a) Primary domain structure of DnaA. Key functions are listed below the relevant domain. (b) Structure of Thermatoga maritima DnaA domain III, highlighting the single-strand binding residue Val176 (Ile190 B. subtilis) within the ISM (PDB 2Z4S). (c) Structure of Escherichia coli DnaA domain IV bound to a DnaA-box (PDB 1J1V). (d) Structure of Aquifex aeolicus DnaA domain III (blue shades) and domain IV (cyan shades) bound to a single DNA strand (orange), highlighting the single-strand binding residue Val156 (Ile190 B. subtilis) (PDB 3R8F). (e) Scheme used to construct mutants within the B. subtilis DNA replication origin. The green arrow highlights the location of a DnaA-box mutation.

To investigate how DnaA filament formation could be localised to the DNA replication origin of Bacillus subtilis we began by characterising site-directed mutants of the DNA unwinding region in vivo (Fig. 1a and Extended Data Fig. 1e). In order to enable identification of essential sequences without selecting for suppressor mutations, we generated a strain in which DNA replication could initiate from a plasmid origin (oriN) integrated into the chromosome (Fig. 1b and Supplemental Information). Activity of oriN requires its cognate initiator protein, RepN; both of these factors act independently of oriC/DnaA8. Expression of repN was placed under the control of a tightly-regulated inducible promoter, thus permitting both the introduction of mutations into oriC and their subsequent analysis following removal of the inducer to shut off oriN activity (Fig. 1c and Extended Data Fig. 2).
Figure 1

Genetic analysis of the oriC DNA unwinding element reveals a critical region required for initiation activity.

(a) B. subtilis oriC unwinding region. DnaA-box colouring indicates conservation (consensus 5′-TTATCCACA-3′ in black). (b) The oriC-independent strain used for constructing replication origin mutations. (c) Growth of an oriC deletion mutant is dependent upon oriN activity. (d) Deletions extending beyond the AT-cluster into the initially unwound region inhibit cell growth. (e) Sequences between the GC-rich and AT-rich clusters are essential for origin function. (f) Sequences proximal to DnaA-boxes are most important for origin function. Marker frequency analysis was used to measure the rate of DNA replication initiation (mean and s.d. of 3 technical replicates). (g) Open complex formation by DnaA requires the native sequence between the GC- and AT-clusters. DNA duplex unwinding was probed by KMnO4 and detected by primer extension.

Extended Data Figure 2

Characterisation of the inducible repN/oriN replication initiation system.

Repression of repN expression inhibits DNA replication in a ΔoriC mutant. A large deletion was introduced into the B. subtilis replication origin using a strain harbouring the inducible oriN/repN construct. Strain growth was found to be dependent upon addition of the inducer IPTG. (a) Strains streaked to resolve single colonies. (b) A GFP-DnaN reporter was used to detect DNA replication following removal of IPTG from inducible oriN/repN strains. Scale bar = 5 μm. (c) Genetic map indicating the location of oriN at the aprE locus in strain HM1108. (d) Analysis of DNA replication initiation at oriC and oriN. Marker frequency analysis was used to measure the rate of DNA replication initiation in the presence and absence of IPTG (0.1 mM). Genomic DNA was harvested from cells during the exponential growth phase and the relative amount of DNA from either the endogenous replication origin (oriC) or the aprE locus (oriN) compared to the terminus (ter) was determined using qPCR (mean and s.d. of 3 technical replicates). Cell doubling times (min) are shown above each data set.

At the B. subtilis replication origin DNA unwinding by DnaA is detected downstream of DnaA-box elements and includes a sequence of 27 continuous A:T base pairs that is thought to facilitate DNA duplex opening (Fig. 1a)9. Surprisingly, we were able to delete the entire AT-rich 27-mer (Δ27) without abolishing origin activity, although the mutant strain did display a slow growth phenotype indicating that the AT-cluster is required for efficient origin function (Fig. 1d). Interestingly, further deletions extending 3 or 6 base pairs (Δ30, Δ33) severely impaired oriC-dependent initiation (Fig. 1d) and a deletion series targeting the sequence between the GC-rich and AT-rich clusters confirmed that this region alone was essential for origin function (Fig. 1e). Scrambling this entire region also inhibited cell growth (t1–t6Scr), demonstrating that the specific sequence is required, rather than the spacing between the flanking elements (Fig. 1f). To explore this region in more detail sequences were scrambled three base pairs at a time by exchanging each triplet for its complement. Phenotypic and marker frequency analyses revealed that disruption of sequences closest to the GC-cluster (t1Scr and t2Scr) caused the greatest defect in DNA replication initiation, indicating that the region proximal to the DnaA-boxes is most important for origin activity (Fig. 1f). Although mutagenesis of neither t4 nor t5 alone produced a detectable effect on DNA replication initiation under the conditions tested, they may become important when origin firing is suboptimal as was observed in the AT-cluster deletion mutant (Fig. 1d). To determine whether this essential DNA sequence between the GC- and AT-clusters has a role in DNA melting per se, an open complex formation assay was performed. DnaA was incubated with oriC plasmids containing either the wild-type or scrambled sequence (t1-t6Scr), potassium permanganate was added to oxidise distorted bases within the DNA, and base modification was detected by primer extension. Scrambling the sequence inhibited open complex formation, indicating that this region is necessary for DnaA-dependent unwinding (Fig. 1g). DnaA monomers are thought to bind DnaA-boxes prior to ATP-dependent filament formation10. Using the strain capable of oriC-independent initiation the seven DnaA-box sequences were individually scrambled to abolish DnaA binding11. Culturing these strains in the absence of oriN activity revealed that mutation of DnaA-box6 severely inhibited growth and mutation of DnaA-box7 resulted in a significant growth defect, while mutation of the remaining DnaA-boxes had no observable effect (Fig. 2a). Marker frequency analysis confirmed that mutation of DnaA-box7 drastically impaired origin activity, whereas mutation of the remaining DnaA-boxes resulted in only modest decreases in initiation frequency (Fig. 2a). These results indicate that DnaA-boxes proximal to the essential unwinding region are most critical for origin activity.
Figure 2

DnaA filaments are loaded from DnaA-boxes onto a specific single-strand sequence within the initially unwound region.

(a) DnaA-boxes proximal to the unwinding region are most important for origin function. Marker frequency analysis was used to measure the rate of DNA replication initiation (mean and s.d. of 3 technical replicates). (b) Sequence of the origin region used for constructing DNA scaffolds in (c). (c) DnaA filament formation using cysteine-specific crosslinking on DNA scaffolds. DnaA complexes were resolved by SDS-PAGE and detected by Western blot analysis. (d) Crystal structure showing ssDNA (dA12) bound to the DnaA filament through the AAA+ domain (PDB: 3R8F). (e) Sequence of the origin region used for constructing DNA scaffolds in (f). (f) DnaA filament formation on tailed substrates is arrested by a poly(A) tract. Long oligomers highlighted within the dotted box are shown above with increased contrast.

To directly test whether these DnaA-boxes promote DnaA filament assembly at the essential unwinding region we utilised a previously described DnaA filament formation assay12. Here two cysteine residues are introduced within the AAA+ domain such that the protein remains functional and when the DnaA filament assembles the cysteine residues from interacting protomers come into close proximity. DNA scaffolds were assembled using oligonucleotides and the cysteine-specific crosslinker bis(maleimido)ethane (BMOE; 8 Å spacer arm) was used to capture the oligomeric species formed on each substrate. Incubation of DnaA with duplex substrates containing DnaA-box6, DnaA-box7 and the GC-rich region produced a dimeric species (Fig 2b-c), whereas incubation of DnaA with a longer duplex substrate containing the unwinding region produced a set of larger oligomeric complexes. We wondered whether the larger species were being formed on the duplex DNA or on a single DNA strand. To test these models scaffolds containing single-stranded (ss) DNA tails were assembled. DnaA filaments readily formed on substrates containing a 5′-tail but were absent when the corresponding 3′-tail was provided (Fig. 2c and Extended Data Fig. 3). Formation of DnaA oligomers on the 5′-tailed substrate was dependent upon both ATP and the ssDNA binding residue Ile190 located within the ISM of the AAA+ domain4, indicating that the assay was capturing DnaA filament formation on ssDNA (Fig. 2c–d, Extended Data Fig. 1d).
Extended Data Figure 3

Wild-type DnaA assembles into filaments on 5′-tailed substrates.

