Literature DB >> 27267595

Evaluation of custom multiplex real - time RT - PCR in comparison to fast - track diagnostics respiratory 21 pathogens kit for detection of multiple respiratory viruses.

Bharti Malhotra1, M Anjaneya Swamy2, P V Janardhan Reddy2, Neeraj Kumar2, Jitendra Kumar Tiwari2.   

Abstract

BACKGROUND: Severe acute respiratory infections in children can be fatal, rapid identification of the causative agent and timely treatment can be life saving. Multiplex real time RT-PCR helps in simultaneous detection of multiple viruses saving cost, time and labour. Commercially available multiplex real time RT-PCR kits are very expensive. Therefore the aim of the present study was to develop a cost effective multiplex real time RT-PCR for the detection of 18 respiratory viruses and compare it with an in-vitro diagnostics approved Fast Track Diagnostic Respiratory Pathogens 21 Kit (FTD).
METHODS: Nasopharyngeal aspirates and throat swabs were collected and processed for extraction of nucleic acid using an automated extraction system and multiplex real time RT-PCR was performed using the FTD kit and a custom assay on 356 samples.
RESULTS: Custom and FTD assays detected one or more respiratory viruses in 268 (75.29 %) and 262 (73.60 %) samples respectively. The concordance between the custom assay and the FTD assay was 100 % for HCoV OC43, HCoV 229E, HPIV-1, HPIV-2, HBoV, HPeV, Flu A, and Influenza A(H1N1)pdm09 and 94.66 - 99.71 % for the remaining viruses; Flu B (99.71 %), HRV (99.71 %), HPIV-3 (98.87 %), HPIV-4 (99.43 %), HCoV NL63 (99.71 %), HMPV A/B (99.71 %), RSV A/B (94.66 %), EV (98.31 %), HCoV HKU1 (99.71 %), HAdV (99.71 %). Major discrepancy was observed for RSV A/B, which was over detected in 18 samples by the custom assay as compared to the FTD assay. The custom assay was much cheaper than the FTD assay and the time taken was only 29 min more.
CONCLUSION: The custom primer and probe mix was found to be comparable to the FTD assay with good concordance but was much cheaper and the time taken for reporting was only 29 min more. The low cost custom multiplex RT-PCR can be a useful alternative to the costly FTD kit for rapid identification of viral aetiology in resource limited settings.

Entities:  

Keywords:  Concordance; Custom assay; FTD assay; Multiplex real time RT-PCR

Mesh:

Year:  2016        PMID: 27267595      PMCID: PMC4896093          DOI: 10.1186/s12985-016-0549-8

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Background

Severe acute respiratory infections (SARI) are one of the major causes of illness and death worldwide and are the third most common cause of death among children [1]. Acute respiratory infections (ARI) cause more deaths in children < 5 years with most cases reported from India (43 million), China (21 million), Pakistan (10 million), Bangladesh, Indonesia and Nigeria (56 million) [2]. Respiratory infections can be caused by many viruses, both DNA and RNA. These include the Respiratory Syncytial Virus (RSV), human Parainfluenza Virus (HPIV), Influenza A Virus (Flu A), Influenza B Virus (Flu B), human Adenovirus (HAdV), human Coronavirus (HCoV), human Rhinovirus (HRV), human Metapneumovirus (HMPV) and human Bocavirus (HBoV) [3]. A new wave of viral diagnosis was established with the development of Polymerase Chain Reaction (PCR) techniques in the 1990s [4]. PCR is more sensitive and rapid than conventional methods for detection of respiratory viruses. Different respiratory viruses present with similar signs and symptoms and can’t be differentiated symptomatically or clinically. Tests capable of rapid simultaneous identification of various viruses at the same time can help expedite initiation of appropriate therapy. Uniplex RT-PCR requires individual amplification of each virus under study which is expensive, time consuming and laborious [5]. To overcome this, multiplex real-time PCRs targeting the detection of multiple pathogens simultaneously have been developed commercially but they are very expensive. There is a need to develop cheaper systems for rapid simultaneous identification of various viruses. The present study compares custom real-time multiplex PCR primers and probes for the simultaneous detection of 18 respiratory viruses with an in-vitro diagnostics (IVD) approved fast track diagnostics (FTD) kit.

Methods

Patient inclusion criteria

Children with SARI, admitted in J. K. Lone Hospital, a pediatric hospital attached to Sawai Man Singh (SMS) Medical College Jaipur were enrolled in the study and tested for respiratory viruses with prior consent of the parent/guardian. Duration of the study was 27 months i.e. between September, 2012 to December, 2014. Children enrolled were ≤ 5 years of age, presenting with fever, cough, sore throat, nasal catarrh, shortness of breath, bronchiolitis, pneumonia, and wheezing.

