Kazuhito Suzuki1, Kouhei Yamamoto, Yasuhiro Arakawa, Hisashi Yamada, Keisuke Aiba, Masanobu Kitagawa. 1. aDepartment of Comprehensive Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University bDepartment of Internal Medicine, Division of Clinical Oncology/Hematology cCore Research Facilities for Basic Science, Division of Molecular Genetics, Jikei University School of Medicine, Tokyo, Japan.
Abstract
Bromodomain and extraterminal protein (BET) inhibitors suppress the expression of c-MYC. U266, a human myeloma cell line, expresses the MYCL gene, but not the c-MYC gene. Our aim was to analyse the antimyeloma activity of BET inhibitors on U266 cells. Two BET inhibitors, I-BET151 and JQ1, were tested. U266 cell proliferation decreased to 61.5 and 54.0% of the control after incubation with 500 nmol/l I-BET151 for 72 and 96 h and to 53.5 and 56.4% of control after incubation with 500 nmol/l JQ1 for 72 and 96 h by MTS tetrazolium, respectively. BET inhibitors induced cell cycle arrest at the G1 phase in U266 cells, but did not induce apoptosis by flow cytometry. According to Gene Set Enrichment Analysis, MYC-related genes were significantly downregulated in U266 cells treated with I-BET151 similar to KMS11 cells that expressed c-MYC. The MYCL1 was expressed in U266 cells, whereas c-MYC and MYCN were not by quantitative real-time reverse-transcription-PCR. Incubation with I-BET151 induced downregulation of MYCL1 in U266 cells. BET inhibitors decreased the cell proliferation in U266 cells with overexpression of MYCL less than those without overexpression of MYCL. BET inhibitors induce G1 arrest without apoptosis and interfere with the proliferation of U266 myeloma cells, which express MYCL, but not c-MYC. BET inhibitors might be active in cancers that express MYCL, but not c-MYC.
Bromodomain and extraterminal protein (BET) inhibitors suppress the expression of c-MYC. U266, a humanmyeloma cell line, expresses the MYCL gene, but not the c-MYC gene. Our aim was to analyse the antimyeloma activity of BET inhibitors on U266 cells. Two BET inhibitors, I-BET151 and JQ1, were tested. U266 cell proliferation decreased to 61.5 and 54.0% of the control after incubation with 500 nmol/l I-BET151 for 72 and 96 h and to 53.5 and 56.4% of control after incubation with 500 nmol/l JQ1 for 72 and 96 h by MTS tetrazolium, respectively. BET inhibitors induced cell cycle arrest at the G1 phase in U266 cells, but did not induce apoptosis by flow cytometry. According to Gene Set Enrichment Analysis, MYC-related genes were significantly downregulated in U266 cells treated with I-BET151 similar to KMS11 cells that expressed c-MYC. The MYCL1 was expressed in U266 cells, whereas c-MYC and MYCN were not by quantitative real-time reverse-transcription-PCR. Incubation with I-BET151 induced downregulation of MYCL1 in U266 cells. BET inhibitors decreased the cell proliferation in U266 cells with overexpression of MYCL less than those without overexpression of MYCL. BET inhibitors induce G1 arrest without apoptosis and interfere with the proliferation of U266myeloma cells, which express MYCL, but not c-MYC. BET inhibitors might be active in cancers that express MYCL, but not c-MYC.
