Literature DB >> 27195796

Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence.

Allison E James1, Artem S Rogovskyy2, Michael A Crowley2, Troy Bankhead1,2.   

Abstract

DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27195796      PMCID: PMC4873019          DOI: 10.1371/journal.pone.0155798

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Relapsing fever is an arthropod-borne disease caused by several species of spirochetal bacteria in the genus Borrelia. While tick-borne relapsing fever is found in many endemic foci worldwide, the burden of disease is most substantial in Africa where it ranks among the top ten causes for hospitalization in Ethiopia, and among the top ten causes of mortality in children under five in Tanzania [1, 2]. Several species of relapsing fever are found in North America and cause sporadic illness, including the well-characterized species Borrelia hermsii [3]. The pathogenesis of relapsing fever Borrelia spp. is distinct from that of the closely related agent of Lyme disease, Borrelia burgdorferi [4, 5]. Relapsing fever Borrelia spp. cause acute recurrent febrile events that correspond to episodic high levels of bacteremia, whereas B. burgdorferi rapidly migrate out of the bloodstream and into host tissues that results in various clinical syndromes including arthritis, neuropathy, and carditis [6, 7]. B. burgdorferi and relapsing fever Borrelia spp. share many orthologous genes and exhibit significant synteny on their chromosomes [8, 9]. Additionally, many genes are unique to either Lyme disease-type or relapsing fever-type agents. The bh0463A gene of B. hermsii codes for a putative DNA adenine methyltransferase (Dam), and is one example of a gene found only in relapsing fever-type spirochetes [9]. DNA methylation is a crucial component of cellular defense, protecting host cells from foreign invasion of DNA and restriction modification complexes. Methylation also serves a role in the coordination and regulation of numerous cellular events, including the timing of DNA replication, partitioning of newly synthesized DNA, and DNA repair processes [10, 11]. In bacteria, methylation of the N6 position of adenine is critical for epigenetic gene regulation. Dams mediate the methylation of adenine in the 5’-GATC-3’ sequence shortly after DNA replication. GATC sites on the newly synthesized strand are briefly unmethylated, allowing DNA-binding proteins with affinity for the resultant hemi-methylated DNA to prevent further modification at the GATC site [10]. Other DNA-binding proteins have an affinity for fully methylated DNA, or for non-methylated DNA [11]. The differential DNA binding affinities of various proteins results in transcriptional regulation of many genes. In multiple pathogens, epigenetic regulation by way of methylation is critical for colonization in various host microenvironments, and for survival in the presence of the host’s immune response. The role of Dam in virulence is increasingly being elucidated in other pathogens [10, 12]. In Salmonella enterica, dam strains have exhibited dysregulation of in vivo-expressed genes, reduced ability to adhere to and invade intestinal epithelium, reduced secretion of effector proteins via a type III secretion system, and membrane instability [13-16]. As a result, Salmonella enterica dam are avirulent in vivo [14, 15]. Likewise, certain dam strains of Haemophilus influenzae demonstrated a reduced ability to adhere to endothelial cells, a reduced capability for cellular invasion, and defective intracellular replication [17]. In vivo attenuation was also observed during murine infection with dam strains of Yersinia pestis and Yersinia pseudotuberculosis [18, 19]. In cases where Dam is essential for viability, Dam over-producing (DamOP) mutants have been generated to evaluate the effects of methylation on virulence. DamOP strains of Vibrio cholerae, certain strains of Yersinia pseudotuberculosis, and Pasteurella multocida have also demonstrated in vivo attenuation [20, 21]. A few decades ago, researchers noted the presence of an adenine-specific methylation system in relapsing fever Borrelia spp., but not in most strains of B. burgdorferi, after digestion of genomic DNA with adenine methylation-sensitive restriction enzymes [22, 23]. While a putative adenine-specific methyltransferase was annotated in the published B. hermsii chromosome, no studies have verified the function of this predicted gene. Moreover, a role for Dam in the pathogenesis of Borrelia spp. has not been evaluated to date. The well-documented role for Dam in the virulence of other pathogens, and the fact that Dam was identified in relapsing fever Borrelia spp. but not in B. burgdorferi, led us to hypothesize that Dam is dispensable for B. hermsii viability and has a role in spirochetal pathogenicity during mammalian infection. In this report, the putative B. hermsii Dam locus (bh0463A) was cloned into a dam Escherichia coli strain. Digestion with methyl-group sensitive restriction enzymes verified the Dam function of bh0463A. A dam mutant clone of B. hermsii was then successfully generated, demonstrating that bh0463A is dispensable for B. hermsii viability. The dam mutant clone was capable of not only infecting immunodeficient mice, but could also successfully establish persistent infection in immunocompetent mice.

Materials and Methods

Ethics statement

The experimental procedures involving strains of inbred mice were carried out in accordance with the American Association for Accreditation of Laboratory Animal Care (AAALAC) protocol and the institutional guidelines set by the Office of Campus Veterinarian at Washington State University (Animal Welfare Assurance A3485-01 and USDA registration number 91-R-002). Washington State University AAALAC and institutional guidelines are in compliance with the U.S. Public Health Service Policy on Humane Care and Use of Laboratory Animals. Inbred mice were maintained at Washington State University (Pullman, WA, USA) in an AAALAC-accredited animal facility. The Washington State University Institutional Animal Care and Use Committee reviewed and approved the animal protocols associated with the current studies. Mice were monitored every 24 hours by lab animal care technicians, as well as every 24 hours post infection when investigators were performing phlebotomy. Animal health was assessed by observing the general appearance of mice as well as their activity prior, during, and after handling. Mice that displayed reduced activity after moving the cage, reduced withdrawal of the hindlimb during bleeding, or had a rough haircoat were considered clinically affected. No animals became severely ill (critically depressed or moribund) or died before or during the experimental endpoint. All animals were euthanized with carbon dioxide, followed by the secondary method of cervical dislocation.

Bacterial strain and culture conditions

The isolation and characterization of B. hermsii DAH has been described [24, 25], and was acquired as a gift from George Chaconas, who obtained it from Tom Schwan. All wild type and mutant clones of B. hermsii were cultivated at 35°C under 1.5% CO2 in modified Barbour-Stoenner-Kelly medium (BSK-II) supplemented with 12% rabbit serum (Accurate Chemical and Scientific Corp., Westbury, NY) [26]. Selection of transformants and growth of the bh0463A mutant clone was achieved with the addition of gentamicin (40 μg/mL). For in vitro growth assays, B. hermsii was grown to late log phase and subcultured in triplicate to a cell density of 5 X 105 spirochetes per mL. Spirochetes were enumerated at 24 hour-intervals and expressed as mean densities with standard deviation. Cell densities and growth phase were monitored by visualization under dark-field microscopy using a Petroff-Hausser counting chamber.

