Literature DB >> 27240331

Expression of Terpenoid Biosynthetic Genes and Accumulation of Chemical Constituents in Valeriana fauriei.

Yun Ji Park1, Mariadhas Valan Arasu2, Naif Abdullah Al-Dhabi3, Soon Sung Lim4, Yeon Bok Kim5, Sang Won Lee6, Sang Un Park7.   

Abstract

Valeriana fauriei (V. fauriei), which emits a characteristic and unpleasant odor, is important in traditional medicine. In this study, the expression of terpenoid biosynthetic genes was investigated in different organs that were also screened for volatile compounds including valerenic acid and its derivatives. Specific expression patterns from different parts of V. fauriei were observed using quantitative real-time PCR (qRT-PCR). The highest transcript levels of biosynthetic genes involved in mevalonic acid (MVA) and methylerythritol phosphate (MEP) production were found in the stem. Although the amounts of volatile compounds were varied by organ, most of the volatile terpenoids were accumulated in the root. Gas chromatography mass spectrometry (GC-MS) analysis identified 128 volatile compounds, which represented 65.33% to 95.66% of total volatiles. Certain compounds were only found in specific organs. For example, isovalerenic acid and valerenic acid and its derivatives were restricted to the root. Organs with high transcript levels did not necessarily have high levels of the corresponding chemical constituents. According to these results, we hypothesize that translocation may occur between different organs in V. fauriei.

Entities:  

Keywords:  Valeriana fauriei; gene expression; terpenoid; valerenic acid; volatile compounds

Mesh:

Substances:

Year:  2016        PMID: 27240331      PMCID: PMC6274141          DOI: 10.3390/molecules21060691

Source DB:  PubMed          Journal:  Molecules        ISSN: 1420-3049            Impact factor:   4.411


1. Introduction

Plants have complex mixtures of volatile lipophilic compounds with low molecular weight and high vapor pressure, derived from both primary and secondary metabolisms [1]. More than 1700 volatile compounds have been characterized from 90 plant families [2]. Plants release these compounds for general or specialized functions in both floral and vegetative tissues [3]. These compounds protect against herbivores, pathogens, and parasites, attract pollinators and seed dispersers, and provide plant–plant signaling [4]. Additionally, volatile compounds emitted from plants can seal wounds [5]. For millennia, humans have used floral scents from many aromatic plants, intended to attract pollinators, as sources of flavorings, preservatives, and herbal remedies [6]. Researches have documented antimicrobial, anti-inflammatory, bronchodilatory, expectorant, anticonvulsant, cholagogic, analgesic, and spasmolytic effects of volatile compounds [7]. Volatile compounds determine a plant’s chemotype and can influence its ecological relevance by shaping interactions with pollinators and herbivores [8]. Diverse volatile compounds are synthesized by different biochemical pathways in plants. There are lipoxygenase pathways including oxylipins, green leaf volatiles, isoprene and other terpenoids, some carotenoid derivatives, indoles, and phenolics, such as methyl salicylate [9]. Terpenoids, which constitute the largest class of volatiles from plants, are synthesized from isoprenoid pathways (Figure 1) [1]. There are three basic phases of volatile terpenoid biosynthesis [10]. First, C5-isoprene units are formed from isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP) via two compartmentally separated pathways, the mevalonic acid (MVA) pathway in the cytoplasm and the methylerythritol phosphate (MEP) pathway in the chloroplast. These precursors are then catalyzed by short-chain prenyltransferase to form prenyl diphosphates, including geranyl diphosphate (GPP), farnesyl diphosphate (FPP), and geranylgeranyl pyrophosphate (GGPP) [11,12]. Finally, many terpene synthases (TPS) synthesize prenyl diphosphates and build primary representatives of each type of terpenoid skeleton. Many volatile terpenoids are directly catalyzed by TPS, but others are modified by oxidation, dehydrogenation, acylation, and other types of reactions [10]. The MVA pathway is thought to provide three C5 units for volatile sesquiterpenes (C15), while the MEP pathway gives rise to volatile hemiterpenes (C5), monoterpenes (C10), and diterpenes (C20) [13]. However, metabolic cross talk has been demonstrated, regulated by exchange of isoprenes like IPP between cytosolic and chloroplastic pathways [14].
Figure 1

Volatile terpenoid biosynthetic pathways in plants. AACT, Acetoacetyl-CoA thiolase; CMK, 4-(cytidine 5′-diphosphate)-2-C-methyl-d-erythritol kinase; DMAPP, dimethylallyl diphosphate; DXP, 1-deoxy-d-xylulose 5-phosphate; DXR, DXP reductoisomerase; DXS, DXP synthase; FDS, farnesyl diphosphate synthase; FPP, farnesyl diphosphate; GA-3P, glyceraldehyde-3-phosphate; GDS, geranyl diphosphate synthase; GGPP, geranylgeranyl diphosphate; GPP, geranyl diphosphate; HDR, (E)-4-hydroxy-3-methylbut 2-enyl diphosphate reductase; HDS, (E)-4-hydroxy-3-methylbut-2-enyl diphosphate synthase; HMG-CoA, 3-hydroxy-3-methylglutaryl-CoA; HMGR, HMG-CoA reductase; HMGS, HMG-CoA synthase; IDI, isopentenyl diphosphate isomerase; IPP, isopentenyl diphosphate; MCT, 2-C-methyl-d-erythritol 4-phosphate cytidylyltransferase; MDS, 2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase; MEP, 2-C-methyl-D-erythritol 4-phosphate; MK, mevalonate kinase; MVA, mevalonate; MVD, mevalonate diphosphate decarboxylase; PMK, phosphomevalonate kinase; TPS, terpene synthases.