DnaA filament formation using amine-specific crosslinking (BS3) on DNA scaffolds (represented by symbols above each lane). Protein complexes were resolved by SDS-PAGE and DnaA was detected by Western blot analysis.

Critically, DnaA oligomer formation on the 5′-tailed substrate was specific. DnaA filament assembly was abolished when the DnaA-box sequences within the duplex region were scrambled and it was significantly reduced when the single-stranded region was replaced with its complementary sequence (Fig. 2c). Taken together these results suggest that DnaA filaments are loaded from duplex DnaA-boxes onto ssDNA bearing a 5′-tail. This model is consistent with both biochemical experiments showing that E. coli DnaA preferentially interacts with the corresponding single-strand of its DUE and single molecule studies showing that Aquifex aeolicus DnaA filaments form with 3′→5′ polarity11,13,14. DnaA oligomer size was proportional to the length of the 5′-tail up to the formation of a heptamer, after which further DNA extension did not promote longer filaments (Fig. 2e-f). We noted that this limit corresponded to a poly(A) tract in the DNA sequence and wondered whether this sequence inhibited DnaA filament formation. When the poly(A) tract was replaced by sequences from the beginning of the DNA unwinding region, DnaA oligomer length increased beyond a heptamer (Fig. 2e-f). This result suggests that the origin unwinding region is designed to limit DnaA filament formation to a precise position within oriC. To identify a possible single-strand binding motif recognised by DnaA, individual base pairs within the essential unwinding region were inverted and origin activity was analysed in vivo. Marker frequency analysis revealed that altering either of two A:T base pairs, which were spaced three nucleotides apart from each other, resulted in the most significant loss of origin activity; in contrast the surrounding mutations had only modest effects (Fig. 3a). Re-examination of the unwinding region shows that A:T base pairs are spaced at three nucleotide intervals throughout this sequence (Fig. 1a). This observation is strikingly congruent with the mechanism proposed for binding of the DnaA filament to ssDNA, where each protomer engages a set of three nucleotides (Fig. 3b)4.
Figure 3

Analysis of the key origin unwinding region provides evidence for functional 3-mer repeats.

(a) Mutagenesis identifies A:T base pairs spaced three nucleotides apart are most critical for origin activity. Marker frequency analysis was used to measure the rate of DNA replication initiation (mean and s.d. of 3 technical replicates). (b) Crystal structure showing the interaction of DnaA with sets of three nucleotides (PDB: 3R8F). Residues for A. aeolicus indicated above; B. subtilis below. (c) In vivo deletion analysis of the unwinding region. Isogenic deletions indicated in black. Marker frequency analysis was used to measure the rate of DNA replication initiation (mean and s.d. of 3 technical replicates). (d) Growth of mutants used in (c). (e) In vitro deletion analysis of tailed substrates.

We hypothesised that an array of triplet nucleotide motifs recognised by DnaA are present within the unwinding region and that the motifs proximal to the DnaA-boxes are most important for origin activity. To test this model in vivo we created a set of nested deletions that removed either one or three base pairs (Extended Data Fig. 4). All of the single base pair deletions dramatically lowered the replication initiation frequency and several significantly inhibited cell growth (especially the same A:T base pairs noted above), whereas triplet deletions encompassing the single deletions had little or no effect (Fig. 3c-d). These results are consistent with the model that single base pair deletions act both by disrupting a specific 3-mer motif and by shifting the register of downstream 3-mer motifs relative to the DnaA filament start point at the DnaA-boxes.
Extended Data Figure 4

DNA sequence of unwinding regions following mononucleotide and trinucleotide deletions.

Resulting sequences grouped in boxes are identical for more than one deletion.

To test the model that the ssDnaA binding motif is indeed a repeating 3-mer, DnaA filament formation was analysed in vitro using tailed substrates which contained either single or triplet base deletions (Fig. 3e). Whereas deletion of one base produced significantly shorter oligomers, deletion of three bases restored formation of full length complexes. Taken together with the in vivo deletions, these results indicate that DnaA filaments bind to ssDNA by recognising a specific 3-mer motif found within the unwinding region. We have termed this 3-mer motif the “DnaA-trio”. To define the precise sequence of the DnaA-trio, DnaA filament formation was observed using a series of DNA scaffolds in which the 5′-tails were extended by increments of one nucleotide. We observed that additional oligomeric species appeared after the following sequences were added: 3′-GAT-5′, 3′-AAT-5′ and 3′-GAA-5′, suggesting that these triplets represent individual DnaA-trio motifs (Fig. 4a).
Figure 4

Identification of the DnaA-trio motif.

(a) Varying the length of 5′-tailed substrates identifies the likely DnaA-trio sequence. Lane 2 shows DnaA filament formation on a duplex DNA scaffold (DnaA-box6, DnaA-box7, GC-rich cluster). Letters indicate the nucleotide sequentially added to the 5′-tail. (b) Targeted mutagenesis of the proposed DnaA-trio motif. (c) Bioinformatic analysis identifies DnaA-trio motifs adjacent to a DnaA-box throughout the bacterial kingdom. Underlined sequences indicate experimentally determined DnaA-dependent unwinding sites. (d) DnaA-trios sequence logo (WebLogo28). (e) A schematic of DnaA filament formation from double-stranded DnaA-boxes (triangles) onto a single strand containing the DnaA-trios.

However, it was surprising that a longer oligomer was not formed following addition of the first 3′-GAT-5′ motif proximal to the GC-cluster, since mutagenesis of this sequence in vivo resulted in strong phenotypes (Fig. 3a, 3c-d). In structures of the archaeal initiator Orc1 bound to a replication origin the protein was observed to make two contacts with the DNA, one through its C-terminal DNA binding domain (analogous to DnaA domain IV) and another through its AAA+ motif15,16. We wondered whether DnaA might similarly be capable of contacting both a DnaA-box and the first DnaA-trio, thereby accounting for the absence of a DnaA trimer. Significantly, BMOE crosslinking of cysteines in the AAA+ domain would not detect this activity as the assay captures DnaA oligomers formed on either double-stranded or ssDNA12. In order to test this hypothesis we employed the amine-specific crosslinker bis(sulfosuccinimidyl)suberate (BS3) which, in contrast to BMOE, only captures DnaA oligomers formed on a single DNA strand (Extended Data Fig. 3 and 5). Crosslinking by BS3 reveals a DnaA dimer forming in the presence of the first 3′-GAT-5′, indicating that DnaA does recognise this sequence (Extended Data Fig. 5). Taken together with the BMOE crosslinking showing that a DnaA dimer is formed on the double-stranded DNA scaffold containing just DnaA-boxes 6 and 7 and the GC-cluster, the data suggests that the DnaA protein initially bound at DnaA-box7 undergoes a conformational change (detected by BS3) to engage the first DnaA-trio motif following the GC-cluster. Several lines of evidence support the notion that DnaA adopts distinct conformations when it engages either double-stranded or ssDNA17,18.
Extended Data Figure 5

Crosslinking with BS3 captures a distinct DnaA oligomer.

DnaA was incubated with various DNA scaffolds and different crosslinking agents were added to capture distinct DnaA oligomers. (a) Crosslinking with BMOE detects DnaA oligomers forming on both duplex and tailed substrates. (b) Crosslinking with BS3 only detects DnaA oligomers forming on tailed substrates, revealing an interaction between DnaA and the first DnaA-trio motif located downstream of the GC-cluster.

