Kathleen L McCann1, Takamasa Teramoto2, Jun Zhang2, Traci M Tanaka Hall2, Susan J Baserga1,3,4. 1. Department of Genetics, Yale University School of Medicine, New Haven, United States. 2. Epigenetics and Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, United States. 3. Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, United States. 4. Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, United States.
Abstract
ANE syndrome is a ribosomopathy caused by a mutation in an RNA recognition motif of RBM28, a nucleolar protein conserved to yeast (Nop4). While patients with ANE syndrome have fewer mature ribosomes, it is unclear how this mutation disrupts ribosome assembly. Here we use yeast as a model system and show that the mutation confers growth and pre-rRNA processing defects. Recently, we found that Nop4 is a hub protein in the nucleolar large subunit (LSU) processome interactome. Here we demonstrate that the ANE syndrome mutation disrupts Nop4's hub function by abrogating several of Nop4's protein-protein interactions. Circular dichroism and NMR demonstrate that the ANE syndrome mutation in RRM3 of human RBM28 disrupts domain folding. We conclude that the ANE syndrome mutation generates defective protein folding which abrogates protein-protein interactions and causes faulty pre-LSU rRNA processing, thus revealing one aspect of the molecular basis of this human disease.
ANE syndrome is a ribosomopathy caused by a mutation in an RNA recognition motif of RBM28, a nucleolar protein conserved to yeast (Nop4). While patients with ANE syndrome have fewer mature ribosomes, it is unclear how this mutation disrupts ribosome assembly. Here we use yeast as a model system and show that the mutation confers growth and pre-rRNA processing defects. Recently, we found that Nop4 is a hub protein in the nucleolar large subunit (LSU) processome interactome. Here we demonstrate that the ANE syndrome mutation disrupts Nop4's hub function by abrogating several of Nop4's protein-protein interactions. Circular dichroism and NMR demonstrate that the ANE syndrome mutation in RRM3 of humanRBM28 disrupts domain folding. We conclude that the ANE syndrome mutation generates defective protein folding which abrogates protein-protein interactions and causes faulty pre-LSU rRNA processing, thus revealing one aspect of the molecular basis of this human disease.
Ribosomes are essential for life. The fundamental cellular process of ribosome assembly requires the coordinated action of all three RNA polymerases, over 200 biogenesis factors, and a number of small nucleolar RNAs (Thomson et al., 2013; Woolford and Baserga, 2013; Fernández-Pevida et al., 2015). In yeast, ribosome biogenesis initiates in the nucleolus with the transcription of the 35S polycistronic pre-ribosomal RNA (rRNA) precursor by RNA polymerase I. The 35S pre-rRNA undergoes a number of cleavage and modification events to give rise to the mature 18S, 5.8S and 25S rRNAs. Mutations that partially disrupt ribosome assembly or function are often deleterious and can lead to disease in humans. Collectively, these diseases of ribosome biogenesis are called ribosomopathies. Ribosomopathies are caused by mutations in proteins that function in all stages of ribosome assembly (McCann and Baserga, 2013; Armistead and Triggs-Raine, 2014).A homozygous missense mutation in the nucleolar protein RBM28 causes the ribosomopathy, alopecia, neurological defects and endocrinopathy (ANE) syndrome (Nousbeck et al., 2008). Five affected children of a consanguineous kindred displayed degrees of baldness, mental retardation, motor deterioration, and reduced pituitary gland function in their second decade of life (Nousbeck et al., 2008; Warshauer et al., 2015). The mutation segregated in the family in an autosomal recessive manner and was mapped to a single leucine to proline amino acid substitution at position 351 (L351P) of RBM28. This residue resides in the first α-helix of its third RNA recognition motif (RRM3; Figure 1A, Figure 1—figure supplement 1). ANE syndrome was classified as a ribosomopathy because RBM28 is localized to the nucleolus and because patient fibroblasts showed reduced numbers of ribosomes (Damianov et al., 2006; Nousbeck et al., 2008). While the L351P mutation is predicted to disrupt the first α-helix of RRM3 and thereby impair RBM28 function, it is not known how this single amino acid substitution disrupts the normal function of RBM28 in the nucleolus. Specifically, what is the molecular basis of ANE syndrome pathogenesis?