The genus Valeriana L. belongs to Caprifoliaceae (honeysuckle family), and includes approximately 250 perennial herbaceous species with malodorous root stalks [15], and grows in temperate areas around the world [16]. These species have been used as mild sedatives and tranquilizers in traditional medicine in various cultures since ancient times [17]. The rhizomes and roots are thought to induce sedation, promote sleep, and relieve depression and anxiety. Species of Valeriana are also used in the food, beverage, and cosmetic industries because of their unique flavor [18]. Many studies have demonstrated that extracts from Valeriana plants include terpenoids, iridoids, flavonoids, and alkaloids [16]. Valerenic acid and its derivatives accumulate in the roots and rhizomes in significant quantities [19]. Chemical constituents of Valeriana vary by species and with seasonal variation and ecological factors [16,17]. We profiled overall volatile compounds, including valerenic acid and its derivatives, from different tissues of Valeriana fauriei (V. fauriei) grown in South Korea. In addition, we characterized the expression patterns of terpenoid biosynthetic genes and compared them with patterns of volatile compound accumulation.

2. Results

2.1. Transcript Levels of Terpenoid Biosynthetic Genes

We determined differential organ-specific expression patterns of terpenoid biosynthetic genes in V. fauriei using qRT-PCR (quantitative real time polymerase chain reaction). The results are shown in Figure 2 and Figure 3. The height of each bar and the error bar indicate the mean and standard deviation based on three independent measurements. The Y-axis represents transcript levels normalized to 18S expression. Most genes related to the MVA pathway showed the highest expression levels in the stem, except for VfHMGS and VfHMGR. The expression patterns of VfAACT, VfMK, VfPMK, VfMVD, and VfFDS were fairly similar, with the highest levels occurring in the stem, followed by the root and the flower or the leaf. Interestingly, in roots, VfAACT and VfFDS, which are involved in the first and last steps of the MVA pathway, were expressed at similar levels to the stem. Among MVA biosynthetic genes, the expression of VfAACT, VfMK and VfMVD was high relative to 18S, while expression of VfFDS was the lowest relative to 18S. VfIDI, which produces the enzyme that catalyzes the isomerization of IPP to DMAPP in both the MVA and MEP pathways, was expressed most abundantly in the stem, followed by the flower, root, and leaf. According to analyses of MEP biosynthetic gene expression levels, most genes, including VfCMK, VfMDS, VfHDR, and VfGDS, had the highest expression levels in the stem, whereas VfDXR and VfHDS were highly expressed in the leaf. VfMCT had similar expression levels in all organs of V. fauriei. The lowest expression levels of VfDXR, VfMDS, VfHDS, and VfHDR were displayed in the root. In contrast, VfDXS transcripts, which are involved in the start of the MEP biosynthetic pathway, had their highest level in the root. Expression levels of terpenoid backbone biosynthetic genes, which lead to IPP and DMAPP production, were primarily high in stem of V. fauriei.
Figure 2

Transcript levels of MVA biosynthetic genes in different organs of V. fauriei (Vf). Genes encode the following enzymes: (a) VfAACT, acetoacetyl-CoA thiolase; (b) VfHMGS, 3-hydroxy-3-methylglutaryl-CoA synthase; (c) VfHMGR, 3-hydroxy-3-methylglutaryl-CoA reductase; (d) VfMK, mevalonate kinase; (e) VfPMK, phosphomevalonate kinase; (f) VfMVD, mevalonate diphosphate decarboxylase; (g) VfFDS, farnesyl diphosphate synthase; and (h) VfIDI, isopentenyl diphosphate isomerase.

Figure 3

Transcript levels of MEP biosynthetic genes in different organs from V. fauriei (Vf). Genes encode the following enzymes: (a) VfDXS, 1-deoxy-d-xylulose 5-phosphate synthase; (b) VfDXR, 1-deoxy-d-xylulose 5-phosphate reductoisomerase; (c) VfMCT, 2-C-methyl-d-erythritol 4-phosphate cytidylyltransferase; (d) VfCMK, 4-(cytidine 5’-diphosphate)-2-C-methyl-d-erythritol kinase; (e) VfMDS, 2-C-methyl-d-erythritol 2,4-cyclodiphosphate synthase; (f) VfHDS, (E)-4-hydroxy-3-methylbut-2-enyl diphosphate synthase; (g) VfHDR, (E)-4-hydroxy-3-methylbut 2-enyl diphosphate reductase; and (h) VfGDS, geranyl diphosphate synthase.

