Literature DB >> 27162490

Alteration of wheat vernalization requirement by alien chromosome-mediated transposition of MITE.

Yasir Serag Alnor Gorafi1, Amin Elsadig Eltayeb2, Hisashi Tsujimoto2.   

Abstract

Under the changing climate, early flowering is advantageous to escape terminal heat and drought. Previously during evaluation of 14 chromosome introgression lines (ILs), we found three ILs that flowered a month earlier than their wheat background Chinese Spring (CS). This paper describes the cause of the early flowering in the ILs and provides insight into the evolution of spring wheat from the winter wheat. We used specific molecular markers for Vrn genes to determine its allelic composition. Phenotypic evaluations carried out under field conditions and in a growth chamber. Unlike the winter vrn-A1 allele of CS, the spring Vrn-A1 allele of the ILs had insertions of 222 and 131-bp miniature inverted-repeat transposable element (MITE) in the promoter region. Sequence analysis indicated that the 222-bp insertion is similar to an insertion in the spring genotype, Triple Dirk D. Our results ruled out any possibility of outcrossing or contamination. Without vernalization, Vrn-A1 is highly expressed in the ILs compared to CS. We attribute the early flowering of the ILs to the insertion of the MITE in the promoter of Vrn-A1. The alien chromosome might mediate this insertion.

Entities:  

Keywords:  alien chromosome; drought; introgression line; transposon; vernalization; wheat evolution

Year:  2016        PMID: 27162490      PMCID: PMC4784996          DOI: 10.1270/jsbbs.66.181

Source DB:  PubMed          Journal:  Breed Sci        ISSN: 1344-7610            Impact factor:   2.086


Introduction

Wheat (Triticum aestivum L.) grows under a wide range of environmental conditions. Its wide adaptability is controlled by three types of genes (Kato and Yamagata 1988): vernalization genes (Vrn), which determine a plant’s vernalization requirement; photoperiod genes (Ppd), which determine its photoperiod sensitivity; and genes that control earliness per se. These genes act together to determine the flowering time and therefore, defines a genotype’s adaptation to a particular environmental condition (Bentley , Worland ). Vernalization genes determine growth habit, which divides wheat into winter and spring types. Spring types have recurrently evolved from the ancestral winter types (Fu ). Wheat vernalization response is controlled by four major genetic loci: Vrn1, Vrn2, Vrn3 and Vrn4 (Kippes ). Vrn1, Vrn2, and Vrn3 interact epistatically and form a positive feedback loop that is activated in winter wheat by the vernalization conditions (Muterko ). Homoeologous Vrn1 alleles (Vrn-A1, Vrn-B1 and Vrn-D1, located in chromosomes 5A, 5B and 5D, respectively) encode a MADS-box transcription factor whose expression increases during vernalization. This promotes flowering by inhibiting expression of the flowering repressor Vrn2 (Distelfeld , Trevaskis , Yan ). The dominant Vrn-A1 is the most potent allele whose action results in the complete elimination of the vernalization requirement (spring, early ear emergence), whereas the Vrn-B1 and Vrn-D1 dominant alleles are associated with residual vernalization requirement (facultative type, medium to late ear emergence) (Stelamkh 1993, 1998). In winter wheat, it has been reported that Vrn-A1 controls the vernalization requirement duration at the protein level (Li ). Dominant Vrn-A1 alleles evolved from the recessive winter allele vrn-A1 by mutations in the promoter region (Chu , Golovnina , Pedal et al. 2010, Yan ) or the first intron (Dubcovsky et al. 2006, Fu , Santra et al. 2009, Scherban et al. 2012). Yan amplified genomic DNA from the promoter region of the dominant Vrn-A1 allele from Triple Dirk D (TDD), and reported the presence of PCR products of two different lengths, both of which were larger than the PCR product of the vrn-A1 allele from Triple Dirk C (TDC). They sequenced these two fragments and found that the promoter region of the Vrn-A1 allele was duplicated in the TDD genome. This allele was designated as Vrn-A1a. Yan concluded that the two fragments are linked because of their simultaneous presence in TDD and their absence in the isogenic line TDC. Sequence analysis revealed that the two Vrn-A1a fragments differed from the recessive vrn-A1 allele from TDC by the insertion of a 222-bp miniature inverted-repeat transposable element (MITE) fragment and a relatively smaller 131-bp MITE fragment (Yan ). The two halves of the larger MITE showed good similarity along their complete length in an inverted orientation. The smaller MITE differed from the larger MITE fragment by one SNP and a 91-bp deletion. The deletion occurred between two 9-bp direct repeats. Both MITEs inserted at the same site and created the same 9-bp host direct duplication. The duplication of the promoter region has been suggested to occur after the insertion of the MITE and the Vrn-A1 allele has been identified in more than half of the hexaploid varieties but not in the tetraploid lines analysed (Yan ). Recently, Chu found that the Vrn-B1 gene has a 5.6 kb retrotransposable element (Retrotrans_VRN) in the 5′-untranslated region (UTR) in tetraploid wheat, which is prevalent among T.turgidum subsp.carthlicum. Also Muterko found the 844-bp transposable element (DTA_Chimera_KF800714) inserted in intron 1 of Vrn-D1 in T. spelta. Golovnina concluded that DNA transposon insertions first occurred in polyploid species. At the same time, the duplication of the promoter region was observed in the A genomes of polyploid species. There are multiple spring Vrn-1 alleles, with different manifestations in vernalization response (Koval , Rhone ). These findings indicate the existence of mechanisms with an unknown evolutionary background. In addition, most of these mobile element insertions reported at polyploid levels that suggest its relation with interspecific hybridization between wheat ancestors. These mechanisms led to the evolution of the spring wheat from the winter wheat and contributed to the wide distribution and high adaptability of wheat. In our previous study (Mohammed ), we evaluated 14 wheat–Leymus chromosome introgression lines (ILs) for heat stress tolerance under field conditions in Sudan. We found that three lines headed and matured earlier than the background cultivar, Chinese Spring (CS), whereas one line was later than CS. We hypothesized that the vernalization requirement of CS was annulled in the ILs by the added alien chromosomes that led to their early flowering. Besides this hypothesis, we found that an insertion in the promoter region of Vrn-A1 of the ILs is the cause of this observed early flowering. The nature of the independent insertions that occurred in these three wheat–Leymus chromosome introgression lines (TAC1, TAC13 and TAC17) is described in this paper.