Verification of DNA adenine methyltransferase function

The plasmid pAE35, and a control plasmid pAE30, were generated to test the Dam activity of bh0463A following transformation into a commercially available dam-/dcm- Escherichia coli strain (New England Biolabs, Ipswich, MA). To generate pAE30, the 135 bp Borrelia hermsii DAH flgB promoter (flgBp) was amplified as previously reported [27] with primers P233 and P255 that possessed NdeI and HindIII sites, respectively (Table 1). The amplification product was then cloned upstream of an aphI gene conferring kanamycin resistance (kanR) on the pBSV2 [28] shuttle vector using the same restriction enzymes (New England Biolabs, Ipswich, MA). The resultant flgBp/kanR locus on pBSV2 was then amplified with P246 and P287, and cloned into the commercially available pJet1.2/blunt vector (Thermo-Fisher Scientific, Waltham, MA). The final control plasmid pAE30 was verified by DNA sequencing.
Table 1

Oligonucleotides used in this study.

PrimerSequence (5’ to 3’)a
P218CATTTCCTAGCTAGCTTAGGTGGCGGTACTTGGGTC
P233ATTCATATGAACACCCTCTATATCACAAATT
P246GCTAGCGCTCTGCCAGTGTTACAACC
P255GTTAAGCTTGTTAAAGAAAATTGAAATAAACTTG
P287GACGCCGGCATTACGAATTCGAGCTCGGT
P308TAGGCCGGCACTAGTGCAAGAGCTATAGCATTAAGAGAATGGCTAAAG
P309TAGGCCGGCTCCCCAGTGCTTCTTTTCCTTCCAACATC
P408CCGGGGATCCTCTAGAGTCG
P426TAGGGCGCGCCGTGGTTCTACAGAACCAAAAGTAGCTGCT
P427TAGCTCGAGGGTCTCTTTAGCAGTCTCTGCCC
P428TAGGGATCCAAAGGAGTATTAAATCTCCCATCTC
P429TAGGCTAGCTGGTAAATATAAAAAGATTAGTCTTTATGA
P780CATGCGAGCCTTCTAAACTACTAAATTTAC
P825GAAGCAGATGTTTATAAAGTCAATAACTTATATC
P846TAGGGTACCTTAGAAAAACTCATCGAGCATC
P847TAGGGTACCGAGGGAGGTTTCCAT ATGAGCGTTGCAATACG
P848TAGGACGTCCATCTTTACGCCTATCCAC

a Restriction sites are underlined and shown in bold.

a Restriction sites are underlined and shown in bold. To generate the dam complementation plasmid, pAE35, the putative dam locus bh0463A was amplified with P847 and P848 producing an 892 bp product. No native promoter or ribosomal binding site (RBS) could be identified in the immediate upstream region of bh0463A. As such, P847 included a 5’ RBS and a KpnI restriction enzyme linker. The flgBp/kanR amplicon was generated using P255 and P846, the latter possessing a KpnI site. Both PCR products were cleaned using a PCR cleanup kit (Qiagen, Valencia, CA) and digested with KpnI (New England Biolabs). Following ligation of the two amplicons, a single kanR-bh0463A construct driven by the B. hermsii flgB promoter was ligated to pJet1.2/blunt in a separate reaction. The final pAE35 construct was verified by DNA sequencing. Both plasmids were transformed into a commercially available dam-/dcm- E. coli strain (New England Biolabs). Following plasmid extraction (Mini Kit, Qiagen), 300 ng of either plasmid (pAE30 or pAE35) were digested with DpnI, MboI, or Sau3AI (New England Biolabs). The resulting DNA fragments were resolved with electrophoresis on a 1.8% agarose gel.

Vector construction

The plasmid vector, pMTKO, was constructed for the stable integration of an aacC1 gene conferring resistance to gentamicin (gent) into the DNA adenine methyltransferase gene at chromosomal locus bh0463A (GenBank Accession Number NC_010673.1). A 2,085 base pair PCR amplicon of the bh0463A locus was produced with primers P426 and P427 (Table 1), and cloned into the pJET1.2/blunt vector backbone (Thermo-Fisher Scientific) to generate the plasmid pJET1.2/MT. Inverse PCR of pJET1.2/MT was performed using P428 and P429, which possess BamHI and NheI 5’ restriction sites, respectively. Amplification of the B. hermsii DAH flgB promoter (flgBp) was performed as described above, and cloned upstream of gent on pBSV2G [29]. The 695 base pair flgBp-gent construct was then amplified from pBSV2G using P408 and P218, which was cloned into the inverse PCR amplicon at the BamHI and NheI restriction sites. Sequencing to verify the appropriate insert was performed using the standard pJET1.2/blunt primers. The final construct, pMTKO, was propagated in E. coli DH5α cells, and purified using a plasmid midikit (Qiagen).

Transformation and mutant characterization

Preparation of electrocompetent B. hermsii DAH cells and transformation were carried out as described previously for B. burgdorferi [30, 31]. After electroporation, cells were immediately placed in 5 mL pre-warmed BSK-II supplemented with 12% rabbit serum, and incubated for 24 hours at 35°C with 1.5% CO2. Culture volume was then increased to 50 mL with fresh medium and the transformant pool was allowed to expand in a polyclonal pool in BSK-II medium under selection with gentamicin (40 μg/mL) until the cell density reached approximately 1x108 spirochetes per mL. Clonal populations were obtained via 10-fold serial dilution until the cell density was approximately 1 spirochete per mL. Two hundred μL of the resulting diluted sample was plated in each well of a 96-well plate. Plates were incubated as described above. Wells containing potential transformant clones were identified by media color change. Transformant clones were PCR screened for the presence of gent, and PCR-positive clones were inoculated into 100 mL of fresh BSK-II under gentamicin selection in preparation for DNA extraction (Midi Kit, Qiagen). DNA from clones of BhΔdam were subjected to PCR using P825 and P780 primers, producing a 2,641 base pair amplicon that spans both upstream and downstream of the disrupted bh0463A locus. The resultant product was purified with a PCR cleanup kit (Qiagen), and the insertion site was verified via sequencing. The absence of Dam activity in the bh0463A mutant was verified by digesting 500 nanograms of genomic DNA extracted from wild type and mutant B. hermsii with either DpnI, MboI, or Sau3AI. Resultant fragments were resolved with electrophoresis on a 0.7% SeaKem LE Agarose gel (Lonza, Basel, Switzerland).