2.2. Analysis of Volatile Constituents

In total, 128 volatile compounds were separated and identified based on comparison of the mass spectra with the National Institute of Standards and Technology (NIST, Gaithersburg, MD, USA) atomic spectra database, Wiley Registry of Mass Spectral Data, and the related literature (Table 1) [20]. The total yield of the volatile compounds was indicated by the highest amount in the root (95.66%), followed by stem (84.05%), leaf (74.91%), and flower (65.33%). We identified 18 monoterpenes, 34 sesquiterpenes, and 80 other volatile compounds from V. fauriei. Monoterpenes, namely borneol (11, 22.96%), bornyl acetate (13, 19.92%), and camphene (1, 3.33%) were found in high amounts in the roots. Interestingly, β-terpinene (3), myrcene (4), p-cymene (5), and borneol (11) were detected only in the root. The leaf extract was characterized by a high content of endo-borneol (10, 11.48%) and γ-terpinene (7, 3.23%). Sesquiterpenes accumulated primarily in the stem (21.55%) and roots (20.66%). The stem contained the highest amount of the sesquiterpene caryophyllene oxide (34, 17.45%). Seven sesquiterpenes (20–22, 24–26, and 50) were root-specific, while four others (33, 37, 39, and 51) were flower-specific. Isovalerenic acid (53, 3.33%), which produces the strong smell of Valeriana species, was found only in the root of V. fauriei.
Table 1

Composition of volatile compounds in different organs from V. fauriei.

