| Literature DB >> 27200013 |
Rui Ma1, Sheng Xu1, Yucheng Zhao2, Bing Xia1, Ren Wang1.
Abstract
Lycoris aurea (L' Hér.) Herb, a perennial grass species, produces a unique variety of pharmacologically active Amaryllidaceae alkaloids. However, the key enzymes and their expression pattern involved in the biosynthesis of Amaryllidaceae alkaloids (especially for galanthamine) are far from being fully understood. Quantitative real-time polymerase chain reaction (qRT-PCR), a commonly used method for quantifying gene expression, requires stable reference genes to normalize its data. In this study, to choose the appropriate reference genes under different experimental conditions, 14 genes including YLS8 (mitosis protein YLS8), CYP2 (Cyclophilin 2), CYP 1 (Cyclophilin 1), TIP41 (TIP41-like protein), EXP2 (Expressed protein 2), PTBP1 (Polypyrimidine tract-binding protein 1), EXP1 (Expressed protein 1), PP2A (Serine/threonine-protein phosphatase 2A), β-TUB (β-tubulin), α-TUB (α-tubulin), EF1-α (Elongation factor 1-α), UBC (Ubiquitin-conjugating enzyme), ACT (Actin) and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) were selected from the transcriptome datasets of L. aurea. And then, expressions of these genes were assessed by qRT-PCR in various tissues and the roots under different treatments. The expression stability of the 14 candidates was analyzed by three commonly used software programs (geNorm, NormFinder, and BestKeeper), and their results were further integrated into a comprehensive ranking based on the geometric mean. The results show the relatively stable genes for each subset as follows: (1) EXP1 and TIP41 for all samples; (2) UBC and EXP1 for NaCl stress; (3) PTBP1 and EXP1 for heat stress, polyethylene glycol (PEG) stress and ABA treatment; (4) UBC and CYP2 for cold stress; (5) PTBP1 and PP2A for sodium nitroprusside (SNP) treatment; (6) CYP1 and TIP41 for methyl jasmonate (MeJA) treatment; and (7) EXP1 and TIP41 for various tissues. The reliability of these results was further enhanced through comparison between part qRT-PCR result and RNA sequencing (RNA-seq) data. In summary, our results identified appropriate reference genes for qRT-PCR in L. aurea, and will facilitate gene expression studies under these conditions.Entities:
Keywords: Lycoris aurea; abiotic stress; gene quantification; quantitative real-time PCR (qRT-PCR); reference gene
Year: 2016 PMID: 27200013 PMCID: PMC4843812 DOI: 10.3389/fpls.2016.00536
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Genes and primer sets used for qRT-PCR.
| Glyceraldehyde-3-phosphate dehydrogenase | CL7040.Contig2_All | AAATTAAGGCTGCAATCAAG | 169 | 1.874 | 0.9992 | ||
| Actin | CL1144.Contig2_All | CAAATCATGTTCGAGACCTTCA | 173 | 1.873 | 0.9989 | ||
| Ubiquitin-conjugating enzyme | CL5627.Contig8_All | TGCCTTGACCATCTCCAAGGTT | 200 | 1.865 | 0.9995 | ||
| Elongation factor 1-α | CL3597.Contig3_All | AAGGATGGGCAGACCCGTGAGCA | 161 | 1.823 | 0.9991 | ||
| α-tubulin | CL544.Contig2_All | TGTGCATTGGTATGTTGGTGA | 139 | 1.872 | 0.9994 | ||
| β-tubulin | Unigene13345_All | TATCAACAGTATCAGGATGCGAC | 213 | 1.853 | 0.9995 | ||
| Serine/threonine-protein phosphatase PP2A | CL6570.Contig3_All | GTACCGAACATTAAATTCAAT | 176 | 1.863 | 0.9994 | ||
| Expressed protein 1 | CL7794.Contig1_All | ATTGAAACAACCTACACCGCAA | 133 | 1.872 | 0.9995 | ||
| Polypyrimidine tract-binding protein 1 | CL6418.Contig1_All | GCAATTTTTGAGAAGAATGGTG | 131 | 1.876 | 0.9996 | ||
| Expressed protein 2 | CL670.Contig8_All | AAACATCAAGAGTGCTGGC | 198 | 1.779 | 0.9996 | ||
| TIP41-like protein | Unigene3100_All | GCAACCATCCAAAGTTTAACTGCT | 157 | 1.847 | 0.9996 | ||
| Cyclophilin 1 | CL6321.Contig1_All | TCGTGAGGGCCATCGAGAAGGT | 137 | 1.819 | 0.9997 | ||
| Cyclophilin 2 | CL8032.Contig1_All | TCCCGATTCTTCTGGAAAGG | 181 | 1.880 | 0.9996 | ||
| mitosis protein | CL7523.Contig2_All | CGACTGGGACGAAACCTGCATGC | 138 | 1.775 | 0.9996 | ||
| secologanin synthase | CL4267.Contig5_All | TTCACTCTCCCTTCTCCTTTA | 150 | 1.820 | 0.9996 |
Unigenes were selected from the transcriptome of L. aurea and searched in sequences of Arabidopsis thaliana using Blastn in GenBank. The sequences of Unigenes can be found in Data Sheet .
Figure 1Distribution of Ct values of candidate reference genes across all of the samples. The Box-plot contains the mean, interquartile range, non-outlier range, and outlier.
Figure 2Pairwise variation (Vn/Vn+1) values in nine subsets calculated by using geNorm. The cut-off value to determine the optimal number of reference genes for qRT-PCR normalization is 0.15.
Expression stability ranking of the 14 candidate reference genes.
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
| geNorm | ||||||||||||||
| NormFinder | ||||||||||||||
| BestKeeper | ||||||||||||||
| Comprehensive Ranking | ||||||||||||||
Figure 3Aggregation of three rankings. The comprehensive ranking of candidate genes was calculated by the geometric mean of three types of rankings (geNorm, NormFinder, and BestKeeper) in each subset.
Figure 4Validation of qRT-PCR results through comparison with RNA-seq expression profiles. (A) Stability ranking of candidate genes by CV of FPKM in RNA-seq. The gene with lower CV indicates more stable expression. (B) Correlation analysis between ranking of MeJA treatment subset by qRT-PCR and the ranking of RNA-seq. CV, coefficient of variation; FPKM, fragments per kilobase of exon model per million mapped reads.
Figure 5Relative quantification of . The results are represented as mean fold changes in relative expression when compared to the first sampling stage (0 h). cDNA samples were taken from the same subset used for gene expression stability analysis. Roots were collected from L. aurea seedlings subjected to various treatments after 0, 1, 6, and 24 h. For tissue samples, different tissue types were collected from different development stage of L. aurea.