Figure 1.
The ANE syndrome mutation confers a growth defect in yeast.
(A) The leucine that is mutated in ANE syndrome is highly conserved. Top: Diagram of the domain structure for human RBM28 and its yeast ortholog, Nop4. The boxes represent RNA Recognition Motifs (RRMs). Arrowheads indicate the approximate location of the mutated amino acid, L351P in humans and L306P in yeast. Bottom: Multiple sequence alignment of the portion of RRM3 containing the mutated leucine. Shaded amino acids in are conserved. A box outlines the conserved leucine that is mutated in ANE syndrome. (B) Schematic of the yeast strain used for testing the ANE syndrome mutation in Nop4. Endogenous Nop4 was placed under the control of the inducible GAL4 promoter in haploid yeast. FLAG-tagged unmutated Nop4 WT or Nop4 L306P was expressed constitutively from the p414GPD plasmid. (C) Nop4 WT and Nop4 L306P are expressed at equivalent levels from the yeast expression vector p414GPD-3xFLAG-GW. The depletion of endogenous Nop4 protein was confirmed by western blot using an HRP-conjugated monoclonal antibody against the 3xHA tag. Expression of Nop4 WT or Nop4 L306P from p414GPD-3xFLAG-GW was analyzed by western blot using a monoclonal antibody against the 3xFLAG tag. As a loading control, a western blot using α-Mpp10 was performed. The expression levels of Nop4 WT and Nop4 L306P relative to Mpp10 were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 L306P = 0.96. EV = empty vector. The arrows indicate the expected bands. The arrowhead indicates an Mpp10 species only observed when yeast are grown in galactose and raffinose. The asterisk denotes degradation. (D) The ANE syndrome mutation in Nop4 impairs growth on solid medium. Serial dilutions of yeast expressing the indicated Nop4 constructs were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain. (E) The Nop4 ANE syndrome mutation impairs growth in liquid medium. Yeast expressing the indicated Nop4 constructs were transferred from SG/R-Trp to SD-Trp and 23°C to deplete the endogenous Nop4. Growth was monitored for 48 hr by measuring the absorbance at OD600. The log2 of the OD600 was plotted over time and the slope was used to estimate the doubling time. Four biological replicates were performed starting with transformation of the plasmids into the yeast strain.
DOI:
http://dx.doi.org/10.7554/eLife.16381.003
The amino acids corresponding to RRM3 from human RBM28, yeast Nop4 and RBM28 from M. mulatta, M. musculus, X. tropicalis and D. rerio were aligned. The conserved structural elements of a canonical RRM are indicated above the alignment. The shaded amino acids are conserved. The conserved leucine that is mutated in ANE syndrome is outlined with a box.
DOI:
http://dx.doi.org/10.7554/eLife.16381.004
(A) Nop4 and RBM28 are expressed from the yeast expression vector p414GPD-3xFLAG-GW. Expression of Nop4 (78 kDa) or RBM28 (86 kDa) from p414GPD-3xFLAG-GW was analyzed by western blot using a monoclonal antibody against the 3xFLAG tag. As a loading control, a western blot using α-Mpp10 was performed. The arrowhead indicates an Mpp10 species only observed when yeast are grown in galactose and raffinose. The expression levels of Nop4 and RBM28 relative to Mpp10 were quantitated and normalized to Nop4: Nop4 = 1, RBM28 = 0.4. (B) RBM28 complements growth on solid medium. Serial dilutions of yeast expressing either Nop4 or RBM28 were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C.
DOI:
http://dx.doi.org/10.7554/eLife.16381.005
The complete amino acid alignment of human RBM28 protein and its yeast ortholog, Nop4, was created using ClustalX. The conserved leucine that is mutated to proline in ANE syndrome, L351 in RBM28 and L306 in Nop4, is circled in black. RRM domains are indicated by the labeled boxes. Below the alignment, the conservation score for each column is plotted. A high score indicates high conservation whereas a low score indicates low conservation.