No.Volatile CompoundsRI *Relative Peak Area (%)
FlowerStemLeafRoot
1n-Hexanal1.430000.162 ± 0.004
2Isovaleric acid11.960003.338 ± 0.082
3Camphene12.910003.338 ± 0.082
4β-Pinene13.6401.244 ± 0.10300.173 ± 0.0041
5β-Terpinene14.510000.558 ± 0.014
6Myrcene15.440000.465 ± 0.011
7p-Cymene17.220000.085 ± 0.002
8β-Phellandrene17.791.277 ± 0.111000.803 ± 0.020
9γ-Terpinene19.090.132 ± 0.01103.231 ± 0.2620.052 ± 0.001
10Terpinolene21.3500.901 ± 0.07400.041 ± 0.001
11Ethyl 3-Hydroxymandelate21.540.197 ± 0.0170.699 ± 0.0585.331 ± 0.4330
12d-Limonene22.900.282 ± 0.024000.082 ± 0.002
131,3-Bis-(p-carbamoylmethylphenoxy)-2-propanol23.180.512 ± 0.044000
14endo-Borneol23.6000.125 ± 0.01011.482 ± 0.9322.841 ± 0.069
151-(4-methoxyphenyl)imidazzoline-2-thione24.220.564 ± 0.0490.211 ± 0.01700
162,2-Dimethyl-3-heptanone24.41000.561 ± 0.0460
171,2,4-Trizol-3-amene24.870.179 ± 0.016000
18Borneol25.1100022.96 ± 0.561
19Benzoic acid25.3500.966 ± 0.08001.522 ± 0.037
20Benzothialzole25.872.725 ± 0.237000
21Eudesmol25.9500.354 ± 0.02900.077 ± 0.002
222-Isopropyl-5-methyl anisole26.470.987 ± 0.0860.497 ± 0.04100
23Myrtenyl acetate26.73002.226 ± 0.1811.729 ± 0.042
242-Hexanoylfuran27.270.610 ± 0.05300.556 ± 0.0450.132 ± 0.003
25Perillaldehyde27.570.834 ± 0.072001.071 ± 0.026
269-oxo-(2,6-dimethylpehenyl)amide 9-H-Fluorene-4-carboxylic acid27.941.067 ± 0.0930.241 ± 0.02021.436 ± 1.7410.581 ± 0.014
27Acetic acid28.310.612 ± 0.05300.353 ± 0.0290.86 ± 0.021
28α-Gurjunene29.740.640 ± 0.056000.133 ± 0.003
29Bornyl acetate30.510.132 ± 0.0110019.923 ± 0.487
309H-Fluorene-4-carboxylic acid30.770.266 ± 0.0230.306 ± 0.0250.253 ± 0.0210.087 ± 0.002
31α-Elemene30.880000.038 ± 0.001
321-Trifluoromethyl-4-(2-emthoxylbenzyloxy)-3-nitro-benzene31.060.298 ± 0.0260.078 ± 0.00600.029 ± 0.001
33N-(Cyclohexanecarbonyl)-l-proline isobutyl ester31.350.133 ± 0.012000.022 ± 0.001
34Bromopropylate31.970.461 ± 0.0400.367 ± 0.03000.318 ± 0.008
35Methadone N-oxide32.500.286 ± 0.02502.524 ± 0.2050.509 ± 0.012
36Quinoline33.010.191 ± 0.0170.174 ± 0.0141.510 ± 0.1231.35 ± 0.033
372-Chloro-6-methyl-pyridine33.400.190 ± 0.0160.226 ± 0.0190.456 ± 0.0370.065 ± 0.002
38Pentadecane33.510.170 ± 0.015000.095 ± 0.002
394,6-bis(1-Methylethyl)-trans-1,3-dioxane34.0000.074 ± 0.0060.751 ± 0.0610.065 ± 0.002
40o-Choloroaniline34.1200.955 ± 0.0791.886 ± 0.1530
41α-Caryophyllene alcohol34.720001.272 ± 0.031
42Isolonhifolan-8-ol34.810.8410.07300.424 ± 0.0340.209 ± 0.005
43γ-Elemene34.930000.357 ± 0.009
44Caryophyllene35.220.680 ± 0.05900.205 ± 0.0170.134 ± 0.003
455-(Phenylmethyl)-2-thioxo-4-imidazolidinone35.3702.235 ± 0.01850.434 ± 0.0350
46α-Acorenol36.040.284 ± 0.025004.025 ± 0.098
47cis-β-Farnesene36.180000.041 ± 0.001
48Humulene36.280000.085 ± 0.002
49Aromadendrene36.560000.741 ± 0.018
50Alloaromandendrene36.711.162 ± 0.101000.066 ± 0.002
51Ylangene36.9200.299 ± 0.0250.779 ± 0.0632.878 ± 0.070
521-(1,5-Dimethyl-4-hexenyl)-4-methyl-benzene37.131.181 ± 0.1020.297 ± 0.02500.065 ± 0.002
53β-Ionone37.390.554 ± 0.0480.179 ± 0.0150.922 ± 0.0752.333 ± 0.057
54Pentadecane37.6200.523 ± 0.0430.439 ± 0.0361.786 ± 0.044
55N-(1H-1,3-Benzimidazol-2-ylmethyl)-4-methoxy-benzamide38.311.646 ± 0.1430.047 ± 0.0040.629 ± 0.0510.475 ± 0.012
56Malonic acid38.50001.177 ± 0.0963.118 ± 0.076
57β-Bisabolene38.8100.158 ± 0.0130.119 ± 0.0100.54 ± 0.013
58cis-Sesquisabinene38.872.302 ± 0.2000.640 ± 0.0532.530 ± 0.02050.527 ± 0.013
59N-Phenyl-(3-methyl-2-oxiranyl) methyl carbamate39.0300.362 ± 0.03000.287 ± 0.007
60Bornyl isovalerate39.201.110 ± 0.0960.143 ± 0.0120.674 ± 0.0550.216 ± 0.005
61exo-3-Methyl-1,7,7-trimethylbicyclo[2,2,1]hept-2-yl butanoate39.5000.143 ± 0.01202.464 ± 0.060
622.6-Dimethylnon-1-en-3-yn-5-yl valeric acid39.810.708 ± 0.061001.249 ± 0.031
63cis-α-Bisabolene40.330.621 ± 0.05400.533 ± 0.0430.187 ± 0.005
64trans-Sesquisabinene40.50000.467 ± 0.0380.213 ± 0.005
651-Phenylthio-3-(1-piperidyl)-propan-2ol40.610.894 ± 0.078000.134 ± 0.003
666-epi-Shyobunol40.7900.139 ± 0.01102.376 ± 0.058
67Photocitral B40.970.779 ± 0.0680.356 ± 0.0292.119 ± 0.01720.282 ± 0.007
68N-(4-Methoxyphenyl)-propanamide41.421.247 ± 0.0190.339 ± 0.0281.212 ± 0.0982.537 ± 0.062