Multiple myeloma is a clonal human plasma cell neoplasm that develops mainly in the bone marrow. Several novel agents, including bortezomib, thalidomide and lenalidomide, have improved patient outcomes in the last decade. Multiple myelomas are a heterogeneous group of plasma cell neoplasms in terms of morphology, phenotype, molecular biology and clinical behaviour. Thus, heterogeneity exists in the outcomes of patients with multiple myeloma, even with the availability of these novel agents.Small-molecule inhibitors of the bromodomain and extraterminal (BET) family of bromodomain proteins, so-called BET inhibitors, suppress the expression of c-MYC, a master regulatory factor of cell proliferation in myeloma cells 1. Translocation or MYC rearrangement is the common somatic event in myelomapatients 2 and transcriptional profiling identifies activation of the MYC pathway in myeloma cells in more than 60% of patients 3. Members of the BET family, such as BRD2, BRD3, BRD4 and BRD-T, are associated with acetylated chromatin and facilitate transcriptional activation 4. In particular, BRD4 marks M/G1 genes in mitotic chromatin for transcriptional memory and directs postmitotic transcription 5. Inhibition of BRD4 leads to G1 arrest in humanmyeloma cell lines by downregulation of c-MYC 1.Members of the MYC family are important oncogenes involved in the development of malignant cells, including multiple myeloma 6. The activity of c-MYC in multiple myeloma increases with disease stage 3,7. There are three kinds of genes, c-MYC, N-MYC and L-MYC, in the MYC family 8–11. The c-MYC gene is expressed in the majority of humanmyeloma cell lines 12,13. However, U266, one of the humanmyeloma cell lines, expresses the MYCL gene, but not the c-MYC gene 14,15.In our study, the BET inhibitors, I-BET151 and JQ1, were found to be active not only against myeloma cell lines that express c-MYC but also against U266 cells. The aim of this study was to analyse the antimyeloma activity of BET inhibitors in U266 cells that do not express c-MYC.
Methods
Cell lines and drugs
Four humanmyeloma cell lines, U266, RPMI8226, MM1S and KMS11, were used in this study. U266, RPMI8226 and MM1S cell lines were obtained from the American Type Culture Collection (Rockville, Maryland, USA). KMS11 was obtained from the Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan). Myeloma cells were grown in RPMI 1640 medium (Boehringer, Ingelheim, Germany) containing 10% heat-inactivated foetal calf serum (HyClone Laboratories, Logan, Utah, USA) in a humidified atmosphere (37°C; 5% CO2). I-BET151 was purchased from Santa Cruz Biotechnology (Dallas, Texas, USA). JQ1 was purchased from BioVision Inc. (Milpitas, California, USA).
Cell count and Cell proliferation assay
Cell proliferation was calculated using an automated cell counter (Luna; Logos Biosystems, Anyang, Korea). Myeloma cells were seeded in 96-well flat-bottom microplates at a density of 5×103 cells/well for RPMI8226, 2.5×104 cells/well for MM1S, 5×103 cells/well for KMS11 and 2.5×104 cells/well for U266. The cells were incubated with or without drugs for 72 and 96 h at 37°C. After incubation, MTS terazolium compound (CellTiter 96 AQueous One Solution Cell Proliferation Assay; Promega, Madison, Wisconsin, USA) was added and the cells were incubated for 2–4 h. The absorbance was measured at a wavelength of 490 nm using a microplate reader (IMark Microplate Reader; Bio-Rad Laboratories, Hercules, California, USA) and expressed as a percentage of the value of the corresponding untreated cells.
Analysis of cell cycle
Myeloma cells (1×106) were incubated with or without BET inhibitors for 48, 72 or 96 h. The cells were then washed with PBS, permeabilized by 30-min exposure to 70% ethanol at −20°C, incubated with propidium iodide (PI) (50 µg/ml in 0.5 ml PBS containing 20 units/ml RNase A) for 30 min at room temperature (20–25°C) and analysed by flow cytometry (MACSQuant Analyzer; Miltenyi Biotec, Bergisch Gladbach, Germany).
Analysis of apoptosis and cell death
Myeloma cells were stained with PI and annexin-V-fluorescein isothiocyanate (FITC) using an Apoptosis Kit (annexin V-FITC kit, MEBCYTO; Medical & Biological Laboratories, Nagoya, Japan). Annexin V-FITC (10 µl) and PI (5 µl) were added to 85 µl of a suspension of 2×105 myeloma cells washed with PBS and incubated at room temperature (20–25°C) for 15 min in the dark. Cells were analysed by flow cytometry. The apoptosis ratio was defined as the ratio of PI-positive cells : annexin-V-positive cells.