Murine infection

Male, C.B-17/IcrHsd-Prkdc (SCID) or C57/BL6NHsd (B6) mice of 4–6 weeks of age were purchased from Harlan (Indianapolis, IN). Both murine strains have been previously used for infection experiments involving B. hermsii [32-34]. The animals were inoculated with a B. hermsii clone via subcutaneous injection within the interscapular region at 1x106 total spirochetes per mouse, except for the infectious dose experiments when each mouse was inoculated with approximately 1x105, 1x104, 1x103, 1x102, or 10 spirochetes. B. hermsii clones were passaged no more than two times in vitro from frozen glycerol stocks prior to murine inoculation, and both the mutant and wild-type inocula were composed of clonal populations of serotype VlpA7. In order to confirm infection, blood was drawn from a mouse via maxillary or saphenous bleed each day over the course of 3 or 10 days. Blood (10 μl) was cultured in 1 ml of BSK-II containing Borrelia antibiotic cocktail (0.02 mg ml-1 phosphomycin, 0.05 mg ml-1 rifampicin and 2.5 mg ml-1 amphotericin B). Blood cultures were incubated at 35°C under 1.5% CO2 for 3–4 weeks. The blood cultures were periodically examined via dark-field microscopy for the presence of Borrelia cells. A mouse whose blood sample(s) showed viable spirochetes via blood culture was considered infected.

Verification of the stable disruption of dam and antigenic variation

The stable integration of gentR into bh0463A was verified by PCR amplification and restriction enzyme digest of mutant spirochetes recovered from mice. One mL blood cultures from mice at day 10 post inoculation were verified positive by microscopy, and DNA was extracted with the Wizard Genomic DNA Kit (Promega, Madison, WI) using the manufacturer’s instructions for Gram negative bacteria. Recovered genomic DNA was then subjected to restriction enzyme digestion with DpnI and MboI, and resultant fragments were electrophoretically resolved on a 1.8% agarose gel. The same DNA extracted from day 10 post inoculation blood cultures was used as template in a PCR reaction with primers P308 and P309 to amplify the variable major protein expression site. The resultant amplicon was resolved on a 1% agarose gel, and DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen). Extracted DNA was sequenced; results were compared with the infecting serotype and analyzed on BLAST (http://blast.ncbi.nlm.nih.gov) to verify antigenic switching.

Quantification of spirochetemia

Quantitative PCR (qPCR) of B. hermsii from mouse blood was demonstrated in a previous study to correlate with microscopic counting of spirochetes on a Petroff-Hausser counting chamber [35]. The qPCR protocol described herein was adapted from [35] and [36]. Total DNA was extracted from 40 μL of mouse blood on days 3, 7, and 10 post inoculation using the QIAamp DNA Micro Kit (Qiagen) following the handbook protocol for small volumes of blood. DNA was eluted in 20 μL of distilled water, followed by dilution 1:10 with water. Five μL of the diluted samples, 10 μL of 2X SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA), and 0.4 μL each of primers P677 and P678 (5’-TAACACACCAGCATCACTAGCT, 5’-CCTTCCTCTTGCTGTCCTATCT, respectively; concentration 18.75 μM) were added to the 20 μL qPCR reaction volume. The 177 base pair product of P677 and P678 originates in the B. hermsii DAH flaB gene. Cycling parameters were one cycle at 98° for 2 minutes, followed by forty cycles at 98° for 5 seconds and 62° for 25 seconds. Reactions were run on the CFX96 Touch Real-Time PCR System (Bio-Rad). A standard curve was generated using the flaB PCR amplicon cloned into the vector pCR4-TOPO (Invitrogen, Carlsbad, CA), diluted from 106 to 10 copies per 5 μL. The mean copy number was obtained from triplicate measurements of both standards and samples, and multiplied by a factor of 1000 to quantify spirochetes per mL of blood. The multiplication factor was obtained because DNA in 5 μL undiluted sample = DNA in 10 μL blood; 10 μL blood x 100 = spirochetes in 1 mL x 10 (sample dilution factor) = 10 X 100 = 1000.

Statistical analysis

The SigmaPlot program (version 11, Systat Software, San Jose, CA) was used for all statistical analyses, except for linear regression analysis of growth curves where Microsoft Excel (version 2013) was used. Student’s t-test was used to compare the slopes of the linear regression lines (growth curves) and when comparing the means of two groups (qPCR data). Fisher’s Exact Test was used in cases where data could be applied to contingency tables (murine infection data). P-values of <0.05 were considered statistically significant.

Results

Verification that bh0463A encodes a putative DNA adenine methyltransferase

The presence of a DNA adenine-specific methylation system in relapsing fever Borrelia spp. was discovered several decades ago by digesting genomic DNA with adenine methylation-sensitive restriction enzymes DpnI and MboI [22, 23]. A later publication by Lescot et al. identified a putative adenine-specific methyltransferase in the chromosome of Borrelia duttonii and B. recurrentis [9]. For the present study, a BLAST analysis of the putative B. duttonii adenine-specific methyltransferase (bdu_467; GenBank Accession Number NC_011229.1) identified a highly similar gene annotated as a ‘DNA methyltransferase’ in the chromosome of B. hermsii at locus bh0463A (Accession Number NC_010673.1). The same BLAST analysis also identified highly similar genes in several other species of relapsing fever (B. turicatae, B. parkeri, B. coriaceae, B. hispanica, B. miyamotoi, B. crocidurae, and B. persica), indicating that the putative adenine-specific methyltransferase is conserved among relapsing fever Borrelia species. Further characterization of this locus on the Restriction Enzyme Database website (http://rebase.neb.com, New England Biolabs) concurred with the BLAST analysis, and identified the predicted recognition sequence of the putative methyltransferase as GATC. To verify the function of bh0463A as a DNA adenine methyltransferase, the predicted dam gene was PCR amplified and cloned downstream of a B. hermsii flgB promoter-driven kanamycin resistance cassette (kanR) in a pJet plasmid. This construct, pAE35, was then transformed into a dam- E. coli strain. Likewise, a similar plasmid possessing only kanR, pAE30, was transformed as a control. Plasmid DNA extracted from the dam- E. coli transformed clones was subjected to digestion with either DpnI, MboI, or Sau3AI; DpnI cuts GATC sites in which the adenine residue is methylated, MboI cuts unmethylated GATC sites, and Sau3AI cleaves all GATC sites regardless of adenine methylation, but will not cut when cytosine is methylated. The results demonstrated that, unlike the control plasmid, expression of bh0463A in the dam- E. coli cells produced a restriction fragment profile indicative of adenine methylation at GATC sites (i.e. permissive digestion by DpnI and Sau3AI only; Fig 1). These results provide strong evidence for the function of bh0463A as a DNA adenine methyltransferase. Hereafter, the bh0463A locus will be referred to as dam.
Fig 1

Complementation of bh0463A in a dam- Escherichia coli strain results in adenine methylation of plasmid DNA.