To support the assignment of the DnaA-trio we performed a targeted mutagenesis of the proposed sequence. The results indicate that each of the positions (3′-GAT-5′) appears important for DnaA filament formation, specifically the nucleotides at positions 1 and 2, and the deoxyribose group at position 3 (Fig. 4b and Extended Data Fig. 6). Interestingly, in the crystal structure of DnaA bound to a ssDNA substrate the protein makes no base-specific contacts4. These observations suggest either that the sequence of the DnaA-trios is important for an intermediate step in DNA duplex recognition and melting prior to full engagement of the product single-strand, or that the specific base sequence promotes the DNA backbone to adopt a favourable geometry for DnaA binding.
Extended Data Figure 6

The nucleotide at the third position of the DnaA-trio is required to stabilise DnaA.

DNA scaffolds containing the first two nucleotides of a DnaA-trio either with or without a 5’-phosphate are unable to stabilise binding of an additional DnaA protomer, indicating that the nucleotide at the third position is required. Combined with the data shown in Fig. 4b where the position is abasic, the results suggest that the sugar at the third position plays a critical role in DnaA binding.

Using this information we first searched for DnaA-trios within other well-characterised origin unwinding elements (Fig. 4c; underlined)19–21. In these cases a set of at least three DnaA-trios could be identified. These DnaA-trios were located proximal to a DnaA-box that shared the same orientation as B. subtilis DnaA-box7 and the regions between the DnaA-box and the DnaA-trios were GC-rich. Using these additional criteria we next interrogated predicted bacterial DNA replication origins (DoriC22) for similar patterns. Figure 4c shows that similar elements can be identified within putative oriC regions throughout the bacterial kingdom. A sequence logo of the DnaA-trios indicates that the preferred motif is 3′-G/AAT-5′ (Fig. 4d), with the central adenine being most highly conserved. We also observed that in the majority of cases a pair of tandem DnaA-boxes preceded the GC-cluster (Extended Data Table 1).
Extended Data Table 1

Bacterial replication origin regions in Figure 4c.

OrganismGenome accession #Reference or Dori C accession # (ORI)Genome position shown in Figure 4Tandem DnaA -boxes (spacing)
Aquifex aeolicus VF5NC_00091817166853 to 166897N
Bacillus subtilis 168NC_000964341860 to 1902Y (-1)
Bdellovibrio bacteriovorus HD100NC_005363ORI100400301569 to 1597N
Bifidobacterium bifidum PRL2010NC_014638ORI940107612048 to 2071Y (0)
Bordetella pertussi s Tohama INC_002929ORI100300124084583 to 4084611Y (+3)
Borrelia afzelii HLJ01NC_018887ORI96010684460118 to 460149Y? (+1)(+9)
Clostridium botulinum A str. HallNC_009698ORI920103351517 to 1552Y (-1)
Corynebacterium glutamicum ATCC 13032NC_003450ORI100100551984 to 2010Y (0)
Enterococcus faecalis V583NC_004668ORI100100961498 to 1533Y (0)
Escherichia col i MG1655NC_000913353925780 to 3925809N
Helicobacter pylor i 26695NC_000915201607488 to 1607525Y (0)
Leuconostoc citreum KM20NC_010471ORI923103821790 to 1819Y (0)
Listeria monocytogenes EGD-eNC_003210ORI100100471773 to 1802Y (-1)
Oceanobacillu s iheyensi s HTE831NC_004193ORI100100741746 to 1778Y (-1)
Staphylococcus aureus NCTC 8325NC_007795ORI100101832075 to 2104Y (-1)
Streptococcus pneumoniae R6NC_003098ORI100100441458 to 1487Y (0)
Streptomyces coelicolor A3(2)NC_003888364270070 to 4270096Y (0)
Synechococcus elongatus PCC 7942NC_007604372695870 to 2695899Y (0)
Thermotoga maritim a MSB8NC_00085321157010 to 157040N
Treponema pallidum NicholsNC_000919ORI100100031568 to 1588Y (-1)
We propose that the DnaA-trio constitutes a new element within bacterial replication origins. Our findings indicate that DnaA-trios play an essential role during DNA replication initiation by providing specificity for DnaA filament formation on a single DNA strand, thereby promoting DNA duplex unwinding. Our analysis also indicates that the arrangement of tandem DnaA-boxes in close proximity to DnaA-trios comprises a widespread strategy used to direct DnaA filament growth onto the unwinding region, with a single DnaA protein likely binding double-strand DNA via domain IV prior to engaging a DnaA-trio via its AAA+ motif (Fig. 4e and Extended Data Fig. 5). Together our data is consistent with the two-step DnaA assembly model for DNA melting18. We note that the configuration between DnaA-boxes and the DnaA-trios is not strictly required for DnaA to be loaded onto the single DNA strand in vitro. Scaffolds containing either a single DnaA-box or containing DnaA-boxes in reverse orientation are competent to promote DnaA filament formation from the duplex DNA onto the 5′-tail, although in the latter situation DnaA filament formation was reduced suggesting that DnaA-box orientation is important (Extended Data Fig. 7). Furthermore, loading does not require the flexibly tethered domains I/II of DnaA, consistent with previous observations suggesting that domains III/IV can adopt multiple conformations (Extended Data Fig. 7)12,17,18. These results suggest that some plasticity can be accommodated between duplex and single-strand DNA binding elements, which is in agreement with recent reanalyses of essential DnaA-boxes in E. coli and may also explain the location of atypical origin unwinding sites23–26.
Extended Data Figure 7

Relationship between the DnaA-box and the DnaA-trios.

(a) Sequence of the origin region used for constructing DNA scaffolds. Symbols below represent duplex DnaA-boxes (triangles), the GC-rich region (green rectangles), the two strands of the unwinding region (red or pink rectangles), and the AT-rich region (blue rectangle). (b) Loading of the DnaA filament onto a single-stranded 5′-tail requires a DnaA-box and DnaA domains III-IV, but the DnaA-box position and orientation are flexible.

Analysis of replication initiator proteins from both bacteria and archaea shows that the ISM within AAA+ domains is utilised for DNA binding and the recent structure of the Drosophila origin recognition complex (ORC) suggests that this is also likely the case for eukaryotes, supporting the model that DNA binding by the ISM is a universal feature of replication initiators4,15,16,27. We find here, for the first time, that the interaction of the B. subtilis replication initiator ISM with the origin involves recognition of a specific DNA sequence. We speculate that motifs analogous to the DnaA-trio may be present in replication origins of higher organisms and be recognised by the ISM of ORC proteins. These sites need not be 3-mers, nor would they necessarily share the same spacing observed for the DnaA-trios as they would need to accommodate the arrangement of AAA+ interactions within the respective heterohexameric ORC17,27. The discovery of ISM binding motifs in higher organisms would greatly facilitate origin identification, an elusive problem precluding the understanding of DNA replication control in eukaryotes.

Methods

Media and chemicals

Nutrient agar (NA; Oxoid) was used for routine selection and maintenance of both B. subtilis and E. coli strains. For experiments in B. subtilis cells were grown using Luria-Bertani (LB) medium. Supplements were added as required: chloramphenicol (5 µg/ml), erythromycin (1 µg/ml), kanamycin (5 µg/ml), spectinomycin (50 µg/ml). Unless otherwise stated all chemicals and reagents were obtained from Sigma-Aldrich.

Phenotype analysis of oriC mutants using the inducible oriC-independent strain

Strains were grown for 18-72 hr at 37°C on NA plates either with or without IPTG (1 mM). All experiments were independently performed at least twice and representative data is shown.

Marker frequency analysis

Genomic DNA was harvested from cells during the exponential growth phase and the relative amount of DNA from the replication origin (ori) and terminus (ter) was determined by qPCR. Strains were grown in LB medium to an A600 of 0.3-0.5 whereupon sodium azide (0.5%; Sigma) was added to prevent further metabolism. Chromosomal DNA was isolated using a DNeasy Blood and Tissue Kit (Qiagen). The DNA replication origin (oriC) region was amplified using primers 5′-GAATTCCTTCAGGCCATTGA-3′ and 5′-GATTTCTGGCGAATTGGAAG-3′; the region adjacent to oriN was amplified using primers 5′-CTTTCTGCCGCAAAGGATTA-3′ and 5′- CCTCTTCATAGCCGTTTTGC-3′; the DNA replication terminus (ter) region was amplified using primers 5′-TCCATATCCTCGCTCCTACG-3′ and 5′-ATTCTGCTGATGTGCAATGG-3′. Either Rotor-Gene SYBR Green (Qiagen) or GoTaq (Promega) qPCR mix was used for PCR reactions. qPCR was performed in a Rotor-Gene Q Instrument (Qiagen). By use of crossing points (CT) and PCR efficiency a relative quantification analysis (ΔΔCT) was performed using Rotor-Gene Software version 2.0.2 (Qiagen) to determine the origin:terminus (ori:ter) ratio of each sample. These results were normalised to the ori:ter ratio of a DNA sample from B. subtilis spores, which only contain one chromosome and thus have an ori:ter ratio of 1. Error bars indicate the standard deviation of three technical replicates. All experiments were independently performed at least twice and representative data is shown.