Materials and Methods

Plant materials and phenotypic evaluation

Of the 14 wheat-Leymus racemosus ILs used in the previous study (Mohammed ), three lines (TACBOW1, TACBOW13 and TACBOW17; hereinafter TACBOW will be abbreviated as TAC, and their wheat genetic background Chinese Spring (CS), were used in this study. These lines are available in NBRP-Wheat (www.shingen.nig.ac.jp/wheat/komugi). In addition to the normal complement of CS chromosomes, TAC1 harbours the homoeologous-group (HG) 2 chromosome of L. racemosus, whereas TAC13 harbours the HG5 chromosome (Larson ). TAC17, in contrast, has the HG 2 chromosome of L. racemosus in place of chromosome 2B of CS wheat (Qi ). Flowering time was recorded in a field of the Arid Land Research Center, Tottori University (Tottori, Japan:35°32′N, 134°13′E) during the wheat growing season (November to June), and in a growth chamber under long-day conditions (16 h) without vernalization at 25/15°C and 60% relative humidity.

Molecular marker analysis, sequencing and expression profile of Vrn-A1

Genomic DNA was extracted from the leaves of 10-day-old seedlings by the CTAB method (Clark 1997). We used specific primer pairs to identify allelic variation at Vrn-A1, Vrn-B1, Vrn-D1 and Vrn-3 (Fu , Yan , 2006) (Table 1). To exclude the effect of differences in flowering time among the accessions due to photoperiod genes, we used the primers Ag5del_F2, and Ag5del_R2 (Bentley ) to confirm the allelic composition at Ppd-A1, and primers Ppd-D1_F1 and Ppd-D1_R1 (Bentley ) to confirm that at Ppd-D1. Amplified PCR fragments were separated in 2% agarose gels stained with Gel Green (Biotium, Hayward, CA, USA).
Table 1

List of primers used to detect the allelic composition of the Vrn1, Vrn3 and Ppd genes in CS and the introgression lines (TAC1, TAC13 and TAC17)

Primer nameSequence (5′-3′) (top: forward primers, bottom: reverse primers)AlleleExpected PCR product size (bp)Reference
VRN1AFGAAAGGAAAAATTCTGCTCGVrn-A1a965Yan et al. 2004
VRN1-INT1RGCAGGAAATCGAAATCGAAG

VRN1AFGAAAGGAAAAATTCTGCTCGVrn-A1500Yan et al. 2004
VRN-1R-ATGCACCTTCCCCCGCCCCAT

VRN1BFCAGTACCCCTGCTACCAGTGVrn-B11000Yan et al. 2004
VRN-1R-B, DTGCACCTTCCCGCGCCCCAT

VRN1DFCGACCCGGGCGGCACGAGTGVrn-B1750Yan et al. 2004
VRN-1R-B, DTGCACCTTCCCGCGCCCCAT

INS-7-FGCCAGATCCCTTTAAAAACCGVrn-A1aDesigned in this study
INS-7-RCCAGGCCAAAACGAGGATTC

Intr1/A/F2AGCCTCCACGGTTTGAAAGTAAVrn-A11170Fu et al. 2005
Intr1/A/R3AAGTAAGACAACACGAATGTGAGA

Intr1/C/FGCACTCCTAACCCACTAACCvrn-A11068Fu et al. 2005
Intr1/AB/RTCATCCATCATCAAGGCAAA

Intr1/B/FCAAGTGGAACGGTTAGGACAVrn-B1709Fu et al. 2005
Intr1/B/R3CTCATGCCAAAAATTGAAGATGA

Intr1/B/FCAAGTGGAACGGTTAGGACAvrn-B11149Fu et al. 2005
Intr1/B/R4CAAATGAAAAGGAATGAGAGCA

Intr1/D/FGTTGTCTGCCTCATCAAATCCVrn-D11671Fu et al. 2005
Intr1/D/R3GGTCACTGGTGGTCTGTGC

Intr1/D/FGTTGTCTGCCTCATCAAATCCvrn-D1997Fu et al. 2005
Intr1/D/R4AAATGAAAAGGAACGAGAGCG