Control plasmid pAE30 (lanes 1, 3, 5, and 7) and a bh0463A complementation plasmid (pAE35; lanes 2, 4, 6, and 8) were extracted from a dam- E. coli strain and subjected to digestion with DpnI (lanes 3 and 4), MboI (lanes 5 and 6), or Sau3AI (lanes 7 and 8). DpnI, MboI, and Sau3A1 cut GATC sequences that are adenine methylated, adenine non-methylated, or cytosine non-methylated, respectively. Sizes of selected molecular weight standards (mws) of 100 bp DNA ladder (New England Biolabs) are shown on the left in base pairs.

Complementation of bh0463A in a dam- Escherichia coli strain results in adenine methylation of plasmid DNA.

Control plasmid pAE30 (lanes 1, 3, 5, and 7) and a bh0463A complementation plasmid (pAE35; lanes 2, 4, 6, and 8) were extracted from a dam- E. coli strain and subjected to digestion with DpnI (lanes 3 and 4), MboI (lanes 5 and 6), or Sau3AI (lanes 7 and 8). DpnI, MboI, and Sau3A1 cut GATC sequences that are adenine methylated, adenine non-methylated, or cytosine non-methylated, respectively. Sizes of selected molecular weight standards (mws) of 100 bp DNA ladder (New England Biolabs) are shown on the left in base pairs.

Generation and in vitro characterization of a dam mutant of B. hermsii

In order to determine whether Dam is dispensable for viability in B. hermsii, a mutant clone with a disrupted dam gene (BhΔdam) was generated. To achieve this, a plasmid (pMTKO) was constructed that contained a B. hermsii flgB promoter-driven aacC1 gene conferring resistance to gentamicin (gent) inserted within a copy of bh0463A at nucleotide position 410 (Fig 2). Electrocompetent B. hermsii cells were transformed with the pMTKO construct, and resultant transformants were isolated under gentamicin selection and PCR screened for the presence of gent. Final verification of the mutant clone was achieved through PCR amplification and sequencing of the gent insertion site.
Fig 2

Schematic of the DNA adenine methyltransferase locus (bh0463A) in B. hermsii wild type (WT) and BhΔdam.

The locations of primers used to generate pMTKO and verify BhΔdam are depicted as arrowheads (see Materials and Methods). nt, nucleotide; up, upstream sequence; dn, downstream sequence.

Schematic of the DNA adenine methyltransferase locus (bh0463A) in B. hermsii wild type (WT) and BhΔdam.

The locations of primers used to generate pMTKO and verify BhΔdam are depicted as arrowheads (see Materials and Methods). nt, nucleotide; up, upstream sequence; dn, downstream sequence. To verify the disruption of Dam function in BhΔdam, genomic DNA from both mutant and wild type strains was subjected to restriction digest by DpnI, MboI, or Sau3AI as described above. The results demonstrated that BhΔdam DNA was resistant to digestion with DpnI, an enzyme requiring methylation of adenine residues for GATC cleavage, whereas wild type DNA was highly fragmented following digestion with DpnI (Fig 3). Conversely, BhΔdam genomic DNA is fragmented after digestion with MboI, which is blocked by adenine methylation, while wild type DNA is resistant to digestion with this enzyme. DNA isolated from both wild type B. hermsii and BhΔdam was equally susceptible to fragmentation by Sau3AI, indicating that the absence of dam in B. hermsii does not affect cytosine methylation at GATC sites. Together, the data indicate that adenine methylation is disrupted in BhΔdam, and provides further confirmation that bh0463A codes for an adenine-specific DNA methyltransferase.
Fig 3

Disruption of putative methyltransferase bh0463A results in unmethylated genomic DNA.

Lanes 1, 3, 5, and 7 contain wild type B. hermsii DNA; Lanes 2, 4, 6, and 8 contain DNA from BhΔdam. DNA is either undigested (lanes 1 and 2), digested with DpnI (lanes 3 and 4), MboI (lanes 5 and 6), or Sau3AI (lanes 7 and 8). DpnI, MboI, and Sau3A1 cut GATC sequences that are adenine methylated, adenine non-methylated, or cytosine non-methylated GATC sites, respectively. Sizes of selected molecular weight standards (mws) of λ DNA Mono cut mix (New England Biolabs) are shown on the left in base pairs.

Disruption of putative methyltransferase bh0463A results in unmethylated genomic DNA.

Lanes 1, 3, 5, and 7 contain wild type B. hermsii DNA; Lanes 2, 4, 6, and 8 contain DNA from BhΔdam. DNA is either undigested (lanes 1 and 2), digested with DpnI (lanes 3 and 4), MboI (lanes 5 and 6), or Sau3AI (lanes 7 and 8). DpnI, MboI, and Sau3A1 cut GATC sequences that are adenine methylated, adenine non-methylated, or cytosine non-methylated GATC sites, respectively. Sizes of selected molecular weight standards (mws) of λ DNA Mono cut mix (New England Biolabs) are shown on the left in base pairs. To determine whether the disruption of dam results in altered growth during in vitro cultivation, growth curves were generated for in vitro-grown BhΔdam and wild type B. hermsii (Fig 4). During the 72 hours of exponential phase growth (day 1–4 post inoculation), the BhΔdam doubling time was 9.8 hours while the doubling time for wild type B. hermsii was 10.5 hours. Linear regression analysis of the slopes during these three days revealed no significant differences between the growth of the mutant and wild type strains (p = 0.6). Maximum cell densities of both clones occurred at 5 days post inoculation (wild type = mean 1.4 x 108, 95% confidence interval = 8.8 x 107–1.9 x 108; BhΔdam = 1.4 x 108, 95% CI = 8.3 x 107–1.9 x 108) and were not significantly different (p = 0.9). Comparison of overall in vitro growth patterns between BhΔdam and the wild type control revealed minimal differences, demonstrating that the disruption of dam does not result in in vitro growth defects.
Fig 4

In vitro growth curves of wild type B. hermsii and BhΔdam.

Wild type B. hermsii is shown with black circles; BhΔdam is shown with white triangles. No significant differences in growth rate or maximum cell density were detected between BhΔdam and wild type B. hermsii. The mean and standard deviation of triplicate measurements at each time point are plotted.

