Literature DB >> 27144107

Development and characterization of microsatellite primers in the federally endangered Astragalus bibullatus (Fabaceae).

Ashley B Morris1, Cassandra Scalf1, Austin Burleyson1, La Tonya Johnson1, Kevin Trostel1.   

Abstract

PREMISE OF THE STUDY: Microsatellites were developed for Astragalus bibullatus (Fabaceae), a federally endangered narrow endemic, to investigate reproductive ecology and species boundaries among closely related taxa. METHODS AND
RESULTS: Next-generation sequencing was used to develop 12 nuclear microsatellite loci that amplify in A. bibullatus, as well as in A. crassicarpus var. trichocalyx, A. gypsodes, and A. tennesseensis. Identified loci were di- and trinucleotide repeats, with 1-15 alleles per locus. Observed and expected heterozygosities ranged from 0.000-0.938 and 0.000-0.860, respectively. Cross-amplification of three loci previously published in A. michauxii was also confirmed for the taxa included here.
CONCLUSIONS: These data indicate the utility of novel microsatellite loci for conservation genetics and reproductive ecology in closely related Astragalus species.

Entities:  

Keywords:  Astragalus bibullatus; Astragalus sect. Sarcocarpi; Fabaceae; cedar glades; conservation genetics

Year:  2016        PMID: 27144107      PMCID: PMC4850055          DOI: 10.3732/apps.1500126

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Astragalus bibullatus Barneby & E. L. Bridges (Fabaceae; Pyne’s ground plum) is a herbaceous perennial endemic to the limestone cedar glades of the Central Basin of Middle Tennessee (Barneby and Bridges, 1987). It is a federally endangered species, known only from eight extant locations in Rutherford County (U.S. Fish and Wildlife Service, 2011). Previous studies using allozymes (Baskauf and Snapp, 1998; Morris et al., 2002) and amplified fragment length polymorphisms (AFLPs) (Baskauf and Burke, 2009) to investigate population structure have found limited genetic diversification among sites. Demographic studies have shown that population sizes fluctuate, in some cases dramatically, from year to year (U.S. Fish and Wildlife Service, 2011). More importantly, seed recruitment and fertility appear to vary by site (Albrecht, 2011). The genetic consequences of these combined factors (long-lived, genetically diverse seed bank, fluctuating population sizes, and differential recruitment success) have yet to be evaluated. Many recognize nuclear microsatellites as the preferred molecular approach for ecological and conservation genetic studies, due to their highly variable, codominant nature (Selkoe and Toonen, 2006). The greatest disadvantage to microsatellites is likely the need for prerequisite knowledge of the genome of the target species, as amplification primers are designed to match a specific location within the genome, unlike AFLPs, random-amplified polymorphic DNA (RAPDs), and intersimple sequence repeats (ISSRs) (Selkoe and Toonen, 2006). Here we present a suite of novel nuclear microsatellite loci in A. bibullatus, developed using next-generation sequencing (Davey et al., 2011; Ekblom and Galindo, 2011; Zalapa et al., 2012) on an Illumina platform. The resulting loci will be useful in long-term conservation studies of the target taxon, as well as in broader taxonomic studies of closely related taxa. In addition, the methodological approach used here provides a relatively straightforward workflow for the user new to microsatellite development and characterization, regardless of study system.