FT-B-INS-FCATAATGCCAAGCCGGTGAGTACVrn31200Yan et al. 2006
FT-B-INS-RATGTCTGCCAATTAGCTAGC

FT-B-NOINS-FATGCTTTCGCTTGCCATCCVrn31140Yan et al. 2006
FT-B-NOINS-RCTATCCCTACCGGCCATTAG

FT-B-NOINS-F2GCTGTGTGATCTTGCTCTCCVrn3691Yan et al. 2006
FT-B-NOINS-RCTATCCCTACCGGCCATTAG

Ag5del_F2TGTCACCCATGCACTCTGTTTPpd-A1453Bentley et al. 2011
Ag5del_R2CTGGCTCCAAGAGGAAACAC

Ppd-D1_F1ACGCCTCCCACTACACTGPpd-D1414Bentley et al. 2011
Ppd-D1_R1TGTTGGTTCAAACAGAGAGC
The Vrn-1A PCR products sequenced directly and after cloning in the pGEM-T Easy Vector (Promega, Madison, WI, USA) using the BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) in an ABI 3130 Genetic Analyzer (Applied Biosystems). To avoid PCR error, PCR products and cloned fragments were sequenced in CS and the ILs. Sequences were analysed in GENETYX v.10 software (GENETYX Corporation, Tokyo, Japan). The expression profile of the Vrn-A1 was identified in the leaves of 4-week-old seedlings grown in the growth chamber under long-day conditions without vernalization. Total RNA was extracted using TriPure isolation reagent (Roche, Mannheim, Germany) following the manufacturer’s instructions. RNA was treated with RNase-free DNase I (Takara, Ohtsu, Japan) to remove any genomic DNA. We used the Transcriptor first-strand cDNA synthesis kit (Roche) to treat 1 μg RNA. The first-strand cDNA (50 ng) was used for PCR with primers 5′-CCTGAACGGTATGAGCGCTAT-3′ and 5′-GCATGAAGGAAGAAGATGAAG-3′ for amplification of the Vrn-1A transcript (Diaz ), and primers 5′-TCAACGAGGAATGCCTAG-TAAGC-3′ and 5′-ACAAAGGGCAGGGACGTAGTC-3′ for amplification of the ribosomal 18S gene as an internal control (Fontecha ). The PCR conditions were an initial denaturation at 95°C for 5 min; followed by 35 cycles at 94°C, 58°C and 72°C for 30 s each; and a final extension at 72°C for 7 min.

Genetic analysis of Vrn-A1

To confirm the role of the alien chromosome in the early flowering of the ILs, we crossed CS with TAC1. The F1 plants were self-pollinated to produce an F2 population. The phenotype was evaluated in the growth chamber without vernalization. The presence or absence of the alien chromosome was examined in all plants by specific markers for the chromosome (Table 2), chromosome counting and genomic in situ hybridization (Cho et al. 2012). The primer pair VRN1AF and VRN1-INT1R was used to examine the allelic constitution at the Vrn-A1 locus (Table 1).
Table 2

List of Leymus SSR markers used to test the presence or absence of the alien chromosome

Leymus SSRForward primerReverse primer
Ltc0090AACTAAGCACACGATGGGAGATGTACTATACGTGCGCAGAGCAACAT
Ltc0543GAGGGAAAGATGAGGGAGCTGGTTGACGTCCTCCCACCATC
Ltc0682TTTTTGTATCGCAAGTCACTAAGGTAATTAGTTGTTGAGCGTCTTGCAT
Ltc0697CAGGTTCTGGAAGAACAAGAGGAATACTCCTGAACCGAGAGCAAAGAC
Ltc0761GCCTGGAGACTCTACTTGCTGTTTTTTTTAAAGCAAGCCACGAGGTAA
Ltc1142AAACCCTACCCCTCGAGCAACGTCATCGATCTCGACCTTCTTCTG
To confirm the genetic purity of ILs compared with their parent CS, we analysed polymorphism of the six SSR markers (Table 3) located on the long arm of wheat chromosome 5 (5LA) in addition to the morphological observation. These markers were selected from the wheat SSR marker list in the USDA GrainGenes database (wheat.pw.usda.gov).
Table 3

List of SSR markers from the long arm of chromosome 5A (5LA) used to test the possibility of outcrossing at the 5LA region of Chinese Spring and the introgression lines (TAC1, TAC13 and TAC17)

Marker nameSequence (F)Sequence (R)
gwm126CACACGCTCCACCATGACGTTGAGTTGATGCGGGAGG
gwm156CCAACCGTGCTATTAGTCATTCCAATGCAGGCCCTCCTAAC
gwm291CATCCCTACGCCACTCTGCAATGGTATCTATTCCGACCCG
wmc110GCAGATGAGTTGAGTTGGATTGGTACTTGGAAACTGTGTTTGGG
wmc524TAGTCCACCGGACGGAAAGTATGTACCACCGATTGATGCTTGAG
cfa2155TTTGTTACAACCCAGGGGGTTGTGTGGCGAAAGAAACAG
To identify the point of the insertion, we analysed early backcross generations of the ILs (BC2F2 and BC2F3, derived from CS × L. racemosus) and the selfed plants of the first and second generations during the maintenance of the ILs (2n = 44 chromosomes), using the primer pair VRN1AF and VRN1-INT1R to identify the presence or absence of the insertion.