Patient exclusion criteria

Samples were not collected from patients with chronic respiratory ailments; non-consenting caregivers, with history of hospitalization in the preceding 14 days, not admitted in hospital and children aged > 5 years.

Sample collection and transportation

A total of 356 nasopharyngeal aspirate and throat swab samples were collected from patients with SARI by a trained technician using a sterile nylon flocked swab and placed in viral transport medium (VTM), labelled and transported on ice at the earliest to Advanced research lab (ICMR Grade-1 Virology Lab) of SMS Medical college Jaipur for further processing and storage of the samples. The study was approved by the institutional ethics committee.

Nucleic acid extraction

Viral nucleic acid from samples was extracted using an EasyMAG (Biomeurex) automated extractor according to the manufacturer’s instructions. Briefly, the extraction was done from 400 μl homogenised sample which was added to 1500 μl lysis buffer and was incubated for 10 min off board. The samples were loaded into the EasyMAG and 100 μl of magnetic silica was added to each sample and mixed well. Finally, the nucleic acid was eluted in a volume of 110 μl of which 50 μl was used for the FTD assay and 54 μl for the custom assay.

Multiplex real -time RT-PCR (FTD ASSAY)

The multiplex real-time PCR FTD assay was performed on an ABI 7500 Fast instrument (Life Technologies, USA) as per the manufacturer’s instructions using an AgPath-ID ™ One-Step RT-PCR kit (Ambion) with the FTD Respiratory pathogens 21 kit (Fast Track Diagnosis, Luxembourg) for the detection of 18 viruses using five tubes containing primer and probe mix for different viruses; Tube-1 [Influenza A (Flu A), Influenza A subtype H1N1 (Pandemic H1N1), human Rhinovirus (HRV), Influenza B (Flu B)], Tube-2 [human Coronaviruses NL63 (HCoV-NL63), 229E (HCoV 229E), OC43 (HCoV-OC43), and HKU1 (HCoV HKU1)], Tube-3 [human Parainfluenza viruses, 2, 3, and 4 (HPIV- 2, 3 and 4) & IC], Tube-4 [human Parainfluenza viruses-1, Mycoplasma pneumoniae (M.pneu), human Bocavirus (HBoV), human Metapneumovirus (HMPV A/B)] and Tube-5 [Respiratory Syncytial virus (RSVA/B), human Adenovirus (HAdV), Enterovirus (EV), human Parechovirus (HPeV)]. The multiplex real time RT-PCR thermal profile for the FTD kit was as follows; 50 °C for 15 min, 95 °C for 10 min, 40 cycles of 95 °C for 8 s, 60 °C for 34 s, whereas the thermal profile for the custom assay was set at 50 °C for 30 min, 95 °C for 10 min, 45 cycles of 95 °C for 15 s, 55 °C for 30 s.

Standardisation of uniplex real-time PCR (Custom assay)

Initial standardisations were done for uniplex real-time PCR using the FTD positive samples as controls. These positive samples included the following viruses namely, HRV, HAdV, Flu A, Pandemic H1N1, Flu B, HPIV-1, HPIV-2, HPIV-3, HPIV-4, RSVA/B, HMPV A/B, HPeV, EV, HCoV-OC43, HCoV-NL63, HCoV 229E, HCoV HKU1, (HBoV). AgPath (Ambion) one step RT-PCR master mix was used for the amplification and detection of viral nucleic acid. Briefly, each reaction was performed in a 20 μl volume which consisted of 12.5 μl of buffer, 1 μl of enzyme, 2 picomoles of each primer (corresponding to each virus), 2 picomoles of probe (corresponding to each virus) (synthesised by Life Technologies) (Table 1), 5 μl of extracted nucleic acid of the positive control/sample and made to a final volume of 20 μl with nuclease free water. The thermal cycling profile for the uniplex RT-PCR was 50 °C for 30 min (1 cycle), 95 °C for 10 min (1 cycle) followed by 90 °C for 15 s and 55 °C for 30 s (45 cycles). Specimens were considered positive when the Ct value was < 35.
Table 1