Gene expression analysis
U266 and KMS11 cells were cultured with 500 nmol/l I-BET151 or DSMO for 24 h. RNA was isolated from the cells using the RNeasy kit (Quiagen, Hilden, the Netherlands). The RNA samples were evaluated using an Affymetrix Prime View Human Gene Expression Array (Affymetrix, Santa Clara, California, USA) at Beth Israel Deaconess Medical Center (Boston, Massachusetts, USA). The Gene Set Enrichment Analysis (. Broad Institute, Cambridge, Massachusetts, USA) was used to identify groups of functionally related oncogenic gene sets. Gene sets with afalse discovery rate of atleast 0.25 and a nominal P-value of at least 0.05 were defined as statistically significant.
Quantitative PCR for c-MYC expression
RNA from myeloma cells with or without BET inhibitors was isolated using the RNeasy kit (Quiagen). Reverse transcription of RNA to complementary DNA (cDNA) was performed using cDNA Synthesis Kits (Life Technologies, Carlsbad, California, USA). Quantitative real-time reverse-transcription-PCR (qRT-PCR) was performed using a 7500 Fast Real-Time PCR Systems (Life Technologies) with the SYBR Green PCR master mix (Roche Diagnostica, Risch-Rotkreuz, Switzerland). The sequences of forward and reverse primers, respectively, for c-MYC, MYCN and MYCL1 were c-MYC 1295F (5′-TGCTCCATGAGGAGACACC-3′), c-MYC 1413R (5′-CTCTGACCTTTTGCCAGGAG-3′), MYCL1 F1 (5′-CGAGAGCCCAAGCGACTC-3′), MYCL1 R1 (5′-AGGGATCCAGGGGGTCTG-3′), MYCN F1 (5′-AGACACCCGCGCAGAATC-3′) and MYCN R1 (5′-GTTTTAATACCGGGGGTGCT-3′). The control sample was amplified under the same conditions with humanglyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers. The sequence of the forward and reverse primer for GAPDH was 5′-ACAGTCAGCCGCATCTTCTT-3′ and 5′-AATTTGCCATGGGTGGAAT-3′, respectively.
Immunoblotting
MYCL and BCL-2, before and after treatment with transduction proteins, were detected by the western blotting methods. The samples were loaded onto a 5–20% gradient polyacrylamide (Wako Co. Ltd, Tokyo, Japan) and electrophoretically transferred to nitrocellulose membranes (GE Healthcare, Danbury, Connecticut, USA). The membranes were blocked with 10% skim milk in PBS. The primary antibodies were anti-MYCLmouse polyclonal antibody (ab167315; Abcam, Cambridge, UK), anti-MYCLrabbit polyclonal antibody (D01P; Abnova, Taipei, Taiwan), anti-BCL2 monoclonal mouse antibody (M0887; Dako, Glostrup, Denmark), anti-FLAG(TM) rabbit monoclonal antibody (F7425; Sigma Aldrich, St Louis, Missouri, USA) and anti-GAPDH(FL-355) rabbit polyclonal antibody (sd-25778; Santa Cruz Biotechnology). The secondary antibodies were horseradish peroxidase-conjugated antirabbit IgG (GE Healthcare). Protein expression was detected using the clarity western ECL substrate (Bio-Rad).
Transfection of expression plasmids
The MYCL expression vector was constructed briefly. Sequences of MYCL were amplified from the cDNA of U266 cells using PCR primers and inserted into the HindIII/XhoI site of the pcDNA3.1 3xFLAG expression vector (Invitrogen, Carlsbad, California, USA). The primers were synthesized at a commercial laboratory (Invitrogen). The primers were as follows: MYCL vari1full EcoR1 F was GGAATTCCGACTACGACTCGTACCAGCACT and MYCL vari1-2full Xba1 R2 was GCTCTAGATGCACCGGCTGCAATGCATT, respectively. The MYCL construct was transfected into U266 cells (2×106 cells) using lipofectamin 3000 transfection reagent (Invitrogen). The controls were mock transfected with an empty vector.
Statistical analysis
Data was presented as mean (±SD) of three independent experiments. Comparisons between two groups of samples were evaluated using the t-test. All P-values reported were two tailed and statistical significance was defined as P less than 0.05. All statistical analyses were carried out using EZR (Saitama Medical Center, Jichi Medical University, Shimotsuke, Japan), which is a graphical user interface for R (The R Foundation for Statistical Computing, Vienna, Austria). More precisely, it is a modified version of R commander designed to add statistical functions used frequently in biostatistics.