DOI:
http://dx.doi.org/10.7554/eLife.16381.006
Figure 1—figure supplement 1.
Multiple sequence alignment of RRM3 from RBM28.
The amino acids corresponding to RRM3 from human RBM28, yeast Nop4 and RBM28 from M. mulatta, M. musculus, X. tropicalis and D. rerio were aligned. The conserved structural elements of a canonical RRM are indicated above the alignment. The shaded amino acids are conserved. The conserved leucine that is mutated in ANE syndrome is outlined with a box.
DOI:
http://dx.doi.org/10.7554/eLife.16381.004
The ANE syndrome mutation confers a growth defect in yeast.
(A) The leucine that is mutated in ANE syndrome is highly conserved. Top: Diagram of the domain structure for humanRBM28 and its yeast ortholog, Nop4. The boxes represent RNA Recognition Motifs (RRMs). Arrowheads indicate the approximate location of the mutated amino acid, L351P in humans and L306P in yeast. Bottom: Multiple sequence alignment of the portion of RRM3 containing the mutated leucine. Shaded amino acids in are conserved. A box outlines the conserved leucine that is mutated in ANE syndrome. (B) Schematic of the yeast strain used for testing the ANE syndrome mutation in Nop4. Endogenous Nop4 was placed under the control of the inducible GAL4 promoter in haploid yeast. FLAG-tagged unmutated Nop4 WT or Nop4 L306P was expressed constitutively from the p414GPD plasmid. (C) Nop4 WT and Nop4 L306P are expressed at equivalent levels from the yeastexpression vector p414GPD-3xFLAG-GW. The depletion of endogenous Nop4 protein was confirmed by western blot using an HRP-conjugated monoclonal antibody against the 3xHA tag. Expression of Nop4 WT or Nop4 L306P from p414GPD-3xFLAG-GW was analyzed by western blot using a monoclonal antibody against the 3xFLAG tag. As a loading control, a western blot using α-Mpp10 was performed. The expression levels of Nop4 WT and Nop4 L306P relative to Mpp10 were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 L306P = 0.96. EV = empty vector. The arrows indicate the expected bands. The arrowhead indicates an Mpp10 species only observed when yeast are grown in galactose and raffinose. The asterisk denotes degradation. (D) The ANE syndrome mutation in Nop4 impairs growth on solid medium. Serial dilutions of yeast expressing the indicated Nop4 constructs were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain. (E) The Nop4ANE syndrome mutation impairs growth in liquid medium. Yeast expressing the indicated Nop4 constructs were transferred from SG/R-Trp to SD-Trp and 23°C to deplete the endogenous Nop4. Growth was monitored for 48 hr by measuring the absorbance at OD600. The log2 of the OD600 was plotted over time and the slope was used to estimate the doubling time. Four biological replicates were performed starting with transformation of the plasmids into the yeast strain.DOI:
http://dx.doi.org/10.7554/eLife.16381.003
Multiple sequence alignment of RRM3 from RBM28.
The amino acids corresponding to RRM3 from humanRBM28, yeastNop4 and RBM28 from M. mulatta, M. musculus, X. tropicalis and D. rerio were aligned. The conserved structural elements of a canonical RRM are indicated above the alignment. The shaded amino acids are conserved. The conserved leucine that is mutated in ANE syndrome is outlined with a box.DOI:
http://dx.doi.org/10.7554/eLife.16381.004
RBM28 complements the growth defect in yeast observed upon depletion of its essential ortholog, Nop4.
(A) Nop4 and RBM28 are expressed from the yeastexpression vector p414GPD-3xFLAG-GW. Expression of Nop4 (78 kDa) or RBM28 (86 kDa) from p414GPD-3xFLAG-GW was analyzed by western blot using a monoclonal antibody against the 3xFLAG tag. As a loading control, a western blot using α-Mpp10 was performed. The arrowhead indicates an Mpp10 species only observed when yeast are grown in galactose and raffinose. The expression levels of Nop4 and RBM28 relative to Mpp10 were quantitated and normalized to Nop4: Nop4 = 1, RBM28 = 0.4. (B) RBM28 complements growth on solid medium. Serial dilutions of yeast expressing either Nop4 or RBM28 were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C.DOI:
http://dx.doi.org/10.7554/eLife.16381.005
Amino acid sequence alignment of human RBM28 and its yeast ortholog Nop4.