Custom primers and probes used for the detection of respiratory viruses

VIRUSFroward primer (5’ - 3’)Reverse primer (5’ - 3’)Probe (5’ - 3’)d References
Panel-1
 Flu BGAGACACAATTGCCTACCTGCTTTTCTTTCCCACCGAACCAAC aFAM – AGAAGATGGAGAAGGCA AAG CAGA ACTAGCEsposito et al., 2010 [17]
 HCoV 229ECAGTCAAATGGGCTGATGCAAAAGGGCTATAAAGAGAATAAGGTATTCT bVIC – CCCTGACGACCACGTTGTGGTTCAHammit et al., 2011 [6]
 HCoV OC43CGATGAGGCTATTCCGACTAGGTCCTTCCTGAGCCTTCAATATAGTAACC cNED-TCCGCCTGGCACGGTACTCCCTHammit et al., 2011 [6]
Panel-2
 HPIV-4CAGAYAACATCAATCGCCTTACAAATGTACCTATGACTGCCCCAAARA aFAM – CCMATCACAAGCTCAGAAATYCAAAGTCGTHammit et al., 2011 [6]
 HPIV-1GTGATTTAAACCCGGTAATTTCTCACCTTGTTCCTGCAGCTATTACAGA bVIC- ACCTATGACATCAACGACHammit et al., 2011 [6]
 HPIV-3CCAGGGATATAYTAYAAAGGCAAAACCGGGRCACCCAGTTGTG cNED – TGGRTGTTCAAGACCTCCATAYCCGAGAAAHammit et al., 2011 [6]
Panel-3
 Influenza A(H1N1) pdm09GTGCTATAAACACCAGCCTYCCACGGGATATTCCTTAATCCTGTRGC aFAM - CAGAATATACATCCRGTCACAATTGGARAAWHO, 2009 [22]
 HRVTGGACAGGGTGTGAAGAGCCAAAGTAGTCGGTCCCATCC bVIC - TCCTCCGGCCCCTGAATGHammit et al., 2011 [6]
 HPIV-2ATGAAAACCATTTACCTAAGTGATGGACCTCCYGGTATRGCAGTGACTGAAC cNED - TCAATCGCAAAAGCHammit et al., 2011 [6]
Panel-4
 RSV A/BGGAAACATACGTGAACAAGCTTCARSV-A: CATCGTCTTTTTCTAAGACATTGTATTGA aFAM – TGTGTATGTGGAGCCTTKwofie et al., 2012 [10]
RSV-B: TCATCATCTTTTTCTAGAACATTGTACTGA
 HCoV NL63ACGTACTTCTATTATGAAGCATGATATTAAAGCAGATCTAATGTTATACTTAAAACTACG bVIC –ATTGCCAAGGCTCCTAAACGTACAGGTGTTHammit et al., 2011 [6]
 HCoV HKU1AGTTCCCATTGCTTTCGGAGTACCGGCTGTGTCTATACCAATATCC cNED - CCCCTTCTGAAGCAACui et al., 2011 [11]
Panel-5
 EVCCCTGAATGCGGCTAATCCATTGTCACCATAAGCAGCCA aFAM- AACCGACTACTTTGGGTGTCCGTGTTTCWolffs et al., 2011 [23]
 HPeVGTAACASWWGCCTCTGGGSCCAAAAGGGCCCCWGRTCAGATCCAYAGT bVIC- CCTRYGGGTACCTYCWGGGCATCCTTCNix et al., 2008 [12]
 HBoVTGCAGACAACGCYTAGTTGTTTCTGTCCCGCCCAAGATACA cNED – CCAGGATTGGGTGGAACCTGCAAASanghvi et al., 2012 [22]
Panel-6
 Flu AGACCRATCCTGTCACCTCTGACAGGGCATTYTGGACAAAKCGTCTA aFAM – TGCAGTCCTCGCTCACTGGGCACGWHO, 2009 [22]
 HAdVGCCCCAGTGGTCTTACATGCACATCGCCACGGTGGGGTTTCTAAACTT bVIC – TGCACCAGACCCGGGCTCAGGTACTCCGAHammit et al., 2011 [6]
 HMPV A/BCATCAGGTAATATCCCACAAAATCAGGTGAATATTAAGGCACCTACACATAATAARA cNED - TCAGCACCAGACACACSanghvi et al., 2012 [13]

NOTE: The lower limit for the detection of HBoV- 1 DNA copy/ml, HMPV- 30 Rna copies/ml, HPeV- 103 (cell culture infective dose) CCID50 - 104 CCID50, RSV A/B- 2×104copies/μl, HCoV HKU1- 5×103 copies/ml, Flu B- 2.2 Log10 (viral particles) VP/ml, and Influenza A(H1N1)pdm09 - 2×101 to 2×copies/ml

aFAM - Detection wavelength - 518 nm; bVIC detection wavelength - 554 nm; cNED detection wavelength 575 nm

dAll the probes were having (non fluorescence quencher) NFQ as quencher at 3’ end

Custom primers and probes used for the detection of respiratory viruses NOTE: The lower limit for the detection of HBoV- 1 DNA copy/ml, HMPV- 30 Rna copies/ml, HPeV- 103 (cell culture infective dose) CCID50 - 104 CCID50, RSV A/B- 2×104copies/μl, HCoV HKU1- 5×103 copies/ml, Flu B- 2.2 Log10 (viral particles) VP/ml, and Influenza A(H1N1)pdm09 - 2×101 to 2×copies/ml aFAM - Detection wavelength - 518 nm; bVIC detection wavelength - 554 nm; cNED detection wavelength 575 nm dAll the probes were having (non fluorescence quencher) NFQ as quencher at 3’ end