Protein expression

BL21 (DE3)-pLysS cells were transformed with the appropriate expression construct (Supplementary Table 2) and selected on nutrient agar plates containing 100 ng/µl of ampicillin and 34 ng/µl of chloramphenicol. A single transformant colony was used to inoculate an overnight starter culture grown at 37 °C, 180 rpm, in LB medium supplemented with 100 ng/µl of ampicillin and 34 ng/µl of chloramphenicol. The following morning a 1/100 dilution of overnight culture was used to inoculate 1200 ml of LB medium supplemented with 100 ng/µl of ampicillin and grown at 37°C, 180 rpm, to an A600 of 0.5. Cells were induced with 1 mM IPTG and cultured for a further 3 hr at 30°C. Cells were pelleted at 3,000 g, 4°C for 10 min before resuspension in 45 ml pf resuspension buffer (25 mM HEPES-KOH (pH7.6); 500 mM potassium glutamate; 10 mM magnesium acetate; 20% sucrose; 30 mM imidazole; 1 x cOmplete EDTA-free protease inhibitor tablet (Roche). The cell suspension was then flash-frozen in liquid nitrogen.

Protein purification

DnaA (WT, WT-CC and I190A-CC) was purified as follows. A frozen 50 ml BL21 cell pellet suspension was thawed on ice with 32 mg of lysozyme and gentle agitation for 1 hr then disrupted by sonication at 20 W for 5 min in 2 s pulses. Cell debris was pelleted by centrifugation at 31,000 xg, 4°C for 45 min and the supernatant further clarified by filtration (0.45 µm). All subsequent steps were performed at 4 °C unless otherwise stated. The clarified lysate was applied at 1 ml/minute to a 1 ml HisTrap HP column (GE), which had previously been equilibrated with Ni binding buffer (25 mM HEPES-KOH [pH7.6]; 250 mM potassium glutamate; 10 mM magnesium acetate; 20% sucrose; 30 mM imidazole). The loaded column was washed with a 10 ml 1 step gradient of 10 % Ni elution buffer (25 mM HEPES-KOH [pH7.6]; 250 mM potassium glutamate; 10 mM magnesium acetate; 20% sucrose; 30 mM imidazole). Specifically-bound proteins were eluted using a 7.5 ml 1-step gradient of 100% Ni elution buffer and the entire fraction collected and diluted into 42.5 ml of Q binding buffer (30 mM Tris-HCl [pH7.6]; 100 mM potassium glutamate; 10 mM magnesium acetate; 1 mM DTT; 20% sucrose). The diluted fraction was then applied at 1 ml/min to a 1 ml HiTrap Q HP column (GE), which had previously been equilibrated with Q binding buffer. The loaded HiTrap Q HP column was washed with 10 ml of Q binding buffer then eluted using a linear 10 ml gradient of 0–100% Q elution buffer (30 mM Tris-HCl [pH7.6]; 1 M potassium glutamate; 10 mM magnesium acetate; 1 mM DTT; 20% sucrose) with 1 ml fractions collected. The peak 3 × 1 ml fractions, based on UV absorbance, were pooled and dialysed into 1 L of FactorXa cleavage buffer (25 mM HEPES-KOH [pH7.6]; 250 mM potassium glutamate; 20% sucrose; 5 mM CaCl2), using 3.5k MWCO SnakeSkin dialysis tubing (Life Technologies) at 4°C overnight. The dialysed protein was diluted to 5 ml total volume in FactorXa cleavage buffer and incubated at 23 °C for 6 hr with 80 µg of FactorXa protease (NEB). The sample was applied at 1 ml/min to a 1 ml HisTrap HP column (GE), which had previously been equilibrated with Factor Xa cleavage buffer. The Factor Xa-cleaved fraction was eluted in 7.5 ml of Ni binding buffer. The eluted fraction was diluted into 42.5 ml of Q binding buffer and purified on a 1 ml HiTrap Q HP column as previously described. Peak fraction(s) were pooled and dialysed into 1 L of final dialysis buffer (40 mM HEPES-KOH [pH7.6]; 250 mM potassium glutamate; 1 mM DTT; 20% sucrose; 20% PEG300), using 3.5k MWCO SnakeSkin dialysis tubing (Life Technologies) at 4°C overnight before aliquoting, flash-freezing in liquid nitrogen and storage at -80 °C. Removal of the N-terminal His-tag, following incubation with FactorXa, was confirmed by anti-pentaHis (Qiagen) Western blotting. C-terminally His-tagged DnaA (WT-CC and Δ(domainI-II)-CC) purification was performed as for the tag-free variants, except that the protein was dialysed into final dialysis buffer following the first HiTrap Q HP column purification before aliquoting, flash-freezing and storing. HBsU purification was performed exactly as for DnaA, except that the HiTrap Q HP column was substituted for a 1 ml HiTrap Heparin HP column (GE) and the composition of buffers was modified accordingly. Ni binding buffer (25 mM Tris-HCl [pH8.0]; 400 mM NaCl; 30 mM imidazole). Ni elution buffer (25 mM Tris-HCl [pH8.0]; 400 mM NaCl; 500 mM imidazole). Heparin binding buffer (25 mM Tris-HCl [pH8.0]; 100 mM NaCl; 1 mM EDTA). Heparin elution buffer (25 mM Tris-HCl [pH8.0]; 2 M NaCl; 1 mM EDTA). Factor Xa cleavage buffer (25 mM Tris-HCl [pH8.0]; 100 mM NaCl; 2 mM CaCl2; 20% sucrose). Final dialysis buffer (25 mM Tris-HCl [pH8.0]; 400 mM NaCl; 2 mM CaCl2; 20% sucrose; 20 % PEG300). Peak fractions were determined by SDS-PAGE and Coomassie staining due to the absence of tryptophan, tyrosine and cysteine residues.

Open complex formation assays

KMnO4 footprinting assays were essentially performed as described in 9, except for the following changes. DnaA was not pre-incubated with ATP. The unwinding buffer contained 2 mM ATP, rather than 5 mM, and 500 ng of plasmid pTR541 (wild-type) or pTR542 (t1-t6scr) was used per 75 µl-scale reaction. DnaA was added to final concentrations of 0, 100, 250, 500 and 1000 nM. Assembled reactions were incubated at 37 °C for 10 min. KMnO4 treatment was then performed at 37 °C for 10 min. Six µl of β-mercaptoethanol was used to quench reactions; however, EDTA was omitted. KMnO4-treated DNA was immediately purified using a Qiagen PCR clean-up kit, eluting in 20 µl of EB buffer. KMnO4-treated templates were not linearised prior to primer extension. Primer extensions were performed on a 20 µl scale using 0.1 U/µl of Vent exo- DNA polymerase (NEB) in 1x manufacturer’s reaction buffer supplemented with 4 mM MgSO4, 200 µM each dNTP, 200 nM Cy5-labelled oligonucleotide (5’-Cy5- AGCTTCAGCAGCATGTAAAAG-3’) and 4 µl of PCR-purified template DNA per reaction. Reactions were subjected to thermocycling using a 3Prime thermal cycler (Techne) with 1 min initial denaturation at 98 °C, followed by 35 cycles of (10 s at 98 °C; 30 s at 55 °C; 30 s at 72 °C). Reactions were quenched by addition of an equal volume of stop buffer (95% formamide; 10 mM EDTA; 10 mM NaOH; 0.01% Orange-G) and products subjected to denaturing PAGE (6% acrylamide:bisacrylamide [19:1]; 8 M urea in 1x TBE). Resolved products were visualised using a Typhoon Trio Variable Mode Imager (GE Healthcare). The DnaA-trio marker was generated by primer extension performed under the same conditions as described for KMnO4-treated substrates, but using a PCR product as template generated with a primer corresponding to the end of the first DnaA-trio (5’- TAGGGCCTGTGGATTTGTG -3’). All experiments were independently performed at least twice and representative data is shown.