Statistical analyses

All data of flowering time were tested by analysis of variance (ANOVA) followed by Fisher’s protected least significant difference test at P < 0.05 in StatView v. 5.0.1 software (SAS Institute, Cary, NC, USA).

Results

Flowering time

The flowering time of the ILs TAC1 and TAC13 that flowered earlier than CS, and TAC17 that flowered later in Sudan (no vernalization), evaluated again under two contrasting conditions in the field in Japan and the growth chamber. Under field conditions in Japan, the daylength was 13h during spring, and the lines were able to accomplish their vernalization requirement. Under the growth chamber condition, the day length was 16 h, and there was no vernalization. Under field conditions in Japan, TAC1 and TAC13 flowered only 3 days earlier than CS, and TAC17 flowered later than CS (Table 4), whereas in the growth chamber, all three ILs flowered significantly earlier than CS, by an average of 32 days; while TAC13 flowered 9 days earlier than TAC1 and 12 days earlier than TAC17 (Table 4).
Table 4

Days-to-flowering of Chinese Spring (CS) and introgression lines TAC1, TAC13 and TAC17 evaluated in the field (2012/2013) in Japan and in a growth chamber under long-day (16 h) conditions without vernalization

GenotypeField in JapanGrowth chamber without vernalization
CS15482
TAC115152
TAC1315143
TAC1716255

P value<0.0001<0.0001
PLSD (P < 0.05)1.5971.37

PLSD = Fisher’s protected least significant difference.

Allelic combination of vernalization and photoperiod genes

In view of the significant differences observed in flowering time of the tested wheat genotypes under three different conditions in the presence or absence of vernalization, we examined the allelic constitution of the underlying vernalization genes in CS and the ILs using the specific primers described by Fu and Yan , 2006) for the spring and winter alleles of Vrn-1 and Vrn-3. The Vrn-A1 promoter region of CS and the ILs was tested with the primers VRN1AF and VRN1-INT1R. CS showed a 713-bp PCR fragment, whereas all three ILs showed two fragments larger than the CS fragment (944 and 853-bp, respectively) (Fig. 1A). According to Yan , the fragment detected in CS (713-bp) is characteristic of both the recessive vrn-A1 allele and the dominant Vrn-A1c allele. To distinguish between these alleles, we tested CS and ILs with the primer pairs Intr1/A/F2–Intr1/A/R3 and Intr1/C/F–Intr1/AB/R (Fu ) for the first intron of Vrn-A1. No PCR product was produced by the second primer pair, but a 1068-bp fragment was produced in all lines with the first primer pair, indicating that CS and ILs lacked the large intron 1 deletion that is defined the dominant Vrn-A1c allele, and that the 713-bp product detected in CS is the recessive allele (vrn-A1c). In TDD, Yan found that the dominant spring Vrn-A1a allele from TDD differs from the recessive winter allele from Triple Dirk C (TDC) by insertion of small and large MITEs in the promoter region. To confirm the presence or absence of this insertion in the ILs we designed a new primer pair, INS-7-F and INS-7-R (Table 1) from the TDD Vrn-A1a sequence (GenBank AY616458) to target only the insertion of the MITEs identified in TDD. Using this primer pair, we confirmed the presence of the inserted MITEs in the ILs which was absent in the case of CS (Fig. 1B).
Fig. 1

Amplification profile of the primer pairs used to detect the allelic composition at the Vrn-A1 locus by using primer pairs (A) VRN1AF–VRN1-INT1R for Vrn-A1a allele and (B) INS-7-F–INS-7-R for the MITE insertion. M, 100-bp DNA Ladder, CS, Chinese Spring wheat; Lr, Leymus racemosus; introgression lines (TAC1, TAC13, and TAC17).

The primer pair Intr1/B/F–Intr1/B/R3 did not amplify a PCR product of the dominant spring allele Vrn-B1, whereas Intr1/B/F–Intr1/B/R4 amplified a 1149-bp fragment in all tested genotypes, indicating that these lines had the recessive allele vrn-B1. Intr1/D/F–Intr1/D/R3 amplified a 1671-bp fragment characteristic of the dominant Vrn-D1 in all genotypes, but Intr1/D/F–Intr1/D/R4 amplified no PCR product: this result indicates that all tested genotypes had the dominant allele Vrn-D1. No allelic polymorphism detected among the tested lines and CS at the Vrn-3, Ppd-A1 and Ppd-D1 loci. In L. racemosus, no amplification resulted from the use of any of the above primer sets, suggesting that its vernalization and photoperiod genes differ from those of wheat. The results of molecular marker analysis indicated that the ILs differed from CS by an insertion of MITE in the promoter region of Vrn-A1 allele, and no PCR product was produced from L. racemosus (Fig. 1A, 1B). These results suggest that the insertion is in the promoter region of the Vrn-A1 allele of the wheat genome and not the alien chromosome. To clarify this suggestion, we crossed CS with the IL TAC1. All F1 plants were monosomic for the alien chromosome (Supplemental Fig. 1) and flowered earlier than CS. Molecular analysis with primer pair VRN1AF–VRN1-INT1R indicated that all are heterozygous and had the insertion of the MITE in their Vrn-A1 promoter region. One plant was selected and self-pollinated. The 37 resulting F2 plants were analysed for the presence of both the alien chromosome and the insertion of the MITE in their promoter regions. Of the 37 plants, 24 (65%) had the alien chromosome, and 13 did not. Of the 24 F2 plants that had the alien chromosome, 19 (79%) carried the insertion; and of the 13 plants without the alien chromosome, 9 (69%) had the insertion (Table 5), thereby confirming that the insertion segregated independently of the alien chromosome. The F2 plants segregated for the winter/spring allele at Vrn-A1 in the ratio of 9 winter: 22 heterozygous: 6 spring, which is in a good agreement with the 1 : 2 : 1 genetic ratio (χ2 = 1.8, P > 0.05). These results indicate that the insertion is located in the wheat genome and that the early flowering observed in the ILs is not due to the effect of the alien chromosome.
Table 5