The complete amino acid alignment of humanRBM28 protein and its yeast ortholog, Nop4, was created using ClustalX. The conserved leucine that is mutated to proline in ANE syndrome, L351 in RBM28 and L306 in Nop4, is circled in black. RRM domains are indicated by the labeled boxes. Below the alignment, the conservation score for each column is plotted. A high score indicates high conservation whereas a low score indicates low conservation.DOI:
http://dx.doi.org/10.7554/eLife.16381.006Nop4, the yeast ortholog of RBM28, is required for assembly of the large ribosomal subunit (LSU; Bergès et al., 1994; Sun and Woolford, 1994; Nousbeck et al., 2008). Recently, the LSU processome interactome revealed that Nop4 functions as a hub protein, interacting with many more proteins than average within the LSU processome (McCann et al., 2015). We hypothesized that introduction of the orthologous ANE syndrome mutation into Nop4 (L306P) would disrupt Nop4’s function as a hub protein and therefore disrupt LSU assembly in the nucleolus.We demonstrate that introduction of the ANE syndrome mutation into Nop4 disrupts growth and pre-rRNA processing in yeast and abrogates several, but not all, of its protein-protein interactions. Surprisingly, the C-terminal half of Nop4, where the ANE syndrome mutation occurs, is necessary and sufficient for hub protein function, cell growth and pre-rRNA processing. Consistent with these findings, circular dichroism and NMR reveal that the ANE mutation in RRM3 of the Nop4human ortholog, RBM28, disrupts folding of the entire domain, not just the first α-helix. Together, these results suggest that the molecular basis of ANE syndrome lies in defective protein folding that reduces protein interactions and the function of RBM28 as a hub protein, resulting in pre-rRNA processing defects in the nucleolus.
Results
The ANE syndrome mutation in Nop4 causes growth defects in yeast
Our goal was to elucidate the molecular basis of the ribosomopathy ANE syndrome, which is attributed to a single amino acid substitution, L351P, in RBM28 (Nousbeck et al., 2008). HumanRBM28 can complement the growth defect in the yeast, Saccharomyces cerevisiae, when its ortholog, the essential Nop4 protein, is depleted (Figure 1—figure supplement 2; Kachroo et al., 2015). Therefore, we used yeast genetics to pinpoint the molecular basis of ANE syndrome. A ClustalX alignment of the yeastNop4 and humanRBM28 amino acid sequences permitted identification of the orthologous ANE syndrome mutation in Nop4 (Figure 1—figure supplement 3). Over their entire length, the amino acid sequences of Nop4 and RBM28 are ~26% identical and 34% similar, and both contain four RRMs (Figure 1A). The ANE syndrome mutation in humanRBM28, L351P, is within the third RRM. Inspection of the alignment revealed an orthologous leucine in the third RRM of yeastNop4, which we mutated to proline to introduce the ANE syndrome mutation into Nop4 (L306P; Figure 1A; Figure 1—figure supplement 1).
Figure 1—figure supplement 2.
RBM28 complements the growth defect in yeast observed upon depletion of its essential ortholog, Nop4.
(A) Nop4 and RBM28 are expressed from the yeast expression vector p414GPD-3xFLAG-GW. Expression of Nop4 (78 kDa) or RBM28 (86 kDa) from p414GPD-3xFLAG-GW was analyzed by western blot using a monoclonal antibody against the 3xFLAG tag. As a loading control, a western blot using α-Mpp10 was performed. The arrowhead indicates an Mpp10 species only observed when yeast are grown in galactose and raffinose. The expression levels of Nop4 and RBM28 relative to Mpp10 were quantitated and normalized to Nop4: Nop4 = 1, RBM28 = 0.4. (B) RBM28 complements growth on solid medium. Serial dilutions of yeast expressing either Nop4 or RBM28 were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C.