Standardisation of multiplex real-time RT-PCR (Custom assay)

Uniplex PCR was followed by multiplex real-time RT-PCR standardisation. In multiplex PCR, each reaction was targeted for the simultaneous detection of three different viruses in a single reaction tube. Each reaction mix consisted of respective forward and reverse primers, and probes each labelled with a different fluorescent dye (FAM, VIC and NED) specific to each of the three viruses. Tube-1 [Influenza B (Flu B), human Coronaviruses229E (HCoV 229E), OC43 (HCoV-OC43)], Tube-2 [human Parainfluenza viruses, 1, 3, and 4 (HPIV- 1, 3 and 4)], Tube-3 [Influenza A subtype H1N1 (Pandemic H1N1), human Rhinovirus (HRV), human Parainfluenza viruses-1 (HPIV-1)], Tube-4 [Respiratory Syncytial virus (RSVA/B), human Coronaviruses NL63 (HCoV-NL63), HKU1 (HCoV HKU1)], Tube-5 [Enterovirus (EV), human Parechovirus (HPeV), human Bocavirus (HBoV)], Tube-6 [Influenza A (Flu A), human Adenovirus (HAdV), human Metapneumovirus (HMPV A/B)]. FTD positive samples were considered as standard. AgPAth (Ambion) one step RT-PCR master mix was used for the detection of respective viral nucleic acids as mentioned above in a reaction volume of 25 μl but with 9 μl of nucleic acid, 4 picomoles of each primer and 2 picomoles of probe. The thermal profile for the multiplex real-time PCR was as described above. Specimens were considered positive when the Ct value was < 35. After standardisation of multiplex PCR the same protocol was used for screening patient samples. Rnase P was used as an internal control in a separate uniplex RT PCR assay. Samples negative for Rnase P were not included in the study.

Results

A total of 356 samples were tested by both assays. Custom and FTD assays detected one or more respiratory viruses in 268 (75.29 %) and 262 (73.60 %) samples respectively (Table 2).
Table 2

Single and multiple infections detected by custom assay as compared to FTD assay

Number of viruses detectedCustom assayFTD assay
088 (24.71 %)94 (26.40 %)
1197 (55.33 %)203 (57.02 %)
265 (18.25 %)55 (15.44 %)
36 (1.68 %)4 (1.12 %)
Single and multiple infections detected by custom assay as compared to FTD assay No significant differences were seen in the number of samples positive for each virus by the custom assay as compared to the FTD assay except with RSV A/B which was over detected in 18 samples and one sample being under detected by the custom assay as compared to the FTD assay. Further, to completely assess the results of these 18 discordant RSVA/B samples, testing was repeated using RSV A and RSV B specific primer and probe mix in uniplex real time RT- PCR as published previously [6]. All 18 samples were found to be positive for RSV B (Table 3).
Table 3

Typing results of RSV A & RSV B for samples positive by custom assay

RSV ARSV BRSV A & B (co-infections)Total
0/1818/180/1818/18
Typing results of RSV A & RSV B for samples positive by custom assay One hundred percent concordance was observed between the custom assay and the FTD assay for eight viruses; HCoV OC43, HCoV 229E, HPIV-1, HPIV-2, HBoV, HPeV, Flu A, and Influenza A(H1N1)pdm09 while it varied from 94.66 to 99.71 % for the remaining ten viruses; Flu B, HRV, HPIV-3, HPIV-4, HCoV NL63, HMPV A/B, RSV A/B, EV, HCoV HKU1, HAdV. (Table 4).
Table 4

Concordance between custom and FTD assay

VirusFTD (+) Custom (+)FTD (+) Custom (-)Custom (+) FTD (-)Concordance between custom assay and FTD assay in %
HCoV OC43700100.0
HCoV 229E300100.0
Flu B120199.71
HPIV-1600100.0
HPIV-3221398.87
HPIV-451199.43
HPIV-2500100.0
HCoV NL6321099.71
HMPV A/B421099.71
RSV A/B6611894.66
HBoV1600100.0
HPeV100100.0
HRV650199.71
EV82498.31
HCoV HKU121099.71
HAdV260199.71
Flu A200100.0
Influenza A(H1N1)pdm092700100.0
Concordance between custom and FTD assay Low concordance was observed between the two assays for RSV A/B (94.66 %) and EV (98.31 %). The discordant results of the custom assay were seen in 19 co-infection samples, 13 single infection samples and four negative samples as compared to the FTD assay, and the discordance was predominant in the co-infected samples as compared to single infection samples (Table 5).
Table 5