Frequency of Leymus racemosus chromosome A, spring and winter Vrn-A1 alleles, and days to heading of 37 F2 plants derived from the cross of Chinese Spring (CS) and TAC1 evaluated in the growth chamber under long-day condition (16 h) without vernalization

Vrn-A1 alleleNo. of plants

With alien chromosomeWithout alien chromosome
Spring4 (48–60)a2 (55–60)
Winter5 (75–81)4 (75–85)
Heterozygous15 (50–66)7 (57–73)

Total2413

Numbers in parentheses show the range of flowering time.

The ILs were produced and maintained carefully by bagging and self-pollination in TACBOW. We did not observe any morphological variation or genetic segregation in any of the traits in the ILs grown under field conditions in Sudan and Japan and during three generations of seed maintenance and multiplication, and the basic morphology of the ILs was similar to their CS wheat background. These observations do not support any possibility of gene flow and contamination especially given the fact that wheat is a highly autogamous species with negligible outcrossing rate. We further confirmed the purity of the material by genetic analysis with specific SSR markers that have been mapped to the long arm of chromosome 5A (Fig. 2A) where the Vrn-A1 allele is located. The band sizes of all ILs were similar to that amplified from CS using the SSR primers indicating the purity of the material (Fig. 2A). In addition, we also examined the presence of the insertion in the promoter region of Vrn-A1 allele of several plants from BC2F2 and two plants from BC2F3 generations of the basic cross CS x L. racemosus using the primer pair VRN1AF–VRN1-INT1R. The number of chromosomes in the backcross lines ranged from 44 to 51 (data not shown). A fragment similar to the fragment of CS was present in all backcross lines; this result indicated that the insertion did not occur during the production of the introgression lines and confirmed the purity of the early generation of the ILs (Fig. 2B). We grew all wheat-Leymus ILs in the same place for seed multiplication and found the insertion in three ILs with chromosome A and one with chromosome 5Lr#1. This finding indicates that the insertion is due to genetic event rather than outcrossing. In addition, we produced spring F2 lines with 42 chromosomes and the MITE insertion in their promoter region. These lines had the same spike morphology of CS (Fig. 2C), which further confirmed the above fact that the MITE insertion is a genetic event and not due to out-crossing, at least in IL TAC1.
Fig. 2

PCR analysis with (A) SSR markers of the long arm of chromosome 5 (5LA) to test the possibility of outcrossing and (B) specific Vrn-A1a marker to detect the presence of the inserted promoter in early backcross generations, (C) spike morphology of basic Chinese Spring (CS), and CS with the inserted promoter derived from the cross of CS and IL TAC1, (D) RT-PCR analysis of the expression of Vrn-A1 (ca. 950 bp). RNA was extracted from 4-week-old seedlings grown under long-day conditions (16 h) without vernalization.

In order to identify the source of the inserted MITE, we designed specific primers based on the 222-bp MITE sequence excluding the flanking sequence (Supplemental Table 1). We used these primers to amplify the genomic DNA from CS, TAC1 and L. racemosus. The results showed that TAC1 had the CS MITE suggesting that the source of the insertion is the wheat genome (Supplemental Fig. 2).

Expression of Vrn-A1 transcripts

Marker analysis indicated that the Vrn-A1 allele of TAC1, TAC13 and TAC17 differs from that of CS by insertions of MITE in the promoter region of these ILs. To confirm the association between this difference and the observed early flowering in these genotypes, we investigated the expression of Vrn-A1 in 4-week-old-seedlings grown without vernalization under long-day conditions. The Vrn-A1 allele was highly expressed in TAC1, TAC13 and TAC17 but not in CS (Fig. 2D).

Sequence analysis

Sequence analysis of the fragments generated from the Vrn-A1 locus of CS and the ILs by primer pairs VRN1AF–VRN1-INT1R and INS-7-F–INS-7-R indicated that the promoter region of Vrn-A1 of the ILs differed from vrn-A1 of CS by the insertion of MITEs (Fig. 3). The sequences of the large and small MITEs were very much like the sequences found in the spring wheat line TDD (Yan ), indicating that these ILs also had both MITEs in their promoters. In addition, CS (DDBJ LC053679) differed from the ILs and TDD by two single nucleotide polymorphisms (SNPs) (T/G at nucleotide [nt] 28 and A/G at nt 889). TAC1 (DDBJ LC052271) differed from CS, TDD (GenBank AY616458), TAC13 (DDBJ LC052274) and TAC17 (DDBJ LC052275) by one SNP (T/C at nt 134). TAC13 included an extra nt (G) at nt 508 (Fig. 4). As in TDD, both MITEs were inserted in the same site at nt 254 and created the same 9-bp host direct duplication (HDD) (TTAAAAACC) in the ILs (Figs. 5, 6). In the large MITE (222-bp), TAC1 (DDBJ LC052276) differed from TDD (GenBank AY616458), TAC13 (DDBJ LC052277) and TAC17 (DDBJ LC052278) by one SNP at nt 195 (T/G), and TAC17 differed from the others by one SNP at nt 199 (T/C) and the insertion of one nt (T) at nt 171 (Fig. 5). In the small MITE (131-bp), TAC1, TAC13 and TAC17 (DDBJ LC052279, LC052280, LC052281, respectively) differed from TDD (GenBank AY616459) by the insertion of one nt (C) at nt 30 and the deletion of one nt (T) at nt 143 (Fig. 6). As in TDD, the small MITE differed from the large MITE by one deletion of 91-bp starting at nt 73.
Fig. 3