DOI:
http://dx.doi.org/10.7554/eLife.16381.005
Figure 1—figure supplement 3.
Amino acid sequence alignment of human RBM28 and its yeast ortholog Nop4.
The complete amino acid alignment of human RBM28 protein and its yeast ortholog, Nop4, was created using ClustalX. The conserved leucine that is mutated to proline in ANE syndrome, L351 in RBM28 and L306 in Nop4, is circled in black. RRM domains are indicated by the labeled boxes. Below the alignment, the conservation score for each column is plotted. A high score indicates high conservation whereas a low score indicates low conservation.
DOI:
http://dx.doi.org/10.7554/eLife.16381.006
We determined that the ANE syndrome mutation in Nop4 (L306P) impaired yeast growth. We generated a strain where endogenous NOP4 is under the control of a galactose-inducible, glucose-repressible promoter and tagged with a triple-HA epitope (Figure 1B). Unmutated (wild type; WT) Nop4 or Nop4 L306P protein is tagged with a triple-FLAG epitope and constitutively expressed from a plasmid (p414GPD). Western blotting of total protein demonstrated that after growth of this strain in glucose for 48 hr at 23°C, the endogenous Nop4 was reduced to undetectable levels and plasmid-borne Nop4 WT and Nop4 L306P were expressed at comparable levels (Figure 1C). Serial dilutions of strains bearing the plasmids: empty vector (EV), Nop4 WT and Nop4 L306P were spotted onto plates containing glucose and incubated at 30°C, 37°C, 23°C and 17°C. At all tested temperatures, depletion of Nop4 (EV) conferred a severe growth defect relative to growth of Nop4 WT (Figure 1D). The L306P mutation impaired growth at all temperatures tested compared to WT, although the defect was not as severe as that observed with the EV control (Figure 1D).To confirm our findings, we analyzed growth in liquid medium at 23°C and estimated the doubling time for each strain. Endogenous Nop4 was depleted and the growth of strains bearing the plasmids: EV, Nop4 WT or Nop4 L306P was monitored for 48 hr. Similar to growth on solid medium, Nop4 L306P exhibited a moderate growth defect in liquid culture, doubling every 7.8 hr, compared to WT, which doubled every 4.8 hr; however, the defect was not as severe as that observed with the EV control, which doubled every 20.5 hr (Figure 1E).
The ANE syndrome mutation causes pre-rRNA processing defects in yeast
The ANE syndrome mutation, L306P in yeastNop4, also disrupts pre-rRNA processing. As growth defects caused by mutation of a nucleolar protein are often indicative of ribosome biogenesis defects, we tested whether the growth defects conferred by Nop4 L306P were due to disruption of ribosome biogenesis. Previously, it has been shown that the mature 25S rRNA and the 27S and 7S pre-rRNA precursors are severely reduced in yeast depleted of Nop4 (Figure 2A; Bergès et al., 1994; Sun and Woolford, 1994). To determine whether Nop4 L306P similarly disrupts production of the 25S rRNA, total RNA was harvested from strains bearing plasmids expressing no Nop4 (empty vector; EV), Nop4 WT or Nop4 L306P and depleted of endogenous Nop4 for 0 and 48 hr. The 25S and 18S rRNAs were visualized by ethidium bromide staining, quantified and the ratio of 25S/18S, a measure of the relative levels of the mature rRNAs, was calculated and normalized to Nop4 WT for each time point (Figure 2B top panels). The observed decrease in the 25S/18S ratios correlated with the trend of the observed growth defects. The EV control, which had the most severe growth defect, also had the most severe reduction in 25S/18S ratio levels in comparison to Nop4 WT. Nop4 L306P conferred a moderate growth defect and a moderate, but statistically significant, reduction in the 25S/18S rRNA ratio (Figure 2C), consistent with reduced 25S levels.
Figure 2.
The ANE syndrome mutation disrupts pre-rRNA processing in yeast.