Discordant results of custom and FTD assays

Custom assayFTD assayNumber of samples
RSV A/BNEGATIVE07
HBoV + RSV A/BHBoV02
HRV + RSVA/BHRV02
EV + RSV A/BEV01
HMPVA/B + RSV A/B + Flu BHMPVA/B + Flu B01
Influenza A(H1N1)pdm09 + RSVA/B + HBoV Influenza A(H1N1)pdm09 + HBoV01
HMPVA/B + RSV A/BHMPVA/B01
Flu B + RSV A/BFlu B01
HPIV-3 + RSV A/BHPIV-301
HPIV-3 + HRVHRV01
HBoV + HPIV-3HBoV01
aHPIV-4 + HRV aHPIV-3 + HRV01
EVNEGATIVE02
NEGATIVEEV01
HBoVHBoV + EV01
HCoV OC43HCoV OC43+ HCoV HKU101
HRV + HAdVHRV01
HPIV-2 + Flu BHPIV-201
HPIV-3NEGATIVE01
NEGATIVEHPIV-401
NEGATIVEHCoV NL6301
HPIV-3HPIV-3 + HMPVA/B01
Influenza A(H1N1)pdm09 + EV Influenza A(H1N1)pdm0901
HRV + RSVA/BHRV01
NEGATIVERSV A/B01
HRV + EVHRV01

aThis sample is counted as variation of co-infection on both the sides

Discordant results of custom and FTD assays aThis sample is counted as variation of co-infection on both the sides Comparisons between the custom assay and the FTD assay were made based on the different parameters listed in Table 6. Most of the findings between the custom assay and the FTD assay were similar except for the cost incurred for screening 18 respiratory viruses. In this regard, the custom assay was found to be more economical than the commercial FTD assay.
Table 6

Comparison of custom and FTD assay in regard to sample testing

Custom assayFTD assay
Viral PathogensFlu A, Influenza Flu A, Influenza
A(H1N1)pdm09, Flu BA(H1N1)pdm09, Flu B
HPIV - 1, 2, 3, 4HPIV - 1, 2, 3, 4
HCoV OC43, 229E, NL63,HCoV OC43, 229E, NL63,
HKU1,HKU1,
RSV A/BRSV A/B
HMPV A/BHMPV A/B
EVEV
HPeVHPeV
HRVHRV
HAdVHAdV
HBoVHBoV
--M. pneu
Sample volume200 μl200 μl
Elution volume55 μl55 μl
PCR volume25 μl25 μl
Principle of detectionFluroscence probe basedFluroscence probe based
Hands on time50 min50 min
Time to result3.5 h3.01 h
Total cost per sampleINR 1500INR 4300
Ease of Handling++
Equipment NucliSENS EasyMAG, ABI 7500 DX Fast NucliSENS EasyMAG, ABI 7500 DX Fast
No. of PCR tubes used per sample65
Primers & probesCustom assay (ABI)FTD
Number of targets/tube34
PCR reaction volumes
 2X RT-PCR buffer12.5 μl12.5 μl
 25X RT-PCR enzyme1.0 μl1.0 μl
 Primer probe mix/tube1.8 μl1.5 μl
 Nucleic acid9 μl10 μl
 Nuclease free water0.7 μl--
Comparison of custom and FTD assay in regard to sample testing

Discussion

The present study was performed to compare a custom multiplex assay and an FTD multiplex assay by testing of 356 respiratory samples obtained from children with SARI admitted in J K lone paediatric hospital Jaipur. In the present study, the concordance between the custom assay and the FTD assay was found to be 100 % for Flu A, Influenza A(H1N1) pdm09, HCoV OC43, HCoV 229E, HPIV-1, HPIV-2, HBoV, and HPeV. Similarly Chen et al., [7] reported a concordance of 99.60 % for Flu A and Influenza A(H1N1) pdm09 when comparing a multiplex PCR assay with a uniplex assay. The concordance between the two assays varied from 94.66 to 99.71 % for the remaining ten viruses; Flu B (99.71 %), HPIV-3 (99.71 %), HPIV-4 (99.43 %), HCoV NL63 (99.71 %), HMPV A/B (99.71 %), RSV A/B (94.66 %), HCoV HKU1 (99.71 %), HAdV (99.71 %), HRV (99.71 %), EV (98.31 %). Similar findings have been observed in earlier studies for Flu B (98.25 to 99.42 %), HPIV-3 (96.53 to 99.30 %), HPIV-4 (97.10 %), HCoV NL63 (95.95 to 100.0 %), HMPV A/B (99.65 to 100.0 %), RSV A/B (93.06 to 98.60 %), HCoV HKU1 (98.84 to 100.0 %), HAdV (97.20 to 100.0 %) [8, 9]. Concordance for EV in the present study was different from an earlier study (93.00 %) [8]. The difference in concordance obtained in different studies may be due to the different primer binding regions or may be due to different methodologies employed by various studies. The number of samples positive for HCoV 229E, HPIV-4, HPIV-2, HCoV NL63, HPeV, HCoV HKU1, Flu A, were ≤ 5 in the present study. Studies based on larger numbers of samples are required to assess the concordance of these viruses more thoroughly. The limit of detection for some of the viruses in the custom assay (Table 7) ranged from 1 DNA copy/ml to 2×104 copies/ml [7, 10–14]. The detection limit of the FTD assay for different viruses was 102 copies/ml for FluA, HPIV-2, HMPV and HCoV OC43; 103 copies/ml for FluB, HCoV HKU1, HPIV-1, HBoV, HPIV-3, HCoV NL63, RSV, HAdV, EV, and HPeV; and 104 copies/ml for HRV, HCoV 229E and HPIV-4 [15].
Table 7