In vitro growth curves of wild type B. hermsii and BhΔdam.

Wild type B. hermsii is shown with black circles; BhΔdam is shown with white triangles. No significant differences in growth rate or maximum cell density were detected between BhΔdam and wild type B. hermsii. The mean and standard deviation of triplicate measurements at each time point are plotted.

BhΔdam is capable of persistent infection in mice

Previous studies involving dam mutants in other bacterial species have demonstrated a role for Dam in virulence and pathogenesis [10, 12, 37]. Thus, the ability of the BhΔdam mutant clone to establish persistent infection in a mammalian host was investigated. In doing so, two groups of 8 immunocompetent B6 (C57/BL6NHsd) mice each were needle inoculated with either BhΔdam or wild type B. hermsii at 1 x 106 total spirochetes per animal. Blood was collected from each mouse every day for ten days post infection and evaluated for the presence of spirochetemia by blood culture. Thirteen immunodeficient SCID mice were also inoculated alongside immunocompetent mice with either BhΔdam (8 animals) or wild type B. hermsii (5 animals) to serve as an infection control. SCID mice lack antibody production, including the borreliacidal immunoglobulin M (IgM) antibodies that are rapidly produced after host infection and known to be critical for control of B. hermsii infection [38-41]. The wild type clone was able to establish infection in all 8 immunocompetent animals and were continuously detectable in most mice (7/8) throughout the ten-day period (Table 2). Similarly, BhΔdam was also detected in all mice by day 1 post inoculation, and could be recovered each day throughout the study period. Statistically-significant differences in the number of blood-culture positive mice between the two groups were observed only on day 8, where fewer mice produced detectable wild type spirochetemia. The finding that spirochetes were recovered in most mice on days 9 and 10, however, indicate that wild type spirochetes remained persistent throughout the study period, and that the few positive mice found on day 8 were likely a detection artifact due to low levels of spirochetemia at that particular timepoint. Similarly, for SCID mice, the results showed that 8/8 mice inoculated with the BhΔdam mutant clone and 5/5 mice inoculated with wild type were culture-positive for spirochetes throughout the 10 day period (Table 2), except one wild type-infected mouse that did not produce a positive culture until day 2 post inoculation.
Table 2

Infection by B. hermsii wild type and BhΔdam in B6 and SCID mice as determined by blood culture.

Day post infectionB6 mice infected with:SCID mice infected with:
WTBhΔdamWTBhΔdam
18/88/84/5a8/8
28/88/85/58/8
38/88/85/58/8
48/88/85/58/8
58/88/85/58/8
68/88/85/58/8
77/88/85/58/8
83/88/8 b5/58/8
96/88/85/58/8
107/88/85/58/8

a Values listed correspond to number of positive cultures/number tested.

b Statistically-significant difference between mutant and control groups as determined by Fisher’s Exact Test (p<0.05).

a Values listed correspond to number of positive cultures/number tested. b Statistically-significant difference between mutant and control groups as determined by Fisher’s Exact Test (p<0.05). To ensure the stable disruption of dam, DNA was extracted from spirochetes recovered on day 10 post infection from immunocompetent mice and subjected to restriction enzyme analysis with DpnI and MboI (S1 Fig). Spirochetal DNA at this time point was found to lack methylation, indicating that dam function was destroyed throughout the study period. Finally, PCR amplification and sequencing of the variable major protein expression site of spirochetes recovered from 3 mice in each group at day 10 post infection revealed that the locus had undergone antigenic variation (S1 File). Previous studies have shown that antigenic switching in wild type B. hermsii occurs via a gene conversion event at this single, transcriptionally active locus [42-44]. Antigenic variation has also been demonstrated to be required for persistence of this pathogen in immunocompetent mammalian hosts [36]. Specifically, all 3 mice in the BhΔdam group were determined to have switched from the infecting serotype of VlpA7 to VlpA25. Overall, the data demonstrate that the disruption of Dam function by integration of gentR into dam is stable, and that Dam is dispensable for infection and persistence in immunocompetent murine host. Despite the ability of BhΔdam to infect and persist in the murine host, it remained unclear whether disruption of dam results in an attenuation of B. hermsii in vivo. To ascertain the role of dam in spirochetal fitness during murine infection, qPCR quantification of spirochetemia was employed. For this assay, two groups of 5 B6 mice were infected with 1 x 106 wild type B. hermsii or BhΔdam. Blood samples were collected on days 3, 7, and 10 post inoculation, and total DNA was extracted to be used as a template for qPCR. These time points were selected because in our hands, wild type B. hermsii typically achieves peaks of spirochetemia at days 3 and 7 post inoculation, and day 10 concludes the experiment. In B6 mice, mean spirochete density of BhΔdam at all three timepoints was not significantly different from wild type B. hermsii (Fig 5A and 5B, data in S1 Table). To determine whether the spirochete density of the BhΔdam mutant achieved similar levels as the wild type strain in the less stringent host environment of an immunodeficient mouse, blood from 5 SCID mice inoculated with wild type or mutant strains was also used as a template for qPCR on days 3, 7, and 10. Both strains produced high density spirochetemia in SCID mice, but the spirochete burden in mice infected with BhΔdam at all 3 time points was found to be significantly lower than those infected with wild type B. hermsii (p<0.01; Fig 5C and 5D, data inS1 Table). While qPCR results demonstrate statistically significant differences in SCID mice, the biological relevance of these results is unknown and warrants further investigation. Nevertheless, the qPCR results from both immunocompetent and immunodeficient mice demonstrate that dam does not impart B. hermsii with a substantial in vivo fitness advantage, because the spirochete density of BhΔdam in the blood remains grossly elevated at all three time points in both strains of mice. This, combined with the detection of spirochetes in most mice throughout the 10 day experiment, indicates that dam is dispensable for murine infection and persistence.
Fig 5

BhΔdam persists in the blood of B6 and SCID mice.

Spirochetemia as determined by qPCR for A) wild type (WT) B. hermsii in B6 mice; B) BhΔdam in B6 mice; C) WT B. hermsii in SCID mice; and D) BhΔdam in SCID mice. Differences in spirochetemic density between strains at days 3, 7, and 10 post infection in B6 mice were not statistically significant (p>0.05). Conversely, in SCID mice, spirochetemia of BhΔdam at all timepoints was significantly lower than WT B. hermsii (p<0.01, denoted by an asterisk). Spirochetemia from each mouse is represented by a different shape; mean density is depicted by a line.

BhΔdam persists in the blood of B6 and SCID mice.