Filament assembly assays (BMOE)

DNA scaffolds were prepared by mixing each oligonucleotide (50 nM final concentrations) in 10 mM HEPES-KOH (pH7.6), 100 mM NaCl and 1 mM EDTA. Mixed oligonucleotides were heated to 98°C for 5 min in a heat-block and slowly cooled to room-temperature in the heat-block before use. Filament formation was promoted by mixing DnaA-CC proteins (WT, I190A, ΔdomainI-II) (200 nM final concentration) with DNA scaffold (15 nM) on a 20 µl-scale in 30 mM HEPES-KOH (pH7.0), 100 mM potassium glutamate, 100 mM NaCl, 10 mM magnesium acetate, 25% glycerol, 0.01% Tween-20 and 2 mM nucleotide (ADP or ATP). Reactions were incubated at 37°C for 5-12 min before addition of 4 mM BMOE (ThermoFisher Scientific). Reactions were incubated at 37°C for 5-12 min before quenching by addition of 60 mM cysteine. Reactions were incubated once more at 37°C for 10-12 min before fixing in NuPAGE LDS sample buffer (ThermoFisher Scientific) at 98°C for 5 min. Complexes were resolved by running 500 fmol of cross-linked DnaA from each reaction on a NuPAGE Novex 3-8% Tris-Acetate gel (ThermoFisher Scientific) then transferred to Hybond 0.45 µm PVDF membrane (Amersham) in 0.5x NuPAGE Tris-acetate SDS running buffer with 20% MeOH at 35 mA, 4°C overnight using wet transfer apparatus (Biorad). Complexes were visualised by Western blotting using a polyclonal anti-DnaA antibody (Eurogentec). NB/ All filament assembly assays were performed using tag-free proteins with the exception of that shown in Extended Data Figure 9, in which C-terminally His-tagged proteins (ΔdomainI-II-CC and wild-type-CC) were employed. All experiments were independently performed at least twice and representative data is shown.

Filament assembly assays (BS3)

Filament assembly assays using bis(sulfosuccinimidyl)suberate (BS3) were performed as described for BMOE, except a tag-free fully wild-type recombinant DnaA protein was employed for Extended Data Figure 5. Tag-free “CC” variants of wild-type and I190A DnaA were used for Extended Data Figure 7a,b. Crosslinking was performed using BS3 (15 mM final concentration) in place of BMOE and quenching performed by addition of Tris-HCl [pH7.6] (30 mM final concentration). All experiments were independently performed at least twice and representative data is shown.

Microscopy

To visualise GFP-DnaN, starter cultures were grown overnight in defined minimal medium base (Spizizen minimal salts supplemented with Fe-NH4-citrate (1 µg/ml), MgSO4 (6 mM), CaCl2 (100 µM), MnSO4 (130 µM), ZnCl2 (1 µM), thiamine (2 µM)) supplemented with casein hydrolysate (200 µg/ml) and glycerol (0.5%) with IPTG (1 mM) at 37°C, diluted 1:100 into fresh medium with IPTG (1 mM) and allowed to grow at 37°C for several generations until they reached an A600 0.3. Cells were collected by centrifugation, washed to remove IPTG, and resuspended into fresh medium at an A600 0.1 and allowed to grow until an A600 0.6. Cells were mounted on 1.5% agar pads (0.5X growth media) and a 0.13–0.17 mm glass coverslip (VWR) was placed on top. Microscopy was performed on an inverted epifluorescence microscope (Nikon Ti) fitted with a Plan-Apochromat objective (Nikon DM 100x/1.40 Oil Ph3). Light was transmitted from a 300 Watt xenon arc-lamp through a liquid light guide (Sutter Instruments) and images were collected using a CoolSnap HQ2 cooled CCD camera (Photometrics). All filters were Modified Magnetron ET Sets from Chroma and details are available upon request. Digital images were acquired and analysed using METAMORPH software (version V.6.2r6). All experiments were independently performed at least twice and representative data is shown.

Strains

Strains are listed in Supplementary Table 1. The genotype of all origin mutants was confirmed by DNA sequencing.

Oligonucleotides

All oligonucleotides were purchased from Eurogentec. Oligonucleotides used for plasmid construction are listed in Extended Data Table 2. Oligonucleotides used to construct DNA scaffolds are listed in Extended Data Table 3.
Extended Data Table 2

Oligonucleotides used for plasmid construction.