Detection limits of different respiratory viruses by custom assay and FTD kit

Name of the virusCustom assay detection limitFTD assay detection limit
HBoV1 DNA copy/ml [13]103 copies/ml
HMPV30 RNA copies/ml [13]102 copies/ml
HPeV103 CCID50 - 104 (CCID50 [12]103 copies/ml
RSV A/B2 × 104 copies/ml [10]103 copies/ml
HCoV HKU15 × 103copies/ml [11]103 copies/ml
Flu B2.2 Log10 VP/ml [14]103 copies/ml
Influenza A(H1N1)pdm092 × 101 to 2 × 102 copies/ml [7]103 copies/ml
Detection limits of different respiratory viruses by custom assay and FTD kit In the present study RSV A/B was the most predominant virus detected by both the custom and FTD assays with positivity in 84 (23.60 %) and 67 (18.82 %) samples respectively and concordance of 94.66 %. This finding is different when compared with other studies [8, 16] where comparisons were made between multiplex PCRs in which RSV was the second most predominant virus detected [16]. The custom primer and probes used for Influenza A(H1N1) pdm09, RSV A/B, Flu B, HMPV A/B, HBoV, HRV, HPIV-1-4, HAdV and HCoVs showed a positivity of 7.58, 23.60, 3.65, 11.80, 4.49, 18.54, 11.79, 7.58 and 3.93 % respectively for each virus in the present study in comparison to a positivity of 18.39 % [7], 14.1 % [10], 13.3 % [17], 2.9 % [13], 0.5–4.5 % [13, 18, 19], 20.78 % [6], 8.62 % [6], 3.5 % [20], and 4.70 % [6] respectively in earlier studies where the same primer and probes were used. HBoV was mostly associated with co-infections in the present study in both assays. This is consistent with an earlier study [16] The major discrepancy in the present study was found with RSV A/B. The discrepancy in 18 samples which were over detected by the custom assay was resolved by RSV A and RSV B typing. The RSV typing results for the discrepant samples showed that all 18 samples were RSV B. Further all samples positive for RSV A/B by the FTD assay were also subjected to RSV typing which indicated RSV A in 13 (19.40 %) samples, RSV B in 50 (74.63 %) samples and RSV A & RSV B dual infections in 4 (5.97 %) samples During the process of standardisation of the custom assay 3 μl of viral nucleic acid (positive control) was used for each virus including 4 picomoles of primers and 2 picomoles of probes. Each panel consisted of 3 viruses. In total 9 μl of viral nucleic acid was used for each panel. While the FTD assay used 10ul of nucleic acid in each tube with primers and probes for 4 viruses, the concentration of primer and probe was not disclosed by FTD. In total 4 μl more of viral nucleic acid was used in the custom assay compared to the FTD assay which may have increased the sensitivity/detection of different viruses in the custom assay. Initially during the process of standardisation of the custom assay, different primer and probe concentrations were tried and the PCR was run for 45 cycles as per the protocol followed by various authors. Although data was analysed using PCRs run for 35 and 40 cycles, best results were achieved using a Ct value of 35 for both the FTD assay and the custom assay. Accordingly, a Ct value of <35 was considered as positive for both assays as per the FTD kit. With the custom assay being run for 40 cycles this reduces the custom assay run time by 8 min, thereby making it only 21 min longer than the FTD assay. Comparisons were made between various aspects of the custom and the FTD assays (Table 6). No major differences were observed between the two assays except in the cost incurred for both assays. Similar comparisons were also done in an earlier study [21] where three multiplex PCRs were compared. The turn-around time of the custom assay was 29 min more as compared to the FTD assay. But both the assays reported the results on the same day. The excess time of 29 min taken by the custom assay as compared to the FTD assay may not greatly interfere with the treatment process. However, the custom assay was much more economical costing INR 1500/- per sample for screening 18 respiratory viruses compared to the commercial FTD assay which was expensive costing INR 4300/- per sample. This assay may prove to be highly cost effective in resource limited settings like ours. However the limitation of our study was that some of the viruses showed low positivity as a result it is difficult to assess the concordance accurately. Larger numbers of positive samples need to be tested to evaluate the concordance of these less prevalent viruses.