METHODS AND RESULTS

Total genomic DNA of a single individual of A. bibullatus collected from a natural population by Carol Baskauf (Austin Peay State University, Clarksville, Tennessee, USA) was extracted using the QIAGEN DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA). The sample was submitted to the Evolutionary Genetics Core Facility (EGCF) at Cornell University (Ithaca, New York, USA) to generate and then sequence an enriched genomic library using an Illumina MiSeq platform (San Diego, California, USA) to target di-, tri-, tetra-, penta-, and hexameric microsatellite repeats (Andrés and Bogdanowicz, 2011). EGCF supplied files containing more than 3000 possible primer pairs, which were identified in MSATCOMMANDER 1.0.3 (Rozen and Skaletsky, 1999; Faircloth, 2008). We selected 46 primer pairs for our initial screen, with an emphasis on tri- and dinucleotide repeat motifs. Repeat counts of targeted loci ranged from five to 15, and targets were chosen with an effort to diversify the motifs selected. Contigs of selected targets were aligned and compared to verify that all loci were unique. All PCR reactions were three-primer reactions following Schuelke (2000). A 17-base tail (5′-GTAAAACGACGGCCAGT-3′) was added to the 5′ end of each forward primer; a 7-base PIG-tail (5′-GTTTCTT-3′) was added to the 5′ end of each reverse primer. A third primer identical to the tail on the forward primer was fluorescently labeled with one of three standard tags (FAM, VIC, or NED). Loci were initially screened in singleplex using eight individuals from two natural populations, with reactions having the following final concentrations: 1× Platinum Taq Buffer, 2 mM MgCl2, 200 nM total dNTPs, 0.15 μM fluorescently labeled primer, 0.05 μM forward primer, 0.2 μM reverse primer, and 1 unit of Platinum Taq DNA Polymerase (Invitrogen by Life Technologies, Grand Island, New York, USA). A touchdown cycling profile was used for all amplifications: six cycles of 95°C for 45 s, followed by annealing at 61°C (dropping one degree per cycle) for 45 s, and 72°C for 1 min; the remaining 29 cycles consisted of 95°C for 40 s, 55°C for 45 s, and 72°C for 1 min. All loci were initially run in singleplex on an ABI 3130xl DNA Analyzer at Middle Tennessee State University using a GeneScan 500 LIZ Size Standard (Applied Biosystems by Life Technologies, Grand Island, New York, USA). Traces were analyzed in GeneMarker MTP 2.6.0 (SoftGenetics, State College, Pennsylvania, USA). Following this initial screen, 12 loci were selected for further data collection based on clarity of amplification and ease of scoring from the initial eight samples. Additional samples were selected from three reintroduction sites (Couchville, Stones River National Battlefield [SRNB] Glade 7, and SRNB Glade 54), which originated from multiple natural seed source populations in Rutherford County, Tennessee, and therefore, likely represent the range of diversity expected in this endangered species. All three sites are in Rutherford County, Tennessee. Locality data are not reported here and population vouchers were not collected due to the sensitive nature of ongoing recovery efforts. A total of 109 individuals were genotyped at all loci following the same protocol as above, pooling two to three loci where possible as determined by allele size range. In addition, all loci were tested for cross-amplification in A. crassicarpus Nutt. var. trichocalyx (Nutt.) Barneby (n = 9), A. gypsodes Barneby (n = 2; TEX201642, TEX201643), and A. tennesseensis A. Gray ex Chapm. (n = 5) using the same parameters and strategies described above. Additional locality data are not reported here and population vouchers were not collected for A. crassicarpus var. trichocalyx or A. tennesseensis, due to both species being of conservation concern. Sequences on which primers were designed were deposited in GenBank (Table 1). A total of 12 novel loci were identified as polymorphic in the A. bibullatus samples included in this study. GenAlEx 6.502 (Peakall and Smouse, 2012) was used to calculate the number of alleles per locus and expected and observed heterozygosity by population (Table 2). The number of alleles per locus per population ranged from one to 15, with observed heterozygosity ranging from 0.000 (Abib120 exhibited a single allele within A. bibullatus) to 0.938, and expected heterozygosity ranging from 0.000 to 0.860. All loci successfully cross-amplified and were polymorphic in A. crassicarpus var. trichocalyx, A. gypsodes, and A. tennesseensis. Seven recently published loci (AM_15, AM_18, AM_25, AM_29, AM_34, AM_46, and AM_71) developed for A. michauxii (Kuntze) F. J. Herm. (Fabaceae; Wall et al., 2014) were also tested for amplification in all species included here. Of these, three successfully amplified (AM_15, AM_46, AM_71) in all species, except AM_71, which did not amplify in A. tennesseensis.
Table 1.

Characterization of novel nuclear microsatellite loci developed for the federally endangered legume Astragalus bibullatus (Pyne’s ground plum).

LocusPrimer sequences (5′–3′)Repeat motifAllele size (bp)GenBank accession no.
Abib028F: ACCAGCGAATAGTGCTTACGTG(AAC)5212KT905411
R: CTGTAGCCATTGAAGGAACCAC
Abib051F: AGTCTGTACATTGCGAACTCAAC(AG)6170KT905412
R: AGTCTGTACATTGCGAACTCAAC
Abib059F: CATTTCTTGTAACGCCAGAAACG(AAC)7342KT905413
R: GATGAGTTGTGAAGAAGACTGGG
Abib083F: AATCTCAGAGGCATAGAGGGTAG(AC)9197KT905414
R: TGAAATAGGAGATGATTATGGCCC
Abib093F: ACTTATCCTCTCACTCCAACCTC(AAG)5343KT905415
R: CTCAACTCTCTGCCACTTGAATC
Abib094F: AGATCCAAAGTTTGCCATCCATC(AG)8186KT905416
R: TTCCTTCACTTCCGCCATTAATG
Abib095F: CAGGCATGCAAATGGGATAATTG(AG)9215KT905417
R: TAATCACATTCTCTCATGCACGC
Abib113F: CTCTTCTCTCGAATCATCATCCC(AG)11228KT905418
R: CTCTATCCTCTACCACCGCTTC
Abib120F: TTCTTCATCAGTTGCTAAGCCAC(AGG)6267KT905419
R: TATACTTCAGAACGGTGAGGAGG
Abib152F: TGCTACCTACAATGCCACTATTG(AG)10235KT905420
R: TGCTTTAACTAGTGCTTTGTCAC
Abib156F: AAGTGTGTGCGGTGATTAGAAAG(AAG)6212KT905421
R: AAGTGTGTGCGGTGATTAGAAAG
Abib170F: ATTTGTCACCTTTCTCCACATGC(AAC)5350KT905422
R: ATTTGTCACCTTTCTCCACATGC
Table 2.