69Menthyl acetate41.6800.254 ± 0.0210.901 ± 0.0730.08 ± 0.002
70(−)-Isolongifolol methyl ether42.090000.207 ± 0.005
715,5-Dimethyl-4-(3-methyl-1,3-butadienyl)-1-oxaspiro[2,5]octane42.201.121 ± 0.097000.127 ± 0.003
723,3-dichlorodihydro-2(3H)-furanone42.380000.313 ± 0.008
73Z-9-Pentadecenol42.742.454 ± 0.2131.530 ± 0.1263.563 ± 0.2890.544 ± 0.013
74Acetonylacetone dioxime42.9700.122 ± 0.01000
751-Adamantylmethyl 3-methyl-2-butenoate43.271.593 ± 0.1381.392 ± 0.1150.223 ± 0.0180.221 ± 0.005
763-(Methylthio)phenyl isothiocyanate43.8900.527 ± 0.0440.921 ± 0.0750.041 ± 0.001
771-Adamantylmethyl octanoic acid44.200.780 ± 0.06811.040 ± 0.91200.123 ± 0.003
782-(Methylthio)-benzothialzole44.431.013 ± 0.0880.300 ± 0.0250.280 ± 0.0230.06 ± 0.001
793-Methyl-2(3H)-benzothiazolethione44.740.596 ± 0.0520.439 ± 0.0360.654 ± 0.0530.046 ± 0.001
80Pentanoic acid45.251.072 ± 0.090.531 ± 0.0440.522 ± 0.0420.165 ± 0.004
81Terpinyl acetate45.421.550 ± 0.1353.000 ± 0.24800
82p-Methoxybenzylazidoformate46.290.975 ± 0.0852.492 ± 0.2061.051 ± 0.0850.439 ± 0.011
835-Amino-ethyl ester [1,2,4]triazolo[4.3-a]pyrimidine-6-carboxylate46.470.611 ± 0.0530.288 ± 0.02400
841,3,-Trimethyl-2-hydroxymethyl-3,3-dimethyl-4(3-methylbut-2-eny)-cyclohexene46.711.044 ± 0.0910.766 ± 0.06300
855-Butyl-6-hexyloctahydro-1H-indene47.140.992 ± 0.0860.229 ± 0.01900
864-Hydroxy-2-hydroxymethyl-6-methylpyrimidine47.470.456 ± 0.040 000
87Murolan-3,9(11)-diene-10-peroxy47.760.888 ± 0.0770.355 ± 0.0290.482 ± 0.0390.131 ± 0.003
88Methanone48.040.414 ± 0.0360.2750.02300
898-Chlorooctyl isobutyl carbonate48.290.522 ± 0.0450.134 ± 0.01100
901,2-Pentanediol48.720.719 ± 0.062000.031 ± 0.001
91Bicyclogermacrene49.211.642 ± 0.143000
92Larixone49.3900.159 ± 0.01300
93Ursane-3,16-diol49.700.856 ± 0.0740.921 ± 0.0760.640 ± 0.0520.04 ± 0.001
94Dodecahydro-3,8,8,11a-tetramethyl-5H-3,5a-epoxynaphth[2,1-c]oxepin49.941.248 ± 0.1080.354 ± 0.02900
95Hexahydro-5-methyl-1-phenyl-1,3,5-triazine-2-thione50.2701.515 ± 0.1250.240 ± 0.0190
96(2R,4R)-p-Mentha-6,8-diene-2-hydroperoxide50.710.793 ± 0.0690.271 ± 0.02200
974-(Diethoxyphosphiniyl)butanoic acid51.180.259 ± 0.0220.246 ± 0.02000
982,2-Dimethylpropanoic acid51.740.878 ± 0.0760.076 ± 0.00600
99Nerolidol isobutyrate52.170.587 ± 0.0510.253 ± 0.02100
100Longifolenaldehyde52.310.510 ± 0.044000
101Caryophyllene oxide52.670.359 ± 0.03117.454 ± 1.44200
102Carbamic acid52.890.670 ± 0.0580.939 ± 0.0780.220 ± 0.0180.061 ± 0.001
103Ptenin-6-carboxylic acid53.221.473 ± 0.1272.224 ± 0.18300.024 ± 0.001
1042,4,4-Trimethyl-3-hydroxymethyl-5a-(3-methyl-but-2-enyl)-cyclohexene53.480.218 ± 0.0190.324 ± 0.02700
1052-(2-Dodecen-1yl)succinic acid53.760.801 ± 0.0700.145 ± 0.01200
106Ginsenol54.370.294 ± 0.0260.394 ± 0.03300
107Costunolide54.5500.114 ± 0.00900
1081-Formyl-2,2,6-trimethyl-3-(3-methyl-but-2-enyl)-6-cyclohexene54.953.140 ± 0.2731.125 ± 0.09300
1094-epi-Cubedol55.610.819 ± 0.0710.313 ± 0.02600
1105-(6-Bromodecahydro-2-hydroxy-2,5,5a,8a-tetramethyl-1-naphthalene)-1,2-pentanediol55.820.441 ± 0.038000
111(8S,14)-Cedran-diol56.000.855 ± 0.0740.914 ± 0.07500
112Cedrol56.390.379 ± 0.033000
1138-Propoxy cedrane56.650.187 ± 0.0160.078 ± 0.00600
1145,6,6-Trimethyl-undeca-3,4-diene-2,10-dione56.810.311 ± 0.0270.130 ± 0.01100
115Octahydro [1,2]azaborino[1,2-a][1,2]azaborine57.530.535 ± 0.046000
1162.6-Dimethylnon-1-en-3-yn-5-yl valeric acid58.560.292 ± 0.025000
117Terephthalic acid58.800.174 ± 0.0157.487 ± 0.61800
118Adamantane58.980.457 ± 0.0400.944 ± 0.07800
1194,7-Methano-3,6,8-methenocyclopent[a]indene59.800.105 ± 0.009000
1204-Dimethylamino-2-methyl-1-phenyl-butan-2-ol60.110.316 ± 0.0270.376 ± 0.03100
121(±)cis-3,4-Dimethyl-2-phenyltetrahydro-1,4-thiazine61.090.185 ± 0.016000
1222-Isopropyl-6-phenylnicotinonitrile62.820.251 ± 0.022000
1232-Propenoic acid64.220.242 ± 0.0210.300 ± 0.02500
124Hexanedioic acid64.570.476 ± 0.0417.976 ± 0.65900
125Methadone N-oxide65.010.115 ± 0.010000
126Isophthalic acid67.21 0.591 ± 0.0511.164 ± 0.09600
127Diisooctyl phthalate68.010.276 ± 0.0240.420 ± 0.03500
128Di-(2-methyoxyethyl) Isophthalate69.1800.113 ± 0.00900
Total 65.33 ± 5.56484.057 ± 6.93274.916 ± 6.07395.661 ± 2.342

