| Literature DB >> 27197749 |
Li-Jun Cao1,2, Ze-Min Li1, Ze-Hua Wang1, Liang Zhu1, Ya-Jun Gong1, Min Chen2, Shu-Jun Wei1.
Abstract
Recent improvements in next-generation sequencing technologies have enabled investigation of microsatellites on a genome-wide scale. Faced with a huge amount of candidates, the use of appropriate marker selection criteria is crucial. Here, we used the western flower thrips Frankliniella occidentalis for an empirical microsatellite survey and validation; 132,251 candidate microsatellites were identified, 92,102 of which were perfect. Dinucleotides were the most abundant category, while (AG)n was the most abundant motif. Sixty primer pairs were designed and validated in two natural populations, of which 30 loci were polymorphic, stable, and repeatable, but not all in Hardy-Weinberg equilibrium (HWE) and linkage equilibrium. Four marker panels were constructed to understand effect of marker selection on population genetic analyses: (i) only accept loci with single nucleotide insertions (SNI); (ii) only accept the most polymorphic loci (MP); (iii) only accept loci that did not deviate from HWE, did not show SNIs, and had unambiguous peaks (SS) and (iv) all developed markers (ALL). Although the MP panel resulted in microsatellites of highest genetic diversity followed by the SNI, the SS performed best in individual assignment. Our study proposes stringent criteria for selection of microsatellites from a large-scale number of genomic candidates for population genetic studies.Entities:
Mesh:
Substances:
Year: 2016 PMID: 27197749 PMCID: PMC4873785 DOI: 10.1038/srep26512
Source DB: PubMed Journal: Sci Rep ISSN: 2045-2322 Impact factor: 4.379
Figure 1Counts of different motif types with respect to the length of microsatellites.
Figure 2Scatter graph showing the relationship between microsatellite length and motif mismatch.
Thirty microsatellite loci developed for west flower thrips.
| wft3-S01# | KL023705 | (AAT)12 | TCAATGAGTAGTGGCAGTCGG | GTAGCTAGTGAGGCAGGCTG | 162–246 | 16 | 56 | 47 | HEX | MP |
| wft3-S03 | KL023701 | (AGC)12 | CCGACAGGAACACGTGGTCT | AATCGCAAACAGAATCCGACG | 135–188 | 8 | 56 | 45 | HEX | |
| wft3-S06 | KL023747 | (AGC)8 | TCCGATGACGCCAACTTACC | CACTCGTCCTCGGCTTCAG | 142–159 | 5 | 56 | 46 | HEX | |
| wft3-S08 | KL023707 | (ACG)8 | GAAGCTGCTGTGACTCCAGT | GACGCAGAGAACGACCCTG | 155–173 | 5 | 56 | 47 | HEX | SS |
| wft4-S09# | KL023695 | (AGGC)7 | GGCCGATGATTGTGCAAACA | CCGCATGCTAGCAATCCACT | 165–185 | 5 | 56 | 47 | HEX | SS |
| wft4-S13 | KL023711 | (AACC)16 | TGTGCGGTTTCATGCAAAGG | CGAGACAAACGGGTGGATGA | 157–184 | 4 | 56 | 47 | HEX | SS |
| wft3-S14 | KL023717 | (AAG)22 | TTCTCGCTCTTCAGGCGAAA | AGTATGGATTTGGCGGCGTT | 178–222 | 10 | 56 | 47 | HEX | SS |
| wft4-S16 | KL023774 | (ACAG)14 | CAAGCCACTCCCAGGAGATG | GACAGACGACATGACCTCGG | 190–223 | 8 | 56 | 43 | HEX | |
| wft4-S17 | KL023720 | (ACAG)20 | GACCGTCAACGTGGACCC | CCGACTGGACTGCTACTGAC | 99–249 | 10 | 56 | 46 | HEX | |