Results
BET inhibitors decrease the proliferation of U266 myeloma cells
The BET inhibitors I-BET151 and JQ1 at concentrations ranging from 100 nmol/l to 4 µmol/l were applied to four myeloma cell lines. Both compounds inhibited the proliferation of U266, RPMI8226, MM1S and KMS11 cells in a concentration-dependent manner after incubation for 72 and 96 h (Fig. 1a–d). However, the antimyeloma activity of I-BET151 was not dependent on the duration of incubation. The proliferation of RPMI8226, MM1S and KMS11 cells was strongly inhibited by the BET inhibitors; the IC50 values for I-BET151 and JQ1 ranged from 250 to 750 nmol/l. Proliferation of U266 cells was only partially inhibited. Proliferation of U266 cells decreased to 61.5 and 54.0% of the control after incubation with 500 nmol/l I-BET151 for 72 and 96 h, respectively. U266 cell proliferation decreased to 53.5 and 56.4% of the control after incubation with 500 nmol/l JQ1 for 72 and 96 h, respectively (Fig. 1e and f). The antimyeloma activity of I-BET151 was dependent on the duration of incubation when 750, 1000 or 2000 nmol/l I-BET-151 was applied (P=0.0021, 0.0361 and 0.0035, respectively). However, the antimyeloma activity of JQ1 was not dependent on the duration of incubation.
Fig. 1
Proliferation of human myeloma cell lines treated with BET inhibitors. (a) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l I-BET151 for 72 h. (b) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l I-BET151 for 96 h. (c) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l JQ1 for 72 h. (d) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l JQ1 for 96 h. (e) Proliferation of U266 cells treated with 100 nmol/l to 4 µmol/l I-BET151 for 72 and 96 h. (f) Proliferation of U266 cells treated with 100 nmol/l to 4 µmol/l JQ1 for 72 and 96 h. BET, bromodomain and extraterminal protein.
Proliferation of humanmyeloma cell lines treated with BET inhibitors. (a) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l I-BET151 for 72 h. (b) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l I-BET151 for 96 h. (c) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l JQ1 for 72 h. (d) Proliferation of U266, RPMI8226, MM1S and KMS11 cells treated with 500 nmol/l JQ1 for 96 h. (e) Proliferation of U266 cells treated with 100 nmol/l to 4 µmol/l I-BET151 for 72 and 96 h. (f) Proliferation of U266 cells treated with 100 nmol/l to 4 µmol/l JQ1 for 72 and 96 h. BET, bromodomain and extraterminal protein.
BET inhibitors induce G1 arrest
The analysis of cell cycle by flow cytometry showed that I-BET151 induced G1 arrest of U266 cells at 48, 72 and 96 h. The percentage of cells in the G1 phase increased to between 65.7 and 70.9% for U266 cells exposed to 500 nmol/l I-BET151 compared with 54.9 to 59.7% after exposure to dimethyl sulfoxide (DMSO) without the drug. I-BET151 treatment at 500 nmol/l decreased the percentage U266 cells in the S phase to between 8.4 and 10.5% compared with that observed after DMSO exposure (17.7–24.3%). In addition, JQ1 induced G1 arrest of U266 cells after 48, 72 and 96 h of incubation. JQ1 treatment at 500 nmol/l increased the percentage of U266 cells in the G1 phase to between 68.5 and 77.7% and decreased the percentage of S-phase cells to between 5.0 and 6.5% (Fig. 2).
Fig. 2
Cell-cycle analysis of U266 with BET inhibitors. Flow cytometry of PI staining for cell cycle analysis of U266 cells treated with DMSO, 500 nmol/l I-BET151 and 500 nmol/l JQ1 for 48, 72 and 96 h. BET, bromodomain and extraterminal protein; DMSO, dimethyl sulfoxide; PI, propidium iodide.
Cell-cycle analysis of U266 with BET inhibitors. Flow cytometry of PI staining for cell cycle analysis of U266 cells treated with DMSO, 500 nmol/l I-BET151 and 500 nmol/l JQ1 for 48, 72 and 96 h. BET, bromodomain and extraterminal protein; DMSO, dimethyl sulfoxide; PI, propidium iodide.The analysis of apoptosis with flow cytometry showed that DMSO induced apoptosis in 2.6% of U266 cells. I-BET151 and JQ1 did not induce apoptosis in U266 cells; the percentage of apoptotic cells after exposure to 500 nmol/l I-BET151 or JQ1 was 6.0 or 9.5%, respectively (Fig. 3).