ProductTemplatePrimer #1Sequence (5〿〿3〿)Primer #2Sequence (5〿〿3〿)
pHM453Genomic DNAoHM319AATAATGACGTCGGCAAATTGTTTGAATTTGTCoHM320AATAATAGACGTCAGCCCGACACGCAGTTCATC
pHM492Genomic DNAoHM313AATAATGAATTCTTAATTATCTAACCAATTATAAAACGGCACoHM315AATAATCTCGAGCGCTTGGCAGCACCTGAGCAAACC
pHM560Genomic DNAoHM510AATAATGATATCTATAATGGTACCTATATAAGGCCTAGATTGTGACAACCATTGoHM511AATATAAAGCTTAGAGGAAAGGTAGGATTAG
pTR54pHM327oTR36CTTCTACCATTATCCGTTAGGAGGATAAAAATGAAATTCACoTR37GGATAATGGTAGAAGTAATAGTAGGGCCTGTGGATTTG
pTR72pGS43oTR156CAGCTTAAATGAGATCCGGCTGCTAACAAAGCCCGAAAGGoTR157CGGATCTCATTTAAGCTGTTCTTTAATTTCTTTTACATGC
pTR73pTR72oTR158CATCATCATCATCATCACAGCGAAAATATATTAGACCTGTGGAACCAAGCCCTTGCTCAAATCoTR159GCTGTGATGATGATGATGATGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTC
pTR74pTR102oTR189ATTCAAGGTCGCATGGAAAATATATTAGACCTGTGGAACCAAGCCCTTGoTR190TTTCCATGCGACCTTGAATGCCGCTGCTGTGATGATGATGATGATGCATG
pTR83pHM327oTR82CACAGTCTTCCTTGCTGTGGATAGGCTGTGTTTCCTGTCTTTTTCoTR83ATCCACAGCAAGGAAGACTGTGTATGACTTCCGAAAAGTTATTC
pTR84pHM328oTR66GCCCATGATAATGAAGATGATATTTTTATAAATATATATATTAATACATTATCCGTTAGoTR67AAAATATCATCTTCATTATCATGGGCCTGTGGATTTGTGGATAAGTTG
pTR85pHM327oTR118GAAAGGCAAGGAAGCTTTTCGGAAGTCATACACAGTCTGTCoTR119AAAGCTTCCTTGCCTTTCCCCGATTGATCCCCGGTCCTG
pTR86pHM327oTR123GAAGCTTCCTTGCGTCTGTCCACATGTGGATAGGCTGTGTTTCCoTR124AGACGCAAGGAAGCTTCCGAAAAGTTATTCACACTTTCCCCGATTG
pTR87pHM327oTR125ACAGCAAGGAAGGCTGTGTTTCCTGTCTTTTTCACAACTTATCoTR126CAGCCTTCCTTGCTGTGGACAGACTGTGTATGACTTCCGAAAAG
pTR88pHM327oTR86CCTGTCCTTCCTTGCACTTATCCACAAATCCACAGGCCCTACTATTACoTR87GGATAAGTGCAAGGAAGGACAGGAAACACAGCCTATCCAC
pTR89pHM327oTR88TCACAACCTTCCTTGCAATCCACAGGCCCTACTATTACTTCTACoTR89GTGGATTGCAAGGAAGGTTGTGAAAAAGACAGGAAACACAGCCTATC
pTR90pHM327oTR090CCACATTCCTTGCGGCCCTACTATTACTTCTACoTR091GGGCCGCAAGGAATGTGGATAAGTTGTGAAAAAGACAGGAAAC
pTR102pTR73oTR187CAGCAGCGGCATTCGAAAATATATTAGACCTGTGGAACCAAGCCCTTGoTR188TTTCGAATGCCGCTGCTGTGATGATGATGATGATGCATGGTATATC
pTR127pHM327oTR219TTTGTGGATAAGGCCCTACTATTACTTCTACoTR220CCTTATCCACAAATCCACAGTTGTGAAAAAGAC
pTR146pHM327oTR247CAGGCCCATGTATTACTTCTACTATTTTTTATAAATATATATATTAATACoTR248AATACATGGGCCTGTGGATTTGTGGATAAGTTGTG
pTR147pHM327oTR249GCCCTACATATACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR250AGTATATGTAGGGCCTGTGGATTTGTGGATAAGTTGTG
pTR148pHM327oTR251CCCTACTATATGTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR252GAACATATAGTAGGGCCTGTGGATTTGTGGATAAGTTGTG
pTR149pHM327oTR254AGTACTTGTAATAGTAGGGCCTGTGGATTTGTGGATAAGoTR263CTACTATTACAAGTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGGAG
pTR150pHM327oTR255TACTTCATGTATTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGoTR256AATACATGAAGTAATAGTAGGGCCTGTGGATTTGTG
pTR153pHM327oTR261GATCAATCGGTATCCGTTAGGAGGATAAAAATGAAATTCoTR262CTAACGGATACCGATTGATCCCCGGTCCTGCTATTTAAG
pTR168pTR74oTR299GAATTCGCCTGCTCTATCCGAGATAATAAATGCoTR300GAGCAGGCGAATTCGTTTGTAAATTTCTCAGAAG
pTR189pHM327oTR217CAACTGTGGATAAAATCCACAGGCCCTACTATTACTTCTACoTR218GATTTTATCCACAGTTGTGAAAAAGACAGGAAACACAG
pTR208pTR74oTR384TCAAGGTCGCATGAACAAAACAGAACTTATCAATGoTR385CGGATCTTATTTTCCGGCAACTGCGTCTTTAAGC
pTR208Genomic DNAoTR386TTTTGTTCATGCGACCTTGAATGCCGCTGCTGoTR387CGGAAAATAAGATCCGGCTGCTAACAAAGCCCGAAAG
pTR284pHM327oTR449GGCCCAACTATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR450GTAATAGTTGGGCCTGTGGATTTGTGGATAAG
pTR285pHM327oTR451GGCCCTTCTATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR452GTAATAGAAGGGCCTGTGGATTTGTGGATAAG
pTR286pHM327oTR453GGCCCTAGTATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGoTR454GTAATACTAGGGCCTGTGGATTTGTGGATAAG
pTR287pHM327oTR455CCCTACAATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR456AGTAATTGTAGGGCCTGTGGATTTGTGG
pTR288pHM327oTR457CCCTACTTTTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR458GAAGTAAAAGTAGGGCCTGTGGATTTGTGGATAAG
pTR289pHM327oTR459CCCTACTAATACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR460GTATTAGTAGGGCCTGTGGATTTGTGGATAAG
pTR301pHM327oTR469CTTCTACTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGGATAAAAATGoTR470TATAAAAAGTAGAAGTAATAGTAGGGCCTGTGG
pTR302pHM327oTR471TTACTTCTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGGATAAAAATGoTR472TATAAAAAGAAGTAATAGTAGGGCCTGTGGATTTG
pTR303pHM327oTR473CTATTACTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGGATAAAAATGoTR474TATAAAAAGTAATAGTAGGGCCTGTGGATTTG
pTR304pHM327oTR475CAGGCCCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGoTR476AATAGTAGGGCCTGTGGATTTGTGGATAAG
pTR305pHM327oTR477GCCCTACTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGGATAAAAATGoTR478TTATAAAAAGTAGGGCCTGTGGATTTGTG
pTR306pHM327oTR479GGCCCTTTTTATAAATATATATATTAATACATTATCCGTTAGGAGGATAAAAATGoTR480TATAAAAAGGGCCTGTGGATTTGTGG
pTR346pHM327oTR490GGCCCACTATTACTTCTACTATTTTTTATAAATATATATATTAATACoTR491GAAGTAATAGTGGGCCTGTGGATTTGTGGATAAGTTG
pTR348pHM327oTR494GGCCCTATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR495AGAAGTAATAGGGCCTGTGGATTTGTGGATAAGTTG
pTR349pTR54oTR496ATTACTTCCATTATCCGTTAGGAGGATAAAAATGAAATTCoTR497GATAATGGAAGTAATAGTAGGGCCTGTGGATTTG
pTR350pTR54oTR498ACTATTACCATTATCCGTTAGGAGGATAAAAATGoTR499GGATAATGGTAATAGTAGGGCCTGTGGATTTGTG
pTR377pHM327oTR539GGCCCTATATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR540GTAATATAGGGCCTGTGGATTTGTG
pTR441pHM327oTR659CCCTACATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR660GTAGAAGTAATGTAGGGCCTGTGGATTTGTG
pTR443pHM327oTR663CCCTACTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR664GTAGAAGTAGTAGGGCCTGTGGATTTGTG
pTR452pHM326oTR698GGCCGTACTATTACTTCTACTATTTTTTATAAATATATATATTAATACoTR699GTAATAGTACGGCCTGTGGATTTGTGG
pTR453pHM327oTR700AGGCCTACTATTACTTCTACTATTTTTTATAAATATATATATTAATACoTR701GTAATAGTAGGCCTGTGGATTTGTGG
pTR456pHM327oTR706GCCCTCTATTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCoTR707AAGTAATAGAGGGCCTGTGGATTTGTG
pTR457pHM327oTR708CCCTACTTTACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCoTR709GAAGTAAAGTAGGGCCTGTGGATTTG
pTR458pHM327oTR710CCTACTATACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCoTR711TAGAAGTATAGTAGGGCCTGTGGATTTG
pTR475pHM327oTR795CTACTATAACTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR796TAGAAGTTATAGTAGGGCCTGTGGATTTGTG
pTR476pHM327oTR797TACTATTTCTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR798GTAGAAGAAATAGTAGGGCCTGTGGATTTGTG
pTR477pHM327oTR799ACTATTAGTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR800AGTAGAACTAATAGTAGGGCCTGTGGATTTGTG
pTR478pHM327oTR801TACTATTCTTCTACTATTTTTTATAAATATATATATTAATACATTATCCGTTAGoTR802GTAGAAGAATAGTAGGGCCTGTGGATTTGTG
pTR541Genomic DNAoTR535ATTACGCCAGCTAGTGCTTTTATTTCTTGCAACCATAATAGoTR536ATTAATGCAGTTTTATCCTCCTAACGGATAATG
pTR541pSG1301oTR537AAAGCACTAGCTGGCGTAATAGCGAAGAGGoTR538GAGGATAAAACTGCATTAATGAATCGGCCAACG
pTR542pTR84oTR535ATTACGCCAGCTAGTGCTTTTATTTCTTGCAACCATAATAGoTR536ATTAATGCAGTTTTATCCTCCTAACGGATAATG
pTR542pSG1301oTR537AAAGCACTAGCTGGCGTAATAGCGAAGAGGoTR538GAGGATAAAACTGCATTAATGAATCGGCCAACG
Extended Data Table 3

Oligonucleotides used to assemble DNA scaffolds.