Genetic properties of the 12 newly developed microsatellites of Astragalus bibullatus.

Couchville (n = 71)Stones River 54 (n = 16)Stones River 7 (n = 22)
LocusAHoHeAHoHeAHoHe
Abib02820.8920.49420.9380.49820.9090.496
Abib051150.5540.77990.5000.830120.6360.860
Abib05960.5310.61150.8670.71150.6820.600
Abib08360.5970.68640.8750.65840.6670.672
Abib09330.2630.32520.2000.18020.1000.180
Abib09460.4930.53820.4670.46430.4740.566
Abib09540.4430.48530.1880.27140.5000.439
Abib11370.6760.65450.7500.57460.6820.613
Abib12010.0000.00010.0000.00010.0000.000
Abib15230.0140.04220.0630.06120.0450.044
Abib15630.4710.51730.6880.47130.7890.528
Abib17030.5000.50130.4380.42030.3500.401

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.

Because this is a federally endangered species, geographic coordinates are restricted. All three populations represent reintroductions and are located in Rutherford County, Tennessee, USA.

Characterization of novel nuclear microsatellite loci developed for the federally endangered legume Astragalus bibullatus (Pyne’s ground plum). Genetic properties of the 12 newly developed microsatellites of Astragalus bibullatus. Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled. Because this is a federally endangered species, geographic coordinates are restricted. All three populations represent reintroductions and are located in Rutherford County, Tennessee, USA.

CONCLUSIONS

The loci developed here for A. bibullatus are now being used to assess population genetic structure in complement to an ongoing demographic study of five natural populations in addition to the three reintroduction populations presented here. These data will be combined with long-term demographic data of monitored individuals to better understand the reproductive ecology of this system. Additionally, preliminary data indicate that at least some of the markers developed here exhibit private alleles among each of the congeners evaluated in this study, suggesting that these markers will be valuable tools in systematic and phylogeographic investigations of closely related Astragalus species.
  11 in total

1.  An economic method for the fluorescent labeling of PCR fragments.

Authors:  M Schuelke
Journal:  Nat Biotechnol       Date:  2000-02       Impact factor: 54.908

2.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

Review 3.  Using next-generation sequencing approaches to isolate simple sequence repeat (SSR) loci in the plant sciences.

Authors:  Juan E Zalapa; Hugo Cuevas; Huayu Zhu; Shawn Steffan; Douglas Senalik; Eric Zeldin; Brent McCown; Rebecca Harbut; Philipp Simon
Journal:  Am J Bot       Date:  2011-12-20       Impact factor: 3.844

4.  Isolating microsatellite loci: looking back, looking ahead.

Authors:  José A Andrés; Steven M Bogdanowicz
Journal:  Methods Mol Biol       Date:  2011

Review 5.  Applications of next generation sequencing in molecular ecology of non-model organisms.

Authors:  R Ekblom; J Galindo
Journal:  Heredity (Edinb)       Date:  2010-12-08       Impact factor: 3.821

6.  Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers.

Authors:  Kimberly A Selkoe; Robert J Toonen
Journal:  Ecol Lett       Date:  2006-05       Impact factor: 9.492

7.  Population genetics of Astragalus bibullatus (Fabaceae) using AFLPs.

Authors:  Carol J Baskauf; John M Burke
Journal:  J Hered       Date:  2009-06-03       Impact factor: 2.645

Review 8.  Genome-wide genetic marker discovery and genotyping using next-generation sequencing.

Authors:  John W Davey; Paul A Hohenlohe; Paul D Etter; Jason Q Boone; Julian M Catchen; Mark L Blaxter
Journal:  Nat Rev Genet       Date:  2011-06-17       Impact factor: 53.242

9.  Stratified analysis of the soil seed bank in the cedar glade endemic Astragalus bibullatus: evidence for historical changes in genetic structure.

Authors:  Ashley B Morris; Regina S Baucom; Mitchell B Cruzan
Journal:  Am J Bot       Date:  2002-01       Impact factor: 3.844

10.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

View more
  1 in total

1.  Development of SSR markers for Astragalus lehmannianus, a vulnerable species from northwestern China.

Authors:  Mingying Wu; Xiaojun Shi; Dunyan Tan
Journal:  Appl Plant Sci       Date:  2019-10-24       Impact factor: 1.936

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.