Schematic diagram of the difference between the promoter region of Chinese Spring (CS, 713-bp), Triple Dirck D (TDD, 944-bp) and chromosome introgression lines (IL, 944 and 853-bp) with the insertion of the large (222-bp) and small (131-bp) MITEs. The positions of the host direct duplication sequence (TTAAAAACC), CArG- box, and start codon (ATG) were indicated.

Fig. 4

A section of sequence alignment showing the differences between CS, introgression lines (TAC1, TAC13 and TAC17) and TDD in the promoter of Vrn-A1 amplified by the primer pair VRN1AF–VRN1-INT1R.

Fig. 5

Sequence alignment of the large MITE (222-bp) in the promoter region of TAC1, TAC13, TAC17 and TDD amplified by the primer pair INS-7-F–INS-7-R. The host direct duplication (HDD) is highlighted in grey.

Fig. 6

Sequence alignment of the small MITE (131-bp) in the promoter region of TAC1, TAC13, TAC17 and TDD amplified by the primer pair INS-7-F–INS-7-R. The host direct duplication (HDD) is highlighted in grey. The 91-bp deletion is indicated by dashes.

Discussion

The spring alleles of the Vrn genes are epistatic to the winter alleles (Pugsley 1972), and the winter growth habit occurs only when all vernalization genes have recessive alleles. The Vrn-A1a allele is the most potent allele for promoting a spring growth habit and eliminates vernalization, whereas Vrn-B1 and Vrn-D1 only partially eliminate the requirement (Pugsley 1972). This confirms that CS has a vernalization requirement that has to be met before becoming competent to flower: allelic composition analysis using specific markers indicated that CS had the recessive alleles vrn-A1 and vrn-B1 and the dominant allele Vrn-D1, whereas TAC1, TAC13 and TAC17 had Vrn-A1 in addition to vrn-B1 and Vrn-D1. Yan characterized the dominant Vrn-A1a allele and showed that it differs from the recessive allele by the insertion of 222- and 131-bp MITEs in the promoter region. Molecular analyses revealed that all three ILs have the same insertions in the promoter region of Vrn-A1. The segregation of the winter/spring alleles in the F2 population in the 1 : 2 : 1 Mendelian ratio indicated that the insertion is due to genetic factors in the wheat genome, and that early flowering is not due to the effect of the alien chromosome introgressions. In Sudan, the wheat season is short and warm (day length, 11–12 h), especially in central Sudan (18°N to 22°N), whereas in Japan it is longer and colder (day length, 9–14 h). In Japan, wheat crops benefit from a long and cold winter, with heading at the end of winter or the beginning of spring. Winter wheat (which requires vernalization for ear emergence) is not grown in Sudan due to the warm temperatures, whereas it can grow in Japan and reach its maximum yield potential. In Japan, TAC1 and TAC13 flowered nearly at the same time as their background CS genotype, but in Sudan, TAC1 and TAC13 flowered significantly earlier while TAC17 flowered significantly later. CS requires some vernalization to become competent to flower, as it has only the dominant allele Vrn-D1; this could explain the nearly identical flowering times of all the lines in Japan, where the vernalization requirement is met, and the late flowering of CS in Sudan, where it could not be met. On the other hand, the early flowering of TAC1 and TAC13 in Sudan and in the growth chamber and the early flowering of TAC17 in the growth chamber, as well as the higher expression of Vrn-A1 in the ILs than in CS indicated that their vernalization requirement has been eliminated: they have the same photoperiod response alleles as CS (Ppd-B1). We attribute the early flowering of TAC1 and TAC13 to the effect of the insertion of the MITE at Vrn-A1. The same insertion was detected in TAC17, but this line showed delayed flowering in Sudan and Japan under field conditions and early flowering in the growth chamber under long-day conditions; this difference reflects the absence of chromosome 2B (which harbours Ppd-B1) in TAC17 and its replacement by chromosome 2Lr#1 of L. racemosus (Qi ). These results demonstrated that the early flowering of the two addition lines and the substitution line results from the elimination of the vernalization requirement by the presence of MITE at Vrn-A1, and consequently the presence of the Vrn-A1a allele. Analysis with MITE specific primers suggested that the inserted MITE originated from the wheat genome. This insertion might be stimulated by the presence of the alien chromosome. However, we found differences (SNPs) in the promoter region of Vrn-A1 between CS and the ILs (Fig. 4). The observed differences in the promoter sequences between the ILs suggest that those insertions are independent events and that those lines were developed independently; TAC1 was produced independently in Japan (Kishii ), whereas TAC13 and TAC17 were produced in China (Qi ). However, the structure of the insertions is same among these lines (two insertions and identical insertion sites). This fact clearly indicates that the insertion events were not accidental but directed by an unknown genetic mechanism. The alien chromosomes of TAC1 and TAC17 belong to homoeologous group 2, even though these lines were produced independently in Japan and China. The alien chromosome of TAC13 belongs to homoeologous group 5. These facts suggest that a specific alien chromosome was not the trigger of the insertions. Interestingly, we tested addition line TAC12 produced independently in China with alien chromosome belong to homoeologous group 2 same as TAC1 and found that it has the insertion of the MITEs in its Vrn-A1 promoter. We found that the MITE inserted in a GC-rich region in the same position as in TDD. A member of the MITE family also inserted in GC-rich region in Vrn-G1 (Yu ), and the 5.6 kb retrotransposon element (Retrotrans-VRN) (Chu ) inserted in Vrn-B1 at exactly