Fig. 3
Apoptosis of U266 cells treated with BET inhibitors. (a) Flow cytometry of PI and annexin-V staining for annexin-V-positive apoptosis analysis in U266 cells treated with DMSO for 72 h. (b) Flow cytometry of PI and annexin-V staining for annexin-V positive apoptosis analysis in U266 cells treated with 500 nmol/l I-BET151 for 72 h. (c) Flow cytometry of PI and annexin-V staining for annexin-V-positive apoptosis analysis in U266 cells treated with 500 nmol/l JQ1 for 72 h. BET, bromodomain and extraterminal protein; DMSO, dimethyl sulfoxide; FITC, fluorescein isothiocyanate; PI, propidium iodide.
Apoptosis of U266 cells treated with BET inhibitors. (a) Flow cytometry of PI and annexin-V staining for annexin-V-positive apoptosis analysis in U266 cells treated with DMSO for 72 h. (b) Flow cytometry of PI and annexin-V staining for annexin-V positive apoptosis analysis in U266 cells treated with 500 nmol/l I-BET151 for 72 h. (c) Flow cytometry of PI and annexin-V staining for annexin-V-positive apoptosis analysis in U266 cells treated with 500 nmol/l JQ1 for 72 h. BET, bromodomain and extraterminal protein; DMSO, dimethyl sulfoxide; FITC, fluorescein isothiocyanate; PI, propidium iodide.
I-BET151 decreased the expression of genes related to MYC
The microarray analysis showed that the expression of 97 genes decreased by 50% or more in U266 cells exposed to 500 nmol/l I-BET151 for 24 h compared with their expression in U266 cells exposed to DMSO. Notably, expression of the MYCL1 gene decreased by 61.6% in response to I-BET151. The c-MYC and MYCN genes were not expressed in U266 cells treated with or without I-BET151. However, the expression of 500 genes decreased by 50% or more in KMS11 cells treated with 500 nmol/l I-BET151 for 24 h. Notably, the MYC gene was decreased by 65.9%. The MYCL1 and MYCN genes were not expressed in KMS11 cells with or without I-BET151.According to the gene set enrichment analysis, MYC-related genes were significantly downregulated in U266 and KMS11 cells treated with 500 nmol/l I-BET151 for 24 h (Fig. 4a and b). The heat map showed that I-BET151 downregulated similar MYC-related genes in U266 KMS11 cells (Fig. 4c).
Fig. 4
Gene set enrichment analysis of U266 and KMS11 cells treated with I-BET151. (a) Gene set enrichment analysis (GSEA) of the MYC-dependent gene set in RNA from U266 cells treated with 500 nmol/l I-BET151 for 24 h. (b) GESA of the MYC-dependent gene set in RNA from KMS11 cells treated with 500 nmol/l I-BET151 for 24 h. (c) Heat map of MYC-dependent genes in U266 and KMS11 cells treated with or without 500 nmol/l I-BET151. BET, bromodomain and extraterminal protein.
Gene set enrichment analysis of U266 and KMS11 cells treated with I-BET151. (a) Gene set enrichment analysis (GSEA) of the MYC-dependent gene set in RNA from U266 cells treated with 500 nmol/l I-BET151 for 24 h. (b) GESA of the MYC-dependent gene set in RNA from KMS11 cells treated with 500 nmol/l I-BET151 for 24 h. (c) Heat map of MYC-dependent genes in U266 and KMS11 cells treated with or without 500 nmol/l I-BET151. BET, bromodomain and extraterminal protein.