| wft3-S20 | KL023696 | (AGC)17 | AGCGCATTGTCCAGGCTAAT | GCAGCGTGTTTGCAGTATGT | 204–271 | 6 | 56 | 46 | HEX | |
| wft3-S21# | KL023772 | (AAT)15 | GGTGACGTTGAACAAACCGA | GAGGAGCCAACCCAATGTGA | 243–284 | 11 | 56 | 45 | FAM | MP |
| wft4-S22# | KL023713 | (AGAT)9 | CGTTACCGATGTGCCACGTA | ACCTAGTGGATCCCTCGAAAGA | 240 | 13 | 56 | 46 | FAM | SNI |
| wft4-S26# | KL023743 | (ACAG)17 | TTAACGGCGGTCATGCTTCT | AATGCGGCGCTTCGTTAGAA | 220–321 | 11 | 56 | 44 | FAM | MP |
| wft3-S27# | KL023766 | (ACC)13 | GGAAGACCAATCATCGCGGA | ATTCGTGCTGCAGTTGGAGT | 224–263 | 10 | 56 | 44 | FAM | SNI |
| wft3-S28 | KL023710 | (ACT)10 | TCCACTTGGCGTCAAAGTGT | CAGGCCTGTTTCTGGTCGG | 236–253 | 10 | 56 | 47 | FAM | SNI |
| wft4-S29 | KL023712 | (ACGC)11 | CATCACGACAACAATGCCGG | AGCGTCATTATACCGGTGCC | 233–272 | 9 | 56 | 41 | FAM | |
| wft4-S30# | KL023745 | (ACGG)11 | TGTAGTAGGCGGGAAATGATGA | GAGTGTCGCAGCAGAACTCT | 217–336 | 11 | 56 | 47 | FAM | SNI |
| wft4-S31## | KL023716 | (ACTC)13 | ATCACTTCGCTAGCACGCTC | AGTTACGTCGTTCCGTGTCC | 209–261 | 11 | 56 | 41 | FAM | MP |
| wft4-S32# | KL023729 | (ACAG)16 | GTCTCGGTATGCGTACAGGC | ATTTCGATACCAGGCCGTGT | 212–359 | 17 | 56 | 45 | FAM | MP |
| wft3-S33 | KL023736 | (AGC)10 | TCGGAATAACGCTGAGTGCC | TAGGTGCTCTGCAGATGGAC | 238–255 | 10 | 56 | 47 | FAM | SNI |
| wft4-S34 | KL023718 | (AGAT)13 | GCTGCACGCTAAGTTCACAC | GTTGCAGCTCTTCTCACCTG | 234–273 | 9 | 56 | 46 | ROX | |
| wft4-S36 | KL023722 | (AAAG)10 | CCGGCAGCACGTTTATCAAA | TTGCGGTTGATTCGTTGCAT | 275–293 | 6 | 56 | 46 | ROX | |
| wft3-S43 | KL023742 | (AGC)20 | GAGCACGCCACGATGATGAA | GACGGATGGAAGGACGCAAT | 258–299 | 11 | 56 | 47 | ROX | MP, SS |
| wft4-S45 | KL023755 | (ACAG)8 | ACCCAAATACGGCAACCAAC | ATCGGTGCACAATCAGACGG | 296–320 | 6 | 56 | 47 | ROX | SS |
| wft4-S50 | KL023714 | (ATCC)13 | CCTTGCACGCTCTGATAGGT | TCCCGTAGTTGGCCAAATGA | 303–351 | 7 | 56 | 47 | ROX | SS |
| wft4-S52 | KL023739 | (AAAC)11 | AGGGCGTTGATGTTGAGGAA | CGGCGTGATCTAGAGGGTCT | 312–366 | 10 | 56 | 39 | ROX | SNI |
| wft3-S53# | KL023752 | (AAC)17 | ACTCCGTACACAAGATGGAGT | AGTGCGGATCTCAGGCTAAC | 299–357 | 11 | 56 | 47 | ROX | SNI |
| wft4-S57## | KL023777 | (AGAT)23 | GACGGAGAGGGATTCGTCAC | GCTGCTCATGCGACAAATGA | 338–416 | 13 | 56 | 43 | ROX | MP |
| wft4-S58 | KL023694 | (AGAT)15 | AAGCCGAATGGGAGACACTT | ACACGTGAACAGCGTATAGGT | 338–394 | 12 | 56 | 47 | ROX | MP, SS |
| wft3-S60 | KL023732 | (AGC)8 | AGCTCTTGCGGTGATGATCC | AATTGATCGCAGCTGTCAGC | 358–383 | 8 | 56 | 47 | ROX | SNI |
Tm, annealing temperature; NA, number of alleles; N, number of individuals successfully genotyped from the 48 insects; #locus that deviates from Hardy–Weinberg equilibrium significantly in one population; ##locus that deviates from Hardy–Weinberg equilibrium significantly in two population (after sequential Bonferroni correction for multiple tests, P < 0.05); Panel, marker panels; FL, fluorescent label.
Figure 3Population genetics parameters inferred for MT and YQ populations using four panels.
Figure 4Results of STRUCTURE analyses for MT and YQ populations using four marker panels.