Oligo 1Sequence (5〿〿3〿)O ligo 2Sequence (5〿〿3〿)Figure
oTR602ACTTATCCACAAATCCACAGGCCCoTR603GGGCCTGTGGATTTGTGGATAAGT2c, 2f, 4a, E5a, E5b
oTR602ACTTATCCACAAATCCACAGGCCCoTR609ATATATATTTATAAAAAATAGTAGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT2c, E3, E7b
oTR602ACTTATCCACAAATCCACAGGCCCoTR619ATATATATTTATAAAAATATCATCTTCATTATCATGGGCCTGTGGATTTGTGGATAAGT2c
oTR602ACTTATCCACAAATCCACAGGCCCoTR626AGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR627TAGGGCCTGTGGATTTGTGGATAAGT4a, E5a, E5b
oTR602ACTTATCCACAAATCCACAGGCCCoTR628GTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR629AGTAGGGCCTGTGGATTTGTGGATAAGT4a, E6
oTR602ACTTATCCACAAATCCACAGGCCCoTR630TAGTAGGGCCTGTGGATTTGTGGATAAGT4a, 4b, E5a, E5b, E6
oTR602ACTTATCCACAAATCCACAGGCCCoTR631ATAGTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR632AATAGTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR633TAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a, 2f
oTR602ACTTATCCACAAATCCACAGGCCCoTR634GTAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR645AGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR646AAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a, 3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR647GAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR648AGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a, 3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR649TAGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT4a
oTR602ACTTATCCACAAATCCACAGGCCCoTR754TATAAAAAATAGTAGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT2f
oTR602ACTTATCCACAAATCCACAGGCCCoTR831TAGTAGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT2f
oTR602ACTTATCCACAAATCCACAGGCCCoTR854TAGTAGTAGTAGTAGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT2f
oTR602ACTTATCCACAAATCCACAGGCCCoTR956AAGAAGTAATATAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR957AAGAAGTAATGTAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR958AAGAAGTAAAGTAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR959AAGAAGTATAGTAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR960AAGAAGAATAGTAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR961AAGAAGTAATAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR962AAGAAGTAGTAGGGCCTGTGGATTTGTGGATAAGT3d
oTR602ACTTATCCACAAATCCACAGGCCCoTR965pAGTAGGGCCTGTGGATTTGTGGATAAGTE6
oTR602ACTTATCCACAAATCCACAGGCCCoTR970"AGTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR971TnGTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR972TAnTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR995TAATAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR996TACTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR998TGGTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR999TTGTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR1001CAGTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR602ACTTATCCACAAATCCACAGGCCCoTR1002AAGTAGGGCCTGTGGATTTGTGGATAAGT4b
oTR603GGGCCTGTGGATTTGTGGATAAGToTR608ACTTATCCACAAATCCACAGGCCCTACTATTACTTCTACTATTTTTTATAAATATATAT2c, E3
oTR608ACTTATCCACAAATCCACAGGCCCTACTATTACTTCTACTATTTTTTATAAATATATAToTR609ATATATATTTATAAAAAATAGTAGAAGTAATAGTAGGGCCTGTGGATTTGTGGATAAGT2c
oTR611ACCTTCCTTGCTTCCTTGCGGCCCoTR612ATATATATTTATAAAAAATAGTAGAAGTAATAGTAGGGCCGCAAGGAAGCAAGGAAGGT2c, E7b
oTR665ATATATATTTATAAAAAATAGTAGAAGTAATAGTAGGGCCTGTGGATTGCAAGGAAGGToTR667ACCTTCCTTGCAATCCACAGGCCCE7b
oTR666ATATATATTTATAAAAAATAGTAGAAGTAATAGTAGGGCCGCAAGGAATGTGGATAAGToTR668ACTTATCCACATTCCTTGCGGCCCE7b
oTR946ACTGTGGATTTGTGGATAAGGCCCoTR623ATATATATTTATAAAAAATAGTAGAAGTAATAGTAGGGCCTTATCCACAAATCCACAGTE7b

Plasmids

Plasmids are listed in the Supplementary Table 2 (sequences are available upon request). DH5α (F- Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 λ-)29 was used for plasmid construction, except where noted. Descriptions, where necessary, are provided below. pHM327 derivatives were generated by quickchange mutagenesis using the oligonucleotides listed in Extended Data Table 2. Following sequencing to confirm mutated regions, sequences were subcloned using BglII/FspAI. pHM446 [bla aprE′ kan lacI Pspac-MCS ′aprE] is a derivative of pAPNC21330 with a kanamycin resistance cassette replacing the spectinomycin resistance cassette (gift from H. Strahl). pHM453 [bla rpnA′ rpmH erm ΔincAB Pspac-dnaA′] was created in multiple steps. First, pJS1 was generated by ligation with a HindIII-BamHI PCR product containing 5′ end of dnaA and pMUTIN431 cut with HindIII-BamHI (gift from J. Errington). Second, pHM396 was generated by digestion of pJS1 with PvuII (to remove lacZ and lacI) and ligation of the vector backbone. Finally, pHM453 was generated by ligation of an AatII PCR product containing rpmH and the 5′ end of rpnA (oHM319 + oHM320 and 168CA genomic DNA as template) with pHM396 cut with AatII. pHM492 [bla aprE′ kan lacI Pspac-repN(oriN) ′aprE] was generated by ligation of an EcoRI-XhoI PCR product containing repN(oriN) (oHM313 + oHM315 and MMB20832 genomic DNA as template) with pHM446 cut with EcoRI-SalI. pHM560 [bla rpnA′ rpmH erm ΔincA PdnaA ΔincB dnaA′] was generated by ligation of an EcoRV-HindIII PCR product containing the dnaA promoter (oHM510 + oHM511 and 168CA genomic DNA as template) with pHM453 cut with EcoRV-HindIII. pTR72, pTR73, pTR74, pTR102, pTR168 were generated by quickchange mutagenesis using the oligonucleotides listed in Extended Data Table 2. pTR208 was generated by two-fragment PCR. oTR384/oTR385 and oTR386/oTR387 were used to amplify products using pTR74 and B. subtilis 168CA genomic DNA as templates, respectively. An equal volume of each PCR product was mixed, heated to 98°C and allowed to cool to room temperature before DpnI digestion and transformation. pTR229 [bla pT7(his6-link-Xa-dnaA)] was generated by subcloning a HindIII-XhoI fragment of dnaA from pHM239 into the pTR74 backbone. pTR541 and pTR542 were generated by two-fragment PCR. oTR537 and oTR538 were used to amplify the plasmid backbone of pSG1301. oTR535 and oTR536 were used to amplify incC with B. subtilis 168CA genomic DNA and pTR84 used as the templates for pTR541 and pTR542, respectively. An equal volume of each PCR product was mixed, heated to 98°C and allowed to cool to room temperature before DpnI digestion and transformation into EH3827 (asnB32 relA1 spoT1 thi-1 fuc-1 lysA ilv-192 zia::pKN500 ΔdnaA mad-1)33. DNA sequencing confirmed the construction of each origin including flanking sequences (>400 bp upstream and downstream).

Structure of DnaA proteins.

(a) Primary domain structure of DnaA. Key functions are listed below the relevant domain. (b) Structure of Thermatoga maritima DnaA domain III, highlighting the single-strand binding residue Val176 (Ile190 B. subtilis) within the ISM (PDB 2Z4S). (c) Structure of Escherichia coli DnaA domain IV bound to a DnaA-box (PDB 1J1V). (d) Structure of Aquifex aeolicus DnaA domain III (blue shades) and domain IV (cyan shades) bound to a single DNA strand (orange), highlighting the single-strand binding residue Val156 (Ile190 B. subtilis) (PDB 3R8F). (e) Scheme used to construct mutants within the B. subtilis DNA replication origin. The green arrow highlights the location of a DnaA-box mutation.

Characterisation of the inducible repN/oriN replication initiation system.

Repression of repN expression inhibits DNA replication in a ΔoriC mutant. A large deletion was introduced into the B. subtilis replication origin using a strain harbouring the inducible oriN/repN construct. Strain growth was found to be dependent upon addition of the inducer IPTG. (a) Strains streaked to resolve single colonies. (b) A GFP-DnaN reporter was used to detect DNA replication following removal of IPTG from inducible oriN/repN strains. Scale bar = 5 μm. (c) Genetic map indicating the location of oriN at the aprE locus in strain HM1108. (d) Analysis of DNA replication initiation at oriC and oriN. Marker frequency analysis was used to measure the rate of DNA replication initiation in the presence and absence of IPTG (0.1 mM). Genomic DNA was harvested from cells during the exponential growth phase and the relative amount of DNA from either the endogenous replication origin (oriC) or the aprE locus (oriN) compared to the terminus (ter) was determined using qPCR (mean and s.d. of 3 technical replicates). Cell doubling times (min) are shown above each data set.