* Retent ion time (min).

2.3. Amounts of Valerenic Acid and Its Derivatives

Valerenic acid and its derivatives, acetoxyvalerenic acid and hydroxyvalerenic acid, were extracted from different organs (flower, stem, leaf, and root) of V. fauriei and analyzed with HPLC. Valerenic acid and its derivatives were detected only in roots (Table 2). However, flowers, stems, and leaves have not shown detectable levels of the three compounds. The root extract had an average of 69.450 μg of valerenic acid per g of dry weight. Acetoxyvalerenic acid (32.234 μg/g dry weight) also had a high accumulation in the root. However, hydroxyvalerenic acid was not detected in any organ.
Table 2

Amounts of valerenic acid and its derivatives in V. fauriei roots.

CompoundDry Weight (μg/g)
valerenic acid69.450 ± 0.263
acetoxyvalerenic acid32.234 ± 0.961
hydroxyvalerenic acidn.d. 1

Numbers indicate the mean of three replicates ± standard deviation. 1 n.d. = not detected.

3. Discussion

There is considerable interest in chemical composition variation in Valeriana owing to the numerous beneficial properties attributed to consumption of the genus. Previously, the genes involved in volatile terpenoid biosynthesis had not been investigated in different organs of V. fauriei. Our study documents the compositional diversity and amount of volatile compounds, including valerenic acid and its derivatives, and quantifies the expression of genes involved in terpenoid biosynthetic pathways, in different organs of V. fauriei. Roots had high amounts of volatile compounds but low transcript levels. Evidently, expression levels of terpenoid biosynthetic genes did not correspond with the storage of volatile constituents, indicating that products synthesized in the stem or other organs may be translocated into the root. Earlier experimental studies have found similar results. Plants often transport natural products from a synthesis site to an accumulation site [21]. For example, compounds were synthesized in the stem and leaf, then transported to the root of Astragalus membranaceus Moench [22]. In addition, Lykkesfeldt and Moller [23] have reported the synthesis and translocation of glucosinolates from leaves to seeds during development in Tropaeolum majus L. Moreover, nicotine and caffeine, which are primarily produced roots, are transferred to leaves in Arabidopsis thaliana (L.) Heynh. [24]. Translocation of secondary metabolites from source cells to neighboring cells, or even further to other tissues usually occurs in plants. Volatile terpenes are emitted by the transcript levels of biosynthetic enzymes, and transporter for their emission is not required. However, the strong evidence which demonstrates to deny the presence of broad-specificity transporters for the emission of volatiles has not yet been identified. In addition, the mechanism for the long-distance translocation of volatiles has not been investigated in plants [25]. Therefore, we should carry out more experiments such as feeding of radio labels to V. fauriei tissues to clarify the transport and accumulation of volatile compounds in further study. Various taxa of Valeriana, including V. officinalis L., V. jatamansi Jones, V. officinalis var. latifolia Miq., V. amurensis P. Smirn. ex Kom., V. fauriei, and V. alternifolia Bunge var. stolonifera A.I. Baranov & Skvortsov, have been the focus of scientific studies [18,26,27]. Several studies have included experiments to isolate and identify chemical constituents including sesquiterpenoids and iridoid glycosides from V. fauriei [26,27]. In our study, we identified 128 volatile compounds in V. fauriei by GC/MS. Although most volatile compounds had high concentrations in the roots, each organ had several distinctive compounds that served as biochemical markers. For example, isovalerenic acid, which causes the malodorous characteristic, was accumulated solely in the root of V. fauriei. In addition, we found that borneol and bornyl acetate were the most abundant monoterpenes in the roots of V. fauriei, in agreement with the results from previous studies. Wang et al. [18] documented that V. officinalis var. latifolia contained the highest amounts of bornyl acetate (23.93%) in the roots. To date, more than 100 members of TPSs have been identified from various plant species [13]. The action of these enzymatic family lead to structurally diverse cyclic and acyclic monoterpenes and sesquiterpenes [28]. Specific monoterpene synthase catalyze from GPP to various skeletons which are the precursors such as olefins, alcohols and diphosphate esters for the biosynthesis of monoterpenes [29]. Also, the enzymatic cyclization in several plants including Salvia, Mentha, Tanacetum, Foeniculum, Pinus, and Citrus species has been reported [30]. Cyclization of linalyl diphosphate derived from GPP occurs to form the α-terpinyl cation, which is the universal monocyclic intermediate. Then, bornane family such as borneol, bornyl acetate, and camphor is converted by hydrolysis, oxidation, and rearrangement of carbocylic skeleton [31]. It has been investigated that bornyl diphosphate synthase acts on production of bornane-type monoterpenes in higher plants [32]. The characteristic compound valerenic acid, along with its derivatives and iridoids, are primarily accumulated in the roots and rhizomes of Valeriana species [20].Similarly, we found that high amounts of valerenic acid and hydroxyvalerenic acid were detected only in the roots of V. fauriei. Navarrete et al. [33] performed quantitative analyses of valerenic acids (valerenic, hydroxyvalerenic, and acetoxyvalerenic) in Valeriana species including V. officinalis, V. edulis Nutt. ex Torr. & A. Gray, V. sitchensis Bong., and V. jatamansi, but only V. officinalis and V. sitchensis accumulated these compounds. In summary, we analyzed organ specificity in general-common MVA and MEP biosynthesis by measuring transcript levels of related biosynthetic genes. We also measured the accumulation of volatile compounds, and the presence of valerenic acid and its derivatives, in specific organs. We separated and identified 128 volatile compounds in V. fauriei cultivated in South Korea. Volatile compounds were detected in all tested organs, but most of the volatile compounds were stored in the root. In contrast, high levels of gene expression predominantly occurred in the stem. Therefore, terpenoids appear to be translocated after biosynthesis and are stored in specific organs.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

V. fauriei plants were grown at the experimental station, National Institute of Horticultural and Herbal Science (NIHHS), Rural Development Administration (RDA), Pyeongchang, Gangwon-do, South Korea. The plants were grown outdoors in a field from 2013 to 2014. Leaves, stems, flowers, and roots were collected in July 2014 (Figure 4) and then immediately frozen in liquid nitrogen. Different organs from three individual plants were harvested under the same experimental settings. The materials were stored at −80 °C until they were used.
Figure 4

Photographs of two-year-old V. fauriei grown in Pyeongchang, Gangwon-do, South Korea.