Spirochetemia as determined by qPCR for A) wild type (WT) B. hermsii in B6 mice; B) BhΔdam in B6 mice; C) WT B. hermsii in SCID mice; and D) BhΔdam in SCID mice. Differences in spirochetemic density between strains at days 3, 7, and 10 post infection in B6 mice were not statistically significant (p>0.05). Conversely, in SCID mice, spirochetemia of BhΔdam at all timepoints was significantly lower than WT B. hermsii (p<0.01, denoted by an asterisk). Spirochetemia from each mouse is represented by a different shape; mean density is depicted by a line.

BhΔdam is capable of infection at low doses

To evaluate whether BhΔdam retained its ability to infect mice at low doses, 5 groups of B6 and SCID mice, composed of 6 and 3 animals per group respectively, were infected with decreasing doses of wild type B. hermsii or BhΔdam (approximately 1 x 105, 104, 103, 102, and 10 spirochetes per inoculum). Blood samples were taken from each mouse every day until day 3 post inoculation and monitored by blood culture for the presence of spirochetes. In B6 mice, all doses of wild type B. hermsii and BhΔdam resulted in infection by day 2 post inoculation (Table 3). Likewise, for the SCID mice, all infectious doses produced positive spirochetemia for both wild type and BhΔdam throughout the 3 day study (S2 Table). The data indicate that the overall ability of BhΔdam to infect the murine host is independent of dose and similar to wild type B. hermsii.
Table 3

Infection of B6 mice with wild type B. hermsii and BhΔdam at decreasing infectious doses of approximately 1 x 105 to 10 spirochetes.

Day post inoculation:B6 mice inoculated with:
WTBhΔdam
1051041031021010510410310210
15/6a4/66/66/65/65/63/62/62/60/6b
26/66/66/66/66/66/66/66/66/66/6
36/66/66/66/66/66/66/66/66/66/6

a Values listed correspond to number of positive mice/number tested.

b Statistically-significant difference between mutant and control groups as determined by Fisher’s Exact Test (p<0.05). Note that a complemented mutant was not generated for comparison (see below).

a Values listed correspond to number of positive mice/number tested. b Statistically-significant difference between mutant and control groups as determined by Fisher’s Exact Test (p<0.05). Note that a complemented mutant was not generated for comparison (see below).

Attempted complementation of the BhΔdam mutant

Despite clear evidence that disruption of the bh0463A gene of B. hermsii results in a loss of adenine-specific DNA methylation, gene complementation was attempted in order to verify that the difference between the infection profiles of B. hermsii wild type and BhΔdam were due exclusively to the disruption of dam. Initially, a shuttle vector was generated that would allow for in trans complementation using methods described in Battisti et al. [27]. Attempts to transform wild type B. hermsii with the shuttle vector resulted in either no transformants, or integration of the plasmid into the genome. In another effort, a construct was generated that would replace the disrupted dam gene with a wild type copy that included a downstream kanamycin resistance cassette (kan) in cis. Two transformations were attempted; both resulted in transformants with inappropriate rearrangements at the dam locus. A final attempt to complement dam in trans on a 200 kilobase linear plasmid of B. hermsii via allelic exchange utilizing methods described in Fine et al. also failed [31]. No transformants resulted from this effort. Thus far, all attempts to complement the BhΔdam mutant clone have been unsuccessful. In an effort to verify that the disruption of dam results in an inability to persist in the absence of a complemented mutant, a second independently-generated clone of BhΔdam (BhΔdam#2) was generated, characterized, and used to infect B6 mice and SCID mice. Transformation and verification of BhΔdam#2 was carried out by sequencing and restriction enzyme digestion as described for the first clone (S2 Fig). In vitro growth curves comparing BhΔdam#2 to wild type B. hermsii during 3 days of exponential growth (days 1–4 post inoculation) revealed that BhΔdam#2 grew significantly faster than the control strain as determined by linear regression analysis and comparison of the slopes (S3 Fig; p = 0.005). Correspondingly, the doubling time for BhΔdam#2 was 8.8 hours, while the doubling time for wild type was 10.2 hours. Mean maximum cell density was not significantly different between the two strains (BhΔdam#2 = 2.8 x 108 spirochetes per mL, 95% CI = 2.1 x 108–3.6 x 108; wild type = 2.2 x 108, 95% CI = 1.6 x 108–2.7 x 108; p = 0.2), although BhΔdam#2 reached maximum cell density on day 4 post inoculation while wild type B. hermsii peaked at day 6. Finally, B6 and SCID mice were inoculated with 1 x 106 spirochetes, and infection was monitored by blood culture each day for 10 days post inoculation. Like the first clone, all SCID and B6 mice were positive throughout the 10 day experiment (S3 Table), except one SCID mouse that did not become positive until day 2. Together, the results from the second clone further support that the disruption of dam does not result in in vitro growth deficiencies, nor does it result in significant in vivo attenuation leading a lack of persistence. Despite the absence of a complement, two clones of BhΔdam exhibiting similar infection phenotypes provides confidence that Dam is dispensable for mammalian infection and persistence.