I-BET151 downregulated MYCL1, but not c-MYC or MYCN, in U266 cells
The qRT-PCR results showed that MYCL1 was expressed in U266 cells treated with DMSO alone; c-MYC and MYCN were not expressed in these cells. I-BET151 induced downregulation of MYCL1 in U266 cells after 24 h of incubation (Fig. 5a). In contrast, c-MYC was expressed in KMS11, RPMI8226 and MM1S cells treated with DMSO alone. I-BET151 induced downregulation of c-MYC in KMS11, RPMI8226 and MM1S cells after 24 h incubation (Fig. 5b). MYCL was not expressed in KMS11, RPMI8226 or MM1S cells. MYCN was not expressed in RPMI8226 and MM1S cells treated with DMSO. MYCN was expressed in KMS11 cells treated with DMSO; however, I-BET151 did not strongly downregulate the expression of MYCN in KMS11 cells after 24 h incubation (Fig. 5c).
Fig. 5
Quantitative RT-PCR analysis for MYCL, c-MYC and MYCN levels in four human myeloma cell lines. Quantitative RT-PCR was performed for MYCL, c-MYC and MYCN in U266, RPMI8226, MM1S and KMS11 cells with or without 500 nmol/l I-BET151 for 24 h. (a) I-BET151 downregulated the level of MYCL in U266 cells. MYCL was not expressed in RPMI8226, MM1S and KMS11 cells. (b) I-BET151 downregulated the level of c-MYC in RPMI8226, MM1S and KMS11 cells. C-MYC was not expressed in U266 cells. (c) I-BET151 slightly downregulated the level of MYCN in KMS11 cells. MYCN was not expressed in U266, RPMI8226 and MM1S cells. BET, bromodomain and extraterminal protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; I-BET, I-BET151; RT-PCR, real-time reverse-transcription-PCR.
Quantitative RT-PCR analysis for MYCL, c-MYC and MYCN levels in four humanmyeloma cell lines. Quantitative RT-PCR was performed for MYCL, c-MYC and MYCN in U266, RPMI8226, MM1S and KMS11 cells with or without 500 nmol/l I-BET151 for 24 h. (a) I-BET151 downregulated the level of MYCL in U266 cells. MYCL was not expressed in RPMI8226, MM1S and KMS11 cells. (b) I-BET151 downregulated the level of c-MYC in RPMI8226, MM1S and KMS11 cells. C-MYC was not expressed in U266 cells. (c) I-BET151 slightly downregulated the level of MYCN in KMS11 cells. MYCN was not expressed in U266, RPMI8226 and MM1S cells. BET, bromodomain and extraterminal protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; I-BET, I-BET151; RT-PCR, real-time reverse-transcription-PCR.
BET inhibitors did not decrease the proliferation of U266 cells with overexpression of MYCL
First, we produced the U266 cells with overexpression of MYCL using transfection of expression plasmids methods. The qRT-PCR results showed that MYCL1 was highly expressed in U266 cells with overexpression of MYCL than those without (Fig. 6a). In contrast, the western blotting results showed that the signal of MYCL was weak in both U266 cells with and without overexpression of MYCL (Fig. 6b). Second, we treated U266 cells with overexpression of MYCL by 500 nmol/l I-BET151 for 24 h. The western blotting results showed that the signal of MYCL was slightly weak in the U266 cells after the administration of I-BET151 compared with those before the administration of I-BET151 (Fig. 6c). Finally, we analysed the cell count between U226 cells with or without overexpression of MYCL before and after treatment with I-BET151 500 nmol/l. I-BET151 reduced 37.1% of the U266 cells without overexpression of MYCL, whereas I-BET151 reduced 15.6% of the U266 cells with overexpression of MYCL (t-test, P=0.0689; Fig. 6d).
Fig. 6
Analysis of U266 cells overexpressed MYCL. (a) The level of MYCL was higher in U266 cells with overexpression of MYCL than those without overexpression of MYCL by qRT-PCR. (b) The signal of MYCL protein was weak in U266 cells with overexpression of MYCL similar to those without overexpression of MYCL by the western blotting method. (c) The signal of MYCL was slightly weak in the U266 cells after the administration of I-BET151 compared with those before the administration of I-BET151 by the western blotting method. (d) I-BET151 reduced cell proliferation of U266 cells with overexpression of MYCL less than those without overexpression of MYCL (t-test, P=0.0689). BET, bromodomain and extraterminal protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative real-time reverse-transcription-PCR.