the same site as Vrn-G1, although the target site duplications (TSDs) were different in the three insertions (Yu ). The different MITE and transposon inserted in Vrn1 genes in GC-rich region upstream from the ATG start codon (Yu ), which is a characteristics of MITE and transposon element insertion preference (Ferguson et al. 2011). Yan reported that spring Anza isogenic line had an insertion of 43-bp MITE in place of the 222-bp MITE with the same insertion site and a 9-bp HDD. These reports indicated clearly that transposon insertion is abundant in the Vrn1 gene, and it plays a key role in the evolution of the spring wheat from the winter type. Yu found 28 sequences in the entire wheat genome having similar sequences in the complete MITE region and inserted with different host direct duplications of 3 to 7-bp sequences. In addition, they found MITE sequences in seven EST accessions inserted with the same host direct repeat (ATGCCAGTG). These findings suggest the high mobility activity of MITE and its potential impact on the evolution of the wheat genome. The results indicated that ILs had two copies of the promotor; the first one with 222-bp inserted MITE and the second with 131-bp MITE. Our results (Golovnina ) and Yan could not explain how the insertion and duplication happened simultaneously. However, there are two different possible scenarios to explain the phenomenon; (1) MITE_VRN first inserted into the vrn-A1 promoter then the promoter duplicated but lost part of the MITE during the duplication and (2) CS has two copies of vrn-A1, and the two MITEs of different lengths inserted respectively into the two vrn-A1 gene. We think that the first scenario is likely the correct one, as CS has only one copy of vrn-A1 (Diaz ). Further experiment needed to clarify the insertion of the MITE and the duplication of the vrn-A1 promoter. Genomic reorganizations and modifications are common in plants and include structural rearrangements in chromosomes (Leitch and Bennett 1997) and sequences (Song , Wendel ), changes in gene expression (Comai , Kashkush ) and activation of transposons (Kashkush , 2003). McClintock, more than 50 years ago, built her famous theory (McClintock’s Genome Shock Theory) (McClintock 1984) based on observation of maize kernels color patterns. She concluded that the host genomes acquire genetic variability by transpositions of TEs and through other structural modifications of the chromosomes when the organisms meet stressful conditions, such as tissue culture, pathogen attack, and interspecific crossing. Recently, Hegarty and Hiscock (2005) and Baack and Rieseberg (2007) revealed that hybridization leads to rapid genomic changes, including chromosomal rearrangements, genome expansion, differential gene expression, and gene silencing. In rice, an active miniature inverted-repeat transposable element (mPing) has been isolated (Jiang , Kikuchi , Nakazaki ). It has been reported that the transposition of mPing is activated by stress conditions, such as cell culture (Jiang , Kikuchi ), gamma-ray irradiation (Nakazaki ), high hydrostatic pressure (Lin ), and by introgression of wild rice (Shan , Yasuda ). The ILs used in this study had alien chromosomes added to the wheat genome, and therefore, some genetic changes might have taken place during the maintenance of these lines. It is worth noting that Fu found monosomic wheat–rye addition lines showing different and drastic genetic or epigenetic variations that might not have been caused by the introgression of rye chromatins into wheat. These findings indicated clearly that introgression of the chromosomes of wild species could promote genetic changes, and therefore, support our hypothesis that this insertion occurred due to a genetic event directed by the presence of the alien chromosome during the maintenance of these ILs. However, more indepth analysis is needed to elucidate our hypothesis, especially in points that MITE_VRN is a non-autonomous element without any open reading frame, and that its transposition should depend on a transposase of a related autonomous elements. Tetraploid wheat has approximately 375 copies of MITE in the genome (Yan ), and hexaploid wheat has approximately 28 copies of MITE in the genome (Yu ). This suggests an abundance of the MITE sequence in the wheat genome and their potential exploitation in wheat genetics and breeding. Most of the wild Triticeae species have a winter growth habit, suggesting that the recessive vrn-1 allele was the common ancestral feature (Goncharov 1998). Golovnina studied the molecular variability of the wheat Vrn-1 promoter region in diploid, tetraploid and hexaploid wheat accessions to clarify the complicated molecular basis of spring vs. winter growth habit. These authors concluded that DNA transposon insertions first occurred in polyploid species with the promoter region of their A genomes being the site of duplication. Yan further reported that the duplication of the promoter region and the insertion of the MITEs were found only in hexaploid wheat. Based on these reports and the results of our study, we conclude that the insertion of the MITE and the duplication of the promoter region in spring wheat might be due to polyploidization and occurred after the addition of the diploid DD genome to the tetraploid AABB genome. Our results also indicated that not only are the addition lines important genetic resources for wheat breeding because they contain alien chromosomes from wild species, but also that the presence of alien chromosomes in the wheat genome could promote new genetic diversity which could be utilized for wheat improvement. Furthermore, elucidation of MITE activity in the wheat genome will have many potential applications in wheat genetics and breeding including gene tagging, gene isolation and gene knockouts.
  32 in total