Conclusion

This study reported a high prevalence of respiratory viruses in children ≤ 5 years using a custom assay and an FTD assay. Good concordance was observed for all the viruses between both assays except for RSVA/B. However larger numbers of positive samples need to be tested for thorough evaluation of less prevalent viruses. The custom primer and probe mix was much more economical than the commercial FTD kit. Our study suggests that this custom multiplex real-time RT-PCR can be used for simultaneous and rapid detection of multiple viruses in resource limited settings. This will help prevent unnecessary use of antibiotics and permit timely initiation of supportive therapy/antiviral drugs if available.

Abbreviations

ARI, acute respiratory infections; CCID, cell culture infective dose; EV, enterovirus; Flu A, influenza A; Flu B, influenza B; FTD, fast track diagnostic; HAdV, human adenovirus; HBoV, human bocavirus; HCoV 229E, human coronaviruses 229E; HCoV HKU1, human coronaviruses HKU1; HCoV-NL63, human coronaviruses NL63; HCoV-OC43, human coronaviruses OC43; HMPV A/B, human metapneumovirus; HPeV, human parechovirus; HPIV- 1, 2, 3 and 4, human parainfluenza viruses 1, 2, 3, and 4; HRV, human rhinovirus; IVD, in-vitro diagnostics; M.pneu, mycoplasma pneumoniae; NFQ, non fluorescence quencher; Pandemic H1N1, influenza A subtype H1N1; PCR, polymerase chain reaction; RSVA/B, respiratory syncytial virus; SARI, sever acute respiratory infections; SMS, Sawai Man Singh; VP, viral particles; VTM, viral transport medium
  21 in total

1.  Comparison of the Luminex Respiratory Virus Panel fast assay with in-house real-time PCR for respiratory viral infection diagnosis.

Authors:  Naomi J Gadsby; Alison Hardie; Eric C J Claas; Kate E Templeton
Journal:  J Clin Microbiol       Date:  2010-03-31       Impact factor: 5.948

2.  Replacing traditional diagnostics of fecal viral pathogens by a comprehensive panel of real-time PCRs.

Authors:  Petra F G Wolffs; Cathrien A Bruggeman; Gijs T J van Well; Inge H M van Loo
Journal:  J Clin Microbiol       Date:  2011-03-23       Impact factor: 5.948

3.  Real-time PCR assays for detection of bocavirus in human specimens.

Authors:  Xiaoyan Lu; Malinee Chittaganpitch; Sonja J Olsen; Ian M Mackay; Theo P Sloots; Alicia M Fry; Dean D Erdman
Journal:  J Clin Microbiol       Date:  2006-09       Impact factor: 5.948

Review 4.  Estimates of world-wide distribution of child deaths from acute respiratory infections.

Authors:  Brian G Williams; Eleanor Gouws; Cynthia Boschi-Pinto; Jennifer Bryce; Christopher Dye
Journal:  Lancet Infect Dis       Date:  2002-01       Impact factor: 25.071

5.  Collection by trained pediatricians or parents of mid-turbinate nasal flocked swabs for the detection of influenza viruses in childhood.

Authors:  Susanna Esposito; Claudio G Molteni; Cristina Daleno; Antonia Valzano; Claudia Tagliabue; Carlotta Galeone; Gregorio Milani; Emilio Fossali; Paola Marchisio; Nicola Principi
Journal:  Virol J       Date:  2010-04-30       Impact factor: 4.099

6.  Detection of all known parechoviruses by real-time PCR.

Authors:  W Allan Nix; Kaija Maher; E Susanne Johansson; Bo Niklasson; A Michael Lindberg; Mark A Pallansch; M Steven Oberste
Journal:  J Clin Microbiol       Date:  2008-06-04       Impact factor: 5.948

7.  During the summer 2009 outbreak of "swine flu" in Scotland what respiratory pathogens were diagnosed as H1N1/2009?

Authors:  Rory N Gunson; William F Carman
Journal:  BMC Infect Dis       Date:  2011-07-13       Impact factor: 3.090

8.  Respiratory viruses in children hospitalized for acute lower respiratory tract infection in Ghana.

Authors:  Theophilus B Kwofie; Yaw A Anane; Bernard Nkrumah; Augustina Annan; Samuel B Nguah; Michael Owusu
Journal:  Virol J       Date:  2012-04-10       Impact factor: 4.099