Wild-type DnaA assembles into filaments on 5′-tailed substrates.

DnaA filament formation using amine-specific crosslinking (BS3) on DNA scaffolds (represented by symbols above each lane). Protein complexes were resolved by SDS-PAGE and DnaA was detected by Western blot analysis.

DNA sequence of unwinding regions following mononucleotide and trinucleotide deletions.

Resulting sequences grouped in boxes are identical for more than one deletion.

Crosslinking with BS3 captures a distinct DnaA oligomer.

DnaA was incubated with various DNA scaffolds and different crosslinking agents were added to capture distinct DnaA oligomers. (a) Crosslinking with BMOE detects DnaA oligomers forming on both duplex and tailed substrates. (b) Crosslinking with BS3 only detects DnaA oligomers forming on tailed substrates, revealing an interaction between DnaA and the first DnaA-trio motif located downstream of the GC-cluster.

The nucleotide at the third position of the DnaA-trio is required to stabilise DnaA.

DNA scaffolds containing the first two nucleotides of a DnaA-trio either with or without a 5’-phosphate are unable to stabilise binding of an additional DnaA protomer, indicating that the nucleotide at the third position is required. Combined with the data shown in Fig. 4b where the position is abasic, the results suggest that the sugar at the third position plays a critical role in DnaA binding.

Relationship between the DnaA-box and the DnaA-trios.

(a) Sequence of the origin region used for constructing DNA scaffolds. Symbols below represent duplex DnaA-boxes (triangles), the GC-rich region (green rectangles), the two strands of the unwinding region (red or pink rectangles), and the AT-rich region (blue rectangle). (b) Loading of the DnaA filament onto a single-stranded 5′-tail requires a DnaA-box and DnaA domains III-IV, but the DnaA-box position and orientation are flexible.
  37 in total

1.  Light-dependent and asynchronous replication of cyanobacterial multi-copy chromosomes.

Authors:  Satoru Watanabe; Ryudo Ohbayashi; Yuh Shiwa; Aska Noda; Yu Kanesaki; Taku Chibazakura; Hirofumi Yoshikawa
Journal:  Mol Microbiol       Date:  2012-02       Impact factor: 3.501

2.  Where does bacterial replication start? Rules for predicting the oriC region.

Authors:  Pawel Mackiewicz; Jolanta Zakrzewska-Czerwinska; Anna Zawilak; Miroslaw R Dudek; Stanislaw Cebrat
Journal:  Nucleic Acids Res       Date:  2004-07-16       Impact factor: 16.971

3.  Soj/ParA stalls DNA replication by inhibiting helix formation of the initiator protein DnaA.

Authors:  Graham Scholefield; Jeff Errington; Heath Murray
Journal:  EMBO J       Date:  2012-01-27       Impact factor: 11.598

4.  Conserved gene arrangement in the origin region of the Streptomyces coelicolor chromosome.

Authors:  M J Calcutt; F J Schmidt
Journal:  J Bacteriol       Date:  1992-05       Impact factor: 3.490

5.  Six GTP-binding proteins of the Era/Obg family are essential for cell growth in Bacillus subtilis.

Authors:  Takuya Morimoto; Pek Chin Loh; Tomohiro Hirai; Kei Asai; Kazuo Kobayashi; Shigeki Moriya; Naotake Ogasawara
Journal:  Microbiology       Date:  2002-11       Impact factor: 2.777

6.  Complexes at the replication origin of Bacillus subtilis with homologous and heterologous DnaA protein.

Authors:  M Krause; B Rückert; R Lurz; W Messer
Journal:  J Mol Biol       Date:  1997-12-05       Impact factor: 5.469

7.  Suppression of initiation defects of chromosome replication in Bacillus subtilis dnaA and oriC-deleted mutants by integration of a plasmid replicon into the chromosomes.

Authors:  A K Hassan; S Moriya; M Ogura; T Tanaka; F Kawamura; N Ogasawara
Journal:  J Bacteriol       Date:  1997-04       Impact factor: 3.490

8.  The DnaA homolog of the hyperthermophilic eubacterium Thermotoga maritima forms an open complex with a minimal 149-bp origin region in an ATP-dependent manner.

Authors:  Shogo Ozaki; Kazuyuki Fujimitsu; Hitoshi Kurumizaka; Tsutomu Katayama
Journal:  Genes Cells       Date:  2006-04       Impact factor: 1.891

Review 9.  A structural framework for replication origin opening by AAA+ initiation factors.

Authors:  Karl E Duderstadt; James M Berger
Journal:  Curr Opin Struct Biol       Date:  2012-12-21       Impact factor: 6.809

10.  Crystal structure of the eukaryotic origin recognition complex.

Authors:  Franziska Bleichert; Michael R Botchan; James M Berger
Journal:  Nature       Date:  2015-03-11       Impact factor: 49.962

View more
  25 in total

1.  Genetic networks controlled by the bacterial replication initiator and transcription factor DnaA in Bacillus subtilis.

Authors:  Tracy A Washington; Janet L Smith; Alan D Grossman
Journal:  Mol Microbiol       Date:  2017-08-11       Impact factor: 3.501

2.  Erratum: The bacterial DnaA-trio replication origin element specifies single-stranded DNA initiator binding.

Authors:  Tomas T Richardson; Omar Harran; Heath Murray
Journal:  Nature       Date:  2016-06-29       Impact factor: 49.962

3.  Genetic and biochemical interactions between the bacterial replication initiator DnaA and the nucleoid-associated protein Rok in Bacillus subtilis.

Authors:  Charlotte A Seid; Janet L Smith; Alan D Grossman
Journal:  Mol Microbiol       Date:  2017-01-03       Impact factor: 3.501

4.  HBsu Is Required for the Initiation of DNA Replication in Bacillus subtilis.

Authors:  Xheni Karaboja; Xindan Wang
Journal:  J Bacteriol       Date:  2022-05-12       Impact factor: 3.476

Review 5.  Mechanisms of Theta Plasmid Replication in Enterobacteria and Implications for Adaptation to Its Host.

Authors:  Jay W Kim; Vega Bugata; Gerardo Cortés-Cortés; Giselle Quevedo-Martínez; Manel Camps
Journal:  EcoSal Plus       Date:  2020-11

6.  Lytic transglycosylase MltG cleaves in nascent peptidoglycan and produces short glycan strands.

Authors:  Jad Sassine; Manuel Pazos; Eefjan Breukink; Waldemar Vollmer
Journal:  Cell Surf       Date:  2021-05-01

Review 7.  Opening the Strands of Replication Origins-Still an Open Question.

Authors:  Jyoti K Jha; Revathy Ramachandran; Dhruba K Chattoraj
Journal:  Front Mol Biosci       Date:  2016-09-30

8.  Unique and Universal Features of Epsilonproteobacterial Origins of Chromosome Replication and DnaA-DnaA Box Interactions.

Authors:  Pawel Jaworski; Rafal Donczew; Thorsten Mielke; Marcel Thiel; Stanislaw Oldziej; Christoph Weigel; Anna Zawilak-Pawlik
Journal:  Front Microbiol       Date:  2016-09-30       Impact factor: 5.640

Review 9.  Control of Initiation of DNA Replication in Bacillus subtilis and Escherichia coli.

Authors:  Katie H Jameson; Anthony J Wilkinson
Journal:  Genes (Basel)       Date:  2017-01-10       Impact factor: 4.096

Review 10.  Replisome Assembly at Bacterial Chromosomes and Iteron Plasmids.

Authors:  Katarzyna E Wegrzyn; Marta Gross; Urszula Uciechowska; Igor Konieczny
Journal:  Front Mol Biosci       Date:  2016-08-11
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.