4.2. Total RNA Extraction and cDNA Preparation

Total RNA was isolated from each organ using a Total RNA Mini Kit (Geneaid, New Taipei City, Taiwan) following the manufacturer’s instructions using three biological replicates. DNase I (Qiagen, Hilden, North Rhine-Westphalia, Germany) was used to remove genomic DNA. RNA concentration and purity were confirmed with agarose gel electrophoresis and a NanoVue Plus Spectrophotometer (GE Healthcare Bio-Science Corp., Piscataway, NJ, USA). cDNA was synthesized from 1 μg of total RNA using the ReverTra Ace-α Kit (Toyobo, Osaka, Japan).

4.3. qRT-PCR Analysis

All gene specific primers used were designed as previously described by Park et al [34] (Table A1). qRT-PCR was performed with a BIO-RAD CFX96 Real-time PCR system (Bio-Rad Laboratories, Hercules, CA, USA) with the 2X Real-Time PCR smart mix (Solgent Co., Ltd. Daejeon, Korea) under the following conditions: initial denaturation at 95 °C for 15 min, 39 cycles of denaturation for 20 s at 95 °C and annealing for 20 s at 72 °C, with a final extension at 72 °C for 10 min. Melting curves were analyzed to verify reaction specificity. Means and standard deviations were calculated from three independent biological replicates for each sample and compared by organ.
Table A1

Primers sets used in the experiments and their efficiency (%) for qRT-PCR.

PrimerSequence (5′ to 3′)Amplication (bp)Primer Efficiency (%)
VfAACT-FATCGGGCATGAAAGCAACCA12997.9
VfAACT-RGATCCCTTCCTTGCTTCCGCTA
VfHMGS-FTGGTGGAACTGCAGCATTGTTC13198.8
VfHMGS-RCCGCACTGTCTGTGCACACGA
VfHMGR-FTCAGATGCCCTGCCTCTTCC102100.2
VfHMGR-RGATCTTCTCGCGCCACCTTG
VfMK-FCGGCGGCTGCGTATTGACT133107.1
VfMK-RGCAAATCTCGAGCCCATTGC
VfPMK-FGAGCCGGAATCACAGACGGA14693.3
VfPMK-RCTCCACGTCTTTGCGAGGCT
VfMVD-FAATGGAATCGCGCTGAAGGA10598
VfMVD-RCACAGCATTCGGCCCAGCAT
VfIDI-FAGCAGATGCAGGCGAAGAGG11193.3
VfIDI-RGCCTCGCTTAAGTTCCCGTTCT
VfFDS-FTGATGACGACGGCAAGGAGA13194.9
VfFDS-RCACCAACCAAGTGAGCATGCAAGA
VfDXS-FGCCCAATACCACCTGTCGGA12195.8
VfDXS-RTGCATCGGTCCACCAATCTG
VfDXR-FAGAACTCCGGTCATTGTGCCA120100.1
VfDXR-RCCGCCTCGATCTTTGCAAGTTA
VfMCT-FTCAGTTGCTCTGCAAATGGGAGT104102.2
VfMCT-RTCCCATTCTTGTGCCCTTTCC
VfCMK-FGCACCATTGTTGGGATCGGT11382.6
VfCMK-RCTCGTTCTCGGCTCGTGTGA
VfMDS-FTGCAGCTACTGCTGCTGTGGA14470.6
VfMDS-RGGTATGTTGATGCCGCCGAT
VfHDS-FCTGACAGGCGGGCACAGTTT13497.1
VfHDS-RGCCGATTCGCATAGCTCTTCC
VfHDR-FCCGAAGCAATCGGGAAGTTG11295
VfHDR-RCGCTCTTGAGTAGCGTCGCA
VfGDS-FTAGCAGTGCTGGCGGGAGAT145102.8
VfGDS-RTCGCGCGTCGTACTCATTTG

4.4. GC and GC-MS

Samples (10 g) of the fresh material (leaves, stems, flowers, and roots) were weighed and placed in vials with 25 mL of headspace. A fused-silica fiber covered with a 75-μm-thick layer of carboxen/polydimethylsiloxane (CAR/PDMS) was used to absorb volatile compounds. It was exposed in the headspace in the vials at 25 °C for 20 min, then removed from vials and introduced directly into the GC injector where thermal desorption of the analysis was performed at 250 °C for 3 min. GC analysis was carried out with an Agilent 6890N GC mainframe fitted with an HP-5 fused-silica capillary column (30 m × 0.32 mm i.d., 0.25 μm film thickness; Agilent, Santa Clara, CA, USA) and a flame ionization detector (FID). The injector and detector temperatures for each analysis were 250 °C and 280 °C, respectively. The carrier gas was nitrogen, with a flow rate of 1.0 mL/min. The column temperature was maintained at 50 °C for 5 min and then programmed as follows: increase from 50 °C to 260 °C at a rate of 3 °C·min−1, increase from 260 °C to 280 °C at a rate of 10 °C·min−1, and hold at 280 °C for 5 min. GC-MS analysis was performed on a Polaris Q GC/MS (Thermo Finnigan, Waltham, MA, USA) coupled with an HP-5 fused-silica capillary column (30 m × 0.32 mm i.d., film thickness 0.25 μm; Agilent). Helium was used as the carrier gas at a flow rate of 1.0 mL/min. The mass spectra were obtained with an ionization voltage of 70 eV, trap current of 250 μA, and ion source temperature of 200 °C. The oven temperature program was the same as described previously, and injections were made in splitless mode. Volatile compounds were separated and identified based on comparison of the mass spectra with the National Institute of Standards and Technology (NIST) atomic spectra database, Wiley Registry of Mass Spectral Data, and the related literature. Total ion current chromatograms were recorded in a mass range of 40–400 amu. The analyses were performed using three biological replicates.