Discussion

It has been previously reported that adenine methylation systems are found in relapsing fever Borrelia spp., but are absent in most B. burgdorferi strains [22, 23]. Correspondingly, a putative Dam is encoded in the chromosome of Borrelia recurrentis and B. duttonii, but not in B. burgdorferi [9]. For the present study, analyses with BLAST and the Restriction Enzyme Database (http://rebase.neb.com) revealed that an orthologous gene with a putative Dam function exists in B. hermsii at chromosomal locus bh0463A (GenBank Accession Number NC_010673.1), and is conserved in other relapsing fever-type Borrelia. After cloning the B. hermsii gene into a dam- E. coli strain, extracted DNA was digested with restriction enzymes sensitive to adenine methylation. The resulting restriction fragment profile provided strong evidence that bh0463A is indeed an adenine-specific methyltransferase. Because of the role for DNA methylation in the virulence of other pathogens, the presence of dam in B. hermsii led to the hypothesis that the gene product serves a role in host pathogenicity. The findings reported here are the first to show that disruption of dam in a relapsing fever-type Borrelia species does not result in significant in vitro or in vivo attenuation, a rather surprising finding based on studies involving dam- strains of other important pathogens [10, 12, 37]. The finding that mean spirochete density is significantly lower for BhΔdam at days 3, 7, and 10 post inoculation compared to the wild type strain in SCID mice is somewhat puzzling, as this difference is not observed when the mutant clone is inoculated into the more taxing environment of the immunocompetent host. Whether this finding is biologically relevant must be examined more closely, as the overall spirochete burden of the mutant strain in SCID mice was grossly elevated, as expected. The apparently subtle differences between strains, and their interactions with the host’s immune system, will be evaluated in forthcoming studies using a larger sample size and increasing the sampling frequency. Nevertheless, the results reported herein demonstrate that the B. hermsii Dam is dispensable for murine infection and persistence. The hallmark of relapsing fever is the repeated waxing and waning of spirochetemia that parallels febrile episodes [5]. The episodic outgrowth of each peak is dominated by a single serotype of the variable major protein (Vmp) [45]. The B. hermsii genome harbors a large repertoire of non-expressed vmp genes that are switched via gene conversion into the single transcriptionally-active expression site during infection of a mammalian host [42, 43, 46]. The overall result of this antigenic variation system is that it provides the spirochete with the capacity to repeatedly evade the highly serotype-specific host humoral response [41, 47]. Antigenic switching is required for spirochete persistence in mice beyond the first wave of spirochetemia, which typically peaks on day 3 post infection [36, 39]. By day 10 post infection, when antigenic variation was confirmed in BhΔdam, it would be expected that all spirochetes in the infecting inoculum, even minor serotypes if present, would have undergone switching or be cleared. By this point, each immunocompetent mouse would be expected to have undergone 1–2 relapses [36, 39]. While antigenic switching was verified to occur in BhΔdam, it is not clear whether the kinetics of such switching could be mediated by Dam. Increased antigenic switch rates in BhΔdam may explain why the mutant was detected each day throughout the B6 murine infection experiment, while wild type B. hermsii could not be recovered on low density days. Moreover, in a report by Barbour et al. that describes a loose, programmed order for within-host antigenic variation in B. hermsii, certain serotypes appeared more frequently than others when infected with spirochetes of the serotype VlpA7 [48]. Interestingly, while BhΔdam underwent antigenic switching, spirochetes from all three mice switched to the same serotype (VlpA25), a serotype that was not identified with any frequency in the reported findings by Barbour et al. This raises the possibility that the absence of Dam disrupts the programmed order for antigenic switching in B. hermsii. Future studies should include a closer examination of the role for Dam in immune evasion, both in the rate and order of Vmp switching, and in mechanisms for early IgM immune escape. The data clearly indicate that Dam is not absolutely required for infection or persistence in our murine model, but the presence of dam orthologs in numerous relapsing fever Borrelia spp. raises the question of why the gene is so highly conserved in these spirochetes. One possibility is that Dam may be essential in some component of the life cycle of B. hermsii that is not recreated in the laboratory. In nature, the spirochete must be capable of survival in diverse reservoir species, and thrive under the pressure of co-infecting pathogens and bacteriophages. In this context, even small reductions in replication rate, as was observed in B6 and SCID mice immediately post infection, may adversely affect the propagation of this pathogen. Another explanation for the conservation of Dam is that it may serve a role in the tick phase of the B. hermsii lifecycle, or in the regulation of differential gene expression as the spirochete moves between the mammalian host and tick vector. For example, in the tick phase of the B. hermsii lifecycle, vmp transcription is turned ‘OFF’, while another distant site required for tick transmission, vtp (variable tick protein), is turned ‘ON’ [36, 49]. While both Vtp and Vmp are required for the B. hermsii lifecycle, the mechanisms regulating their mutually exclusive expression remains unknown [36, 39]. The absence of the Dam gene in B. burgdorferi, however, supports that if dam is involved in differential gene regulation in the tick, it is uniquely required for relapsing fever spirochetes. Indeed, significant differences between the two groups exist, with many relapsing fever-type Borrelia being transmitted by the soft-bodied, fast-feeding Ornithodoros spp. ticks, while B. burgdorferi requires the hard-bodied, slow-feeding Ixodes tick [50, 51]. Whether dam is required for the tick phase of relapsing fever spirochetes will be the subject of forthcoming studies. Ideally, the results herein would be supported by a mutant clone complemented with the bh0463A gene. Although complementation of B. hermsii has been successful for other groups [27, 36, 52], all attempts to generate a dam complement failed. Despite the published descriptions of numerous complementation mutants of B. burgdorferi, difficulties in genetic complementation of Borrelia have been documented [53, 54]. A major limitation of not having a complement is our inability to test whether the disruption of dam resulted in polar effects on adjacent genes. Polar effects, however, are unlikely due to the fact that significant phenotypic differences were not observed between wild type B. hermsii and BhΔdam. Moreover, both bh0463A and gentR genes are transcribed in the same direction, and none of the native sequence was deleted in BhΔdam. Thus, the native terminator sequence is expected to terminate the mutant transcript in the same fashion as the wild type transcript, further minimizing the likelihood that polar effects had any impact on a possible mutant phenotype. Despite the lack of a complement, the absence of significant differences of two independently-generated clones of BhΔdam in regard to in vitro growth, infectivity, and in vivo persistence, along with restriction fragment evidence for the disruption of Dam function prior to and after murine infection, instills confidence in the validity of the results: the absence of adenine-specific DNA methylation does not result in marked phenotypic differences during mammalian infection. The present data indicate that dam does not influence the ability of B. hermsii to infect or persist in the mammalian host. In addition to characterizing the role for dam in the arthropod portion of the lifecycle, it would also be prudent to investigate the utility of BhΔdam as a molecular tool. For example, the role for DNA adenine methylation in restriction modification systems and in DNA partitioning have been well established [10, 11]. Therefore, future studies will be directed toward understanding whether BhΔdam provides improved transformation efficiency when generating genetic mutants, and determining if the absence of Dam activity allows for B. hermsii plasmid loss. Unlike B. burgdorferi, the B. hermsii genome is stable following transformation and in vitro passage [31, 55, 56]. Both tools have the potential to improve the investigation of putative virulence factors, and provide insight into the evolution of various relapsing fever and Lyme Borrelia spp.

BhΔdam remains Dam deficient on day 10 post inoculation.

Pooled BhΔdam DNA extracted from 5 B6 mice on day 10 post inoculation was subjected to DpnI and MboI restriction enzyme digestion to verify the stable disruption of Dam function. DpnI and MboI cleave sequences that are adenine methylated and adenine non-methylated, respectively. Sizes of selected molecular weight standards (mws) of 100 bp DNA ladder (New England Biolabs) are shown on the left in base pairs. (TIF) Click here for additional data file.

Verification of Dam disruption in BhΔdam#2 by restriction enzyme digestion.

DNA from BhΔdam#2 is either undigested, or digested with DpnI, MboI, or Sau3AI. DpnI, MboI, and Sau3A1 cut GATC sequences that are adenine methylated, adenine non-methylated, or cytosine non-methylated GATC sites, respectively. The absence of DNA cleavage with DpnI digestion and fragmentation with MboI digestion verifies the disruption of Dam function. (TIF) Click here for additional data file.