Analysis of U266 cells overexpressed MYCL. (a) The level of MYCL was higher in U266 cells with overexpression of MYCL than those without overexpression of MYCL by qRT-PCR. (b) The signal of MYCL protein was weak in U266 cells with overexpression of MYCL similar to those without overexpression of MYCL by the western blotting method. (c) The signal of MYCL was slightly weak in the U266 cells after the administration of I-BET151 compared with those before the administration of I-BET151 by the western blotting method. (d) I-BET151 reduced cell proliferation of U266 cells with overexpression of MYCL less than those without overexpression of MYCL (t-test, P=0.0689). BET, bromodomain and extraterminal protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative real-time reverse-transcription-PCR.
Discussion
This study has shown that BET inhibitors reduce the proliferation of U266 cells, which do not express c-MYC, as well as that of RPMI8226, MM1S and KMS11 cells that express c-MYC. BET inhibitors induced G1 arrest, but not apoptosis. I-BET151 downregulated the MYCL1 gene level in U266 cells. Similarly, MYC-related genes were downregulated in U266 and KMS11 cells. Finally, I-BET151 modulated the cell-cycle pathway of U266 cells independent of c-MYC expression and that of KMS11 cells by downregulation of c-MYC.BET inhibitors interfere with bromodomains on the acetyl–lysine recognition domains of coactivator proteins that are implicated in the initiation and elongation of transcription. In myeloma cells overexpressing c-MYC, BET inhibitors inhibit the downregulation of c-MYC transcription by chromatin-dependent signal transduction to RNA polymerase 1. Both I-BET151 and JQ1 are pan-BET inhibitors that inhibit cell proliferation in numerous types of malignancies, including acute myeloid leukaemia, malignant lymphoma, neuroblastoma, glioblastoma and osteosarcoma 16–21. In addition, I-BET151 induces apoptosis in vitro and in vivo by transcriptional repression of MYC-dependent and MYC-dependent pathways by inhibiting recruitment to the transcriptional activator PTEFb 22. In a previous study, BET inhibitors interfered with the proliferation of RPMI8226, KMS11 and MM1S cells because of overexpression of c-MYC in these humanmyeloma cell lines. In contrast, BET inhibitors did not affect U266 cells because L-MYC, and not c-MYC, is overexpressed in U266 cells. In our study, I-BET151 downregulated the level of MYCL1 messenger RNA (mRNA) and induced G1 arrest in U266 cells without apoptosis. I-BET151 downregulated the level of c-MYC mRNA as determined by the qRT-PCR method in RPMI8226, KMS11 and MM1S cells.The MYC proto-oncogene family comprises c-MYC, MYCL and MYCN. All three genes form dimers with MAX and bind to DNA 23. N-MYC is similar to c-MYC in terms of domain structure and association with humanmalignancies 24. In contrast, the MYCL protein is different in structure from c-MYC and N-MYC and, unlike c-MYC and N-MYC, was not active in human cell lines 9,25–28. Aberrant expression of L-MYC is associated with only a small number of humanmalignancies. Dib and colleagues reported that 40 out of 43 humanmyeloma cell lines expressed c-MYC. U266 cells only expressed L-MYC. Similarly, L-MYC and N-MYC expression is rare in primary multiple myeloma cells (GEO accession GSE2658) 29.The MYC gene was rearranged with the enhancer of the immunoglobulin gene in about 60% of patients with myeloma. In about 40% of patients with myeloma, the enhancer of the immunoglobulin gene was not observed 30. Moreover, MYC rearrangements are rare or absent in monoclonal gammopathy of undetermined significance and smouldering multiple myeloma cells, but are present in about 15% of multiple myeloma cells, 45% of advanced myeloma cells and 90% of humanmyeloma cell lines 2,31,32.The L-MYC proto-oncogene protein is a human protein that is encoded by the MYCL1 gene 33. MYCL1 was detected as a basic helix–loop–helix transcription factor implicated in lung cancer 34. MYCL1 interacts with MAX as well as c-MYC and MYCN 35,36. L-MYC was related to the pathogenesis of several cancers, such as lung cancer, gastric cancer, colorectal cancer, nonmelanoma lip cancer and thyroid cancer 37–42. Moreover, high expression of L-MYC was related to a poor prognosis in patients with lung cancer and gastric cancer 43,44. Recently, L-MYC as well as c-MYC were found to be involved in the generation of human induced pluripotent stem cells 45. Activity of BET inhibitors by downregulation of MYCL has never been reported in cancer cells. We considered that the activity of BET inhibitors for U266 was dependent on downregulation of MYCL because BET inhibitors did not decrease the proliferation of U266 cells with overexpression of MYCL and downregulated the mRNA level of MYCL1. We propose that BET inhibitors are active in several cancers, including multiple myeloma, in which L-MYC was overexpressed, but neither c-MYC nor N-MYC was expressed.Catlett-Falcone et al.