1.  Transcriptional activation of retrotransposons alters the expression of adjacent genes in wheat.

Authors:  Khalil Kashkush; Moshe Feldman; Avraham A Levy
Journal:  Nat Genet       Date:  2002-12-16       Impact factor: 38.330

2.  The significance of responses of the genome to challenge.

Authors:  B McClintock
Journal:  Science       Date:  1984-11-16       Impact factor: 47.728

Review 3.  A genomic view of introgression and hybrid speciation.

Authors:  Eric J Baack; Loren H Rieseberg
Journal:  Curr Opin Genet Dev       Date:  2007-10-22       Impact factor: 5.578

4.  Rapid genome change in synthetic polyploids of Brassica and its implications for polyploid evolution.

Authors:  K Song; P Lu; K Tang; T C Osborn
Journal:  Proc Natl Acad Sci U S A       Date:  1995-08-15       Impact factor: 11.205

Review 5.  Hybrid speciation in plants: new insights from molecular studies.

Authors:  Matthew J Hegarty; Simon J Hiscock
Journal:  New Phytol       Date:  2005-02       Impact factor: 10.151

6.  Candidate gene identification of an aluminum-activated organic acid transporter gene at the Alt4 locus for aluminum tolerance in rye (Secale cereale L.).

Authors:  G Fontecha; J Silva-Navas; C Benito; M A Mestres; F J Espino; M V Hernández-Riquer; F J Gallego
Journal:  Theor Appl Genet       Date:  2006-10-25       Impact factor: 5.699

7.  HvVRN2 responds to daylength, whereas HvVRN1 is regulated by vernalization and developmental status.

Authors:  Ben Trevaskis; Megan N Hemming; W James Peacock; Elizabeth S Dennis
Journal:  Plant Physiol       Date:  2006-02-24       Impact factor: 8.340

8.  The plant MITE mPing is mobilized in anther culture.

Authors:  Kazuhiro Kikuchi; Kazuki Terauchi; Masamitsu Wada; Hiro-Yuki Hirano
Journal:  Nature       Date:  2003-01-09       Impact factor: 49.962

9.  The wheat VRN2 gene is a flowering repressor down-regulated by vernalization.

Authors:  Liuling Yan; Artem Loukoianov; Ann Blechl; Gabriela Tranquilli; Wusirika Ramakrishna; Phillip SanMiguel; Jeffrey L Bennetzen; Viviana Echenique; Jorge Dubcovsky
Journal:  Science       Date:  2004-03-12       Impact factor: 47.728

10.  Vernalization requirement duration in winter wheat is controlled by TaVRN-A1 at the protein level.

Authors:  Genqiao Li; Ming Yu; Tilin Fang; Shuanghe Cao; Brett F Carver; Liuling Yan
Journal:  Plant J       Date:  2013-10-14       Impact factor: 6.417

View more
  4 in total

1.  Efficient anchoring of alien chromosome segments introgressed into bread wheat by new Leymus racemosus genome-based markers.

Authors:  Offiong Ukpong Edet; June-Sik Kim; Masanori Okamoto; Kousuke Hanada; Tomoyuki Takeda; Masahiro Kishii; Yasir Serag Alnor Gorafi; Hisashi Tsujimoto
Journal:  BMC Genet       Date:  2018-03-27       Impact factor: 2.797

2.  TaMOR is essential for root initiation and improvement of root system architecture in wheat.

Authors:  Chaonan Li; Jingyi Wang; Long Li; Jialu Li; Mengjia Zhuang; Bo Li; Qiaoru Li; Junfang Huang; Yan Du; Jinping Wang; Zipei Fan; Xinguo Mao; Ruilian Jing
Journal:  Plant Biotechnol J       Date:  2021-12-24       Impact factor: 13.263

3.  Exploiting the miniature inverted-repeat transposable elements insertion polymorphisms as an efficient DNA marker system for genome analysis and evolutionary studies in wheat and related species.

Authors:  Benjamin Ewa Ubi; Yasir Serag Alnor Gorafi; Beery Yaakov; Yuki Monden; Khalil Kashkush; Hisashi Tsujimoto
Journal:  Front Plant Sci       Date:  2022-09-02       Impact factor: 6.627

4.  Molecular Cytogenetic Characterization of New Wheat-Dasypyrum breviaristatum Introgression Lines for Improving Grain Quality of Wheat.

Authors:  Hongjin Wang; Hongjun Zhang; Bin Li; Zhihui Yu; Guangrong Li; Jie Zhang; Zujun Yang
Journal:  Front Plant Sci       Date:  2018-03-19       Impact factor: 5.753

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.