4.5. Measurement of Valerenic Acid and Derivatives

All samples were lyophilized at −80 °C for 72 h. Dried samples were ground into a fine powder using a mortar and pestle. One g of powdered sample was extracted with 10 mL of 90% (v/v) methanol at room temperature for 30 min and then centrifuged at 19354 rcf for 10 min. The supernatant was transferred to a new tube. Centrifugation and supernatant transfer were repeated two more times. The final extract was adjusted to 1 mL through evaporation using a LABOROTA 4000 rotary evaporator (Heidolph Instruments GmbH, Schwabach, Bavaria, Germany). The solution was filtered with a 0.45 μm Acrodisc syringe filter (Pall Corp.; Port Washington, NY, USA) for HPLC analysis. HPLC analysis was performed with a Futecs model NS-4000 HPLC apparatus (Daejeon, Korea) and a C18 column (μBondapak™ C18 10 μm 125Å 3.9 × 300 nm column, Waters, Milford, MA, USA). The mobile phase had a gradient prepared from mixtures of acetonitrile and 0.25% phosphoric acid, and the column temperature was maintained at 30 °C. The flow rate was maintained at 0.7 mL/min. Twenty microliters of the solution was injected into the HPLC, and the detection wavelength was set at 221 nm. The analysis was performed using three biological replicates.

4.6. Statistical Analysis

The data for gene expression and valerenic acid and its derivatives contents were analyzed by Microsoft EXCEL (Version. 2010, Microsoft Corporation, Seattle, WA, USA). Statistical analyses for the relative peak areas were conducted using XL-STAT, version 2013 (Addinsoft, NY, USA).
  27 in total

1.  Essential oils analysis. II. Mass spectra identification of terpene and phenylpropane derivatives.

Authors:  R Oprean; L Oprean; M Tamas; R Sandulescu; L Roman
Journal:  J Pharm Biomed Anal       Date:  2001-03       Impact factor: 3.935

Review 2.  The formation and function of plant volatiles: perfumes for pollinator attraction and defense.

Authors:  Eran Pichersky; Jonathan Gershenzon
Journal:  Curr Opin Plant Biol       Date:  2002-06       Impact factor: 7.834

Review 3.  Structure, mechanism and function of prenyltransferases.

Authors:  Po-Huang Liang; Tzu-Ping Ko; Andrew H-J Wang
Journal:  Eur J Biochem       Date:  2002-07

Review 4.  Biochemistry of plant volatiles.

Authors:  Natalia Dudareva; Eran Pichersky; Jonathan Gershenzon
Journal:  Plant Physiol       Date:  2004-08       Impact factor: 8.340

Review 5.  Transporters of secondary metabolites.

Authors:  Kazufumi Yazaki
Journal:  Curr Opin Plant Biol       Date:  2005-06       Impact factor: 7.834

6.  A new family of high-affinity transporters for adenine, cytosine, and purine derivatives in Arabidopsis.

Authors:  B Gillissen; L Bürkle; B André; C Kühn; D Rentsch; B Brandl; W B Frommer
Journal:  Plant Cell       Date:  2000-02       Impact factor: 11.277

7.  The scientific basis for the reputed activity of Valerian.

Authors:  P J Houghton
Journal:  J Pharm Pharmacol       Date:  1999-05       Impact factor: 3.765

8.  Synthesis of Benzylglucosinolate in Tropaeolum majus L. (Isothiocyanates as Potent Enzyme Inhibitors).

Authors:  J. Lykkesfeldt; B. L. Moller
Journal:  Plant Physiol       Date:  1993-06       Impact factor: 8.340

9.  Isoflavonoid biosynthesis and accumulation in developing soybean seeds.

Authors:  Sangeeta Dhaubhadel; Brian D McGarvey; Ruthanne Williams; Mark Gijzen
Journal:  Plant Mol Biol       Date:  2003-12       Impact factor: 4.076

Review 10.  Biosynthesis of plant volatiles: nature's diversity and ingenuity.

Authors:  Eran Pichersky; Joseph P Noel; Natalia Dudareva
Journal:  Science       Date:  2006-02-10       Impact factor: 47.728

View more
  1 in total

1.  Transcriptomic Analysis, Cloning, Characterization, and Expression Analysis of Triterpene Biosynthetic Genes and Triterpene Accumulation in the Hairy Roots of Platycodon grandiflorum Exposed to Methyl Jasmonate.

Authors:  Yong-Kyoung Kim; Ramaraj Sathasivam; Yeon Bok Kim; Jae Kwang Kim; Sang Un Park
Journal:  ACS Omega       Date:  2021-05-04
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.