In vitro growth curves of wild type B. hermsii and BhΔdam#2.

Wild type B. hermsii is shown with black circles; BhΔdam#2 is shown with white triangles. The mean and standard deviation of triplicate measurements at each time point are plotted. (TIF) Click here for additional data file.

Partial nucleotide alignment of the BhΔdam variable membrane protein (vmp) prior to infection compared to the sequences of vmp from BhΔdam recovered from 3 mice on day 10 post infection.

Through sequencing of vmp and BLAST analysis, the vmp serotype in the infecting inoculum was determined to be VlpA7. The vmp serotype of BhΔdam recovered from all B6 mice on day 10 was determined to be VlpA25. (PDF) Click here for additional data file.

Mean spirochete density as determined by qPCR for wild type B. hermsii and BhΔdam at days 3, 7, and 10 post inoculation.

(DOCX) Click here for additional data file.

Infection of SCID mice with wild type B. hermsii and BhΔdam at decreasing infectious doses of approximately 1 x 105 to 10 spirochetes.

(DOCX) Click here for additional data file.

Infection by a second, independently generated clone of BhΔdam (BhΔdam#2) in B6 and SCID mice as determined by blood culture.

(DOCX) Click here for additional data file.
  53 in total

1.  DNA adenine methylase mutants of Salmonella typhimurium show defects in protein secretion, cell invasion, and M cell cytotoxicity.

Authors:  F García-Del Portillo; M G Pucciarelli; J Casadesús
Journal:  Proc Natl Acad Sci U S A       Date:  1999-09-28       Impact factor: 11.205

2.  DNA adenine methylase is essential for viability and plays a role in the pathogenesis of Yersinia pseudotuberculosis and Vibrio cholerae.

Authors:  S M Julio; D M Heithoff; D Provenzano; K E Klose; R L Sinsheimer; D A Low; M J Mahan
Journal:  Infect Immun       Date:  2001-12       Impact factor: 3.441

3.  An essential role for DNA adenine methylation in bacterial virulence.

Authors:  D M Heithoff; R L Sinsheimer; D A Low; M J Mahan
Journal:  Science       Date:  1999-05-07       Impact factor: 47.728

4.  Variable tick protein in two genomic groups of the relapsing fever spirochete Borrelia hermsii in western North America.

Authors:  Stephen F Porcella; Sandra J Raffel; Donald E Anderson; Stacey D Gilk; James L Bono; Merry E Schrumpf; Tom G Schwan
Journal:  Infect Immun       Date:  2005-10       Impact factor: 3.441

5.  Methylated DNA in Borrelia species.

Authors:  C A Hughes; R C Johnson
Journal:  J Bacteriol       Date:  1990-11       Impact factor: 3.490

6.  Electrotransformation of the spirochete Borrelia burgdorferi.

Authors:  D S Samuels
Journal:  Methods Mol Biol       Date:  1995

7.  Genetic transformation of the relapsing fever spirochete Borrelia hermsii: stable integration and expression of green fluorescent protein from linear plasmid 200.

Authors:  Lindy M Fine; Christopher G Earnhart; Richard T Marconi
Journal:  J Bacteriol       Date:  2011-05-06       Impact factor: 3.490

8.  Isolation of a circular plasmid region sufficient for autonomous replication and transformation of infectious Borrelia burgdorferi.

Authors:  P E Stewart; R Thalken; J L Bono; P Rosa
Journal:  Mol Microbiol       Date:  2001-02       Impact factor: 3.501

9.  Genetic analysis of Borrelia.

Authors:  F W Hyde; R C Johnson
Journal:  Zentralbl Bakteriol Mikrobiol Hyg A       Date:  1986-12

10.  Isolation and cultivation of Lyme disease spirochetes.

Authors:  A G Barbour
Journal:  Yale J Biol Med       Date:  1984 Jul-Aug
View more
  8 in total

Review 1.  Genetic Manipulation of Borrelia Spp.

Authors:  Dan Drecktrah; D Scott Samuels
Journal:  Curr Top Microbiol Immunol       Date:  2018       Impact factor: 4.291

2.  Colony formation in solid medium by the relapsing fever spirochetes Borrelia hermsii and Borrelia turicatae.

Authors:  Sandra J Raffel; Brandi N Williamson; Tom G Schwan; Frank C Gherardini
Journal:  Ticks Tick Borne Dis       Date:  2017-11-12       Impact factor: 3.744

3.  DNA Methylation by Restriction Modification Systems Affects the Global Transcriptome Profile in Borrelia burgdorferi.

Authors:  Timothy Casselli; Yvonne Tourand; Adam Scheidegger; William K Arnold; Anna Proulx; Brian Stevenson; Catherine A Brissette
Journal:  J Bacteriol       Date:  2018-11-26       Impact factor: 3.490

4.  The First Immunocompetent Mouse Model of Strictly Human Pathogen, Borrelia recurrentis.

Authors:  Artem S Rogovskyy; Yuliya V Rogovska; Brianne M Taylor; Dominique J Wiener; David W Threadgill
Journal:  Infect Immun       Date:  2021-06-16       Impact factor: 3.441

Review 5.  Genetic Manipulation of Borrelia.

Authors:  Patricia A Rosa; Mollie W Jewett
Journal:  Curr Issues Mol Biol       Date:  2020-12-10       Impact factor: 2.081

6.  Cis-acting DNA elements flanking the variable major protein expression site of Borrelia hermsii are required for murine persistence.

Authors:  Allison E James; Artem S Rogovskyy; Michael A Crowley; Troy Bankhead
Journal:  Microbiologyopen       Date:  2017-12-17       Impact factor: 3.139

7.  Assessing the Contribution of an HtrA Family Serine Protease During Borrelia turicatae Mammalian Infection.

Authors:  Clay D Jackson-Litteken; Amanda K Zalud; C Tyler Ratliff; Jacob I Latham; Travis J Bourret; Job E Lopez; Jon S Blevins
Journal:  Front Cell Infect Microbiol       Date:  2019-08-13       Impact factor: 5.293

8.  The Unfolded-Protein Response Triggers the Arthropod Immune Deficiency Pathway.

Authors:  Lindsay C Sidak-Loftis; Kristin L Rosche; Natasha Pence; Jessica K Ujczo; Joanna Hurtado; Elis A Fisk; Alan G Goodman; Susan M Noh; John W Peters; Dana K Shaw
Journal:  mBio       Date:  2022-07-18       Impact factor: 7.786

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.