46 reported that the BCL-2 gene is amplified and is responsible for its survival in U266 We analysed the signal of BCL-2 protein in U266 cells treated with or without BET inhibitors. The signal of BCL-2 in U266 treated with 500 nmol/l of I-BET151 and JQ1 for 24 h was similar to those without BET inhibitors using western blotting methods (Supplementary material 1, Supplemental digital content 1, ). These results indicated that the activity of BET inhibitors for U266 was independent of the pathway related to BCL-2.Our study has a limitation in terms of the analysis of the MYCL protein. The MYCL protein was not detected using the western blotting methods by two kinds of anti-MYCL antibodies, although the mRNA level of MYCL was sufficient for evaluation. To the best of our knowledge, studies on expression levels of MYCL protein in U266 have never been reported, although studies on mRNA levels of MYCL have been carried out previously. We considered that MYCL was unstable or metabolized constitutively in U266. The reason why the expression level of MYCL was difficult to evaluate remains unclear. In the future, we will attempt to analyse the significance of protein level and metabolism in U266.In conclusion, BET inhibitors interfere with the proliferation of four humanmyeloma cell lines, including U266 cells that do not express c-MYC, as well as RPMI8226, MM1S and KMS11 cells that express c-MYC. BET inhibitors induced G1 arrest, but not apoptosis. I-BET151 downregulated MYCL1 gene levels in U266 cells. Similar genes related to MYC were downregulated in U266 and KMS11 cell lines. Finally, I-BET151 modulated the cell-cycle pathway in U266 cells that do not express c-MYC and exerted similar effects on KMS11 cells by downregulation of c-MYC. Although the MYCL1 gene is not expressed frequently in primary myeloma cells, it is related to pathogenesis and prognosis in several cancers. BET inhibitors might be active in cancer cells expressing L-MYC, but not c-MYC.Supplemental digital content is available for this article. Direct URL citations appear in the printed text and are provided in the HTML and PDF versions of this article on the journal's website ().
Authors: K S Hatton; K Mahon; L Chin; F C Chiu; H W Lee; D Peng; S D Morgenbesser; J Horner; R A DePinho Journal: Mol Cell Biol Date: 1996-04 Impact factor: 4.272
Authors: Shaila Rahman; Mathew E Sowa; Matthias Ottinger; Jennifer A Smith; Yang Shi; J Wade Harper; Peter M Howley Journal: Mol Cell Biol Date: 2011-05-09 Impact factor: 4.272
Authors: R Catlett-Falcone; T H Landowski; M M Oshiro; J Turkson; A Levitzki; R Savino; G Ciliberto; L Moscinski; J L Fernández-Luna; G Nuñez; W S Dalton; R Jove Journal: Immunity Date: 1999-01 Impact factor: 31.745
Authors: Zhixiang Cheng; Yuanying Gong; Yufang Ma; Kaihua Lu; Xiang Lu; Larry A Pierce; Reid C Thompson; Susanne Muller; Stefan Knapp; Jialiang Wang Journal: Clin Cancer Res Date: 2013-02-12 Impact factor: 12.531
Authors: Patrick L Garcia; Aubrey L Miller; Tracy L Gamblin; Leona N Council; John D Christein; J Pablo Arnoletti; Marty J Heslin; Sushanth Reddy; Joseph H Richardson; Xiangqin Cui; Robert C A M van Waardenburg; James E Bradner; Eddy S Yang; Karina J Yoon Journal: Mol Cancer Ther Date: 2017-11-15 Impact factor: 6.261