9.  Clinical evaluation of multiplex real-time PCR panels for rapid detection of respiratory viral infections.

Authors:  Sonali K Sanghavi; Arlene Bullotta; Shahid Husain; Charles R Rinaldo
Journal:  J Med Virol       Date:  2011-11-03       Impact factor: 2.327

10.  Human bocavirus infection among children, Jordan.

Authors:  Nasser M Kaplan; Winifred Dove; Ahmad F Abu-Zeid; Hiyam E Shamoon; Sawsan A Abd-Eldayem; C Anthony Hart
Journal:  Emerg Infect Dis       Date:  2006-09       Impact factor: 6.883

View more
  13 in total

1.  An open-source molecular diagnostic platform approach for outbreak and epidemic preparedness.

Authors:  Devy M Emperador; Laura T Mazzola; Cassandra Kelly-Cirino
Journal:  Afr J Lab Med       Date:  2020-09-28

2.  A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses.

Authors:  Zhenzhou Wan; Ya'nan Zhang; Zhixiang He; Jia Liu; Ke Lan; Yihong Hu; Chiyu Zhang
Journal:  Int J Mol Sci       Date:  2016-11-23       Impact factor: 5.923

Review 3.  Community-Acquired Pneumonia in Children: the Challenges of Microbiological Diagnosis.

Authors:  C M C Rodrigues; H Groves
Journal:  J Clin Microbiol       Date:  2018-02-22       Impact factor: 5.948

4.  Comparison of FTD® respiratory pathogens 33 and a singleplex CDC assay for the detection of respiratory viruses: A study from Cameroon.

Authors:  Sebastien Kenmoe; Clarisse Tcharnenwa; Gwladys C Monamele; Cyprien Nde Kengne; Mohamadou Njankouo Ripa; Brett Whitaker; Karen A Alroy; S Arunmozhi Balajee; Richard Njouom
Journal:  Diagn Microbiol Infect Dis       Date:  2019-01-16       Impact factor: 2.803

5.  Targeted Sequencing of Respiratory Viruses in Clinical Specimens for Pathogen Identification and Genome-Wide Analysis.

Authors:  Yu Yang; Shannon D Walls; Stephen M Gross; Gary P Schroth; Richard G Jarman; Jun Hang
Journal:  Methods Mol Biol       Date:  2018

6.  Comparison of performance between Fast Track Diagnostics Respiratory Kit and the CDC global reference laboratory for influenza rRT-PCR panel for detection of influenza A and influenza B.

Authors:  Assana Cissé; Jennifer Milucky; Abdoul Kader Ilboudo; Jessica L Waller; Brice Bicaba; Isaïe Medah; Sara Mirza; Cynthia G Whitney; Zekiba Tarnagda
Journal:  Influenza Other Respir Viruses       Date:  2021-02-26       Impact factor: 4.380

7.  Simultaneous detection of SARS-CoV-2 and pandemic (H1N1) 2009 virus with real-time isothermal platform.

Authors:  Lin Yu; Jingyao Wang; Xuelong Li; Lingling Mao; Yi Sui; Weihua Chen; Vicent Pelechano; Xing Guo; Xiushan Yin
Journal:  Heliyon       Date:  2021-07-15

8.  Upper respiratory infections in a rural area with reduced malaria transmission in Senegal: a pathogens community study.

Authors:  Roger C Tine; Léon A Ndiaye; Mbayame N Niang; Davy E Kiori; Ndongo Dia; Oumar Gaye; Hélène Broutin
Journal:  BMC Infect Dis       Date:  2018-09-10       Impact factor: 3.090

9.  DETECTION OF NON-INFLUENZA VIRUSES IN ACUTE RESPIRATORY INFECTIONS IN CHILDREN UNDER FIVE-YEAR-OLD IN COTE D'IVOIRE (JANUARY - DECEMBER 2013).

Authors:  Herve A Kadjo; Edgard Adjogoua; Ndongo Dia; Marius Adagba; Ouattara Abdoulaye; Saraka Daniel; Bertin Kouakou; David C Ngolo; Daouda Coulibaly; Talla Nzussouo Ndahwouh; Mireille Dosso
Journal:  Afr J Infect Dis       Date:  2018-06-18

10.  Development of Multiplex RT-PCR with Immobilized Primers for Identification of Infectious Human Pneumonia Pathogens.

Authors:  S A Lapa; R A Miftakhov; E S Klochikhina; Yu I Ammur; S A Blagodatskikh; V E Shershov; A S Zasedatelev; A V Chudinov
Journal:  Mol Biol       Date:  2021-12-17       Impact factor: 1.374

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.