(A) Simplified diagram depicting the pre-rRNA processing steps in yeast. The pre-rRNA is transcribed as a 35S polycistronic precursor. The external transcribed spacers (5´ and 3´ ETS) and the internal transcribed spacers (ITS1 and 2) are removed through a number of cleavage steps to produce the mature 18S, 5.8S and 25S rRNAs. Oligonucleotide probe e, which is complementary to ITS2 and detects all 27S and 7S pre-rRNAs (indicated on top line), was used for northern blotting. (B) The ANE syndrome mutation in Nop4 impairs pre-rRNA processing in yeast. Top panel: Ethidium bromide staining of total RNA extracted from yeast expressing no Nop4 (empty vector; EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for the indicated time. Bottom panel: Northern blots of total RNA using radio-labeled oligonucleotide probe e to detect 35S, 27S, and 7S pre-rRNAs and an oligonucleotide probe complementary to Scr1 as a loading control. (C) The ratios of the mature rRNAs (25S/18S), the ratios of the precursors (27S/35S and 7S/35S) and the ratios of the precursors to the loading control Scr1 (35S/Scr1, 27S/Scr1 and 7S/Scr1) were calculated from four replicate experiments and were plotted with error bars representing the standard deviation. The significance of the ratios of Nop4 depleted yeast (empty vector; EV) or Nop4 L306P compared to WT was evaluated using one-way ANOVA. ****indicates a p value < 0.0001. ***indicates a p value < 0.001. **indicates a p value <0.01. NS = not significant. Four biological replicates were performed.
DOI:
http://dx.doi.org/10.7554/eLife.16381.007
DOI:
http://dx.doi.org/10.7554/eLife.16381.008
The ANE syndrome mutation disrupts pre-rRNA processing in yeast.
(A) Simplified diagram depicting the pre-rRNA processing steps in yeast. The pre-rRNA is transcribed as a 35S polycistronic precursor. The external transcribed spacers (5´ and 3´ ETS) and the internal transcribed spacers (ITS1 and 2) are removed through a number of cleavage steps to produce the mature 18S, 5.8S and 25S rRNAs. Oligonucleotide probe e, which is complementary to ITS2 and detects all 27S and 7S pre-rRNAs (indicated on top line), was used for northern blotting. (B) The ANE syndrome mutation in Nop4 impairs pre-rRNA processing in yeast. Top panel: Ethidium bromide staining of total RNA extracted from yeast expressing no Nop4 (empty vector; EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for the indicated time. Bottom panel: Northern blots of total RNA using radio-labeled oligonucleotide probe e to detect 35S, 27S, and 7S pre-rRNAs and an oligonucleotide probe complementary to Scr1 as a loading control. (C) The ratios of the mature rRNAs (25S/18S), the ratios of the precursors (27S/35S and 7S/35S) and the ratios of the precursors to the loading control Scr1 (35S/Scr1, 27S/Scr1 and 7S/Scr1) were calculated from four replicate experiments and were plotted with error bars representing the standard deviation. The significance of the ratios of Nop4 depleted yeast (empty vector; EV) or Nop4 L306P compared to WT was evaluated using one-way ANOVA. ****indicates a p value < 0.0001. ***indicates a p value < 0.001. **indicates a p value <0.01. NS = not significant. Four biological replicates were performed.DOI:
http://dx.doi.org/10.7554/eLife.16381.007
Quantitation and statistical analyses for Figure 2C.
DOI:
http://dx.doi.org/10.7554/eLife.16381.008Since the L306P mutation resulted in a reduction of the 25S/18S ratio, we determined whether the L306P mutation had an effect on pre-rRNA processing. Northern blot analysis of total RNA harvested from strains expressing no Nop4 (EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for 0 and 48 hr was performed using an oligonucleotide probe in ITS2 and an oligonucleotide probe against the loading control Scr1 (Figure 2A). The ratios of 27S/35S and 7S/35S pre-rRNAs as well as the ratios of the precursors to the loading control, Scr1, were quantified and normalized to Nop4 WT. Similar to the 25S/18S ratios, the pre-rRNA processing defects mirror the growth defects. Depletion of Nop4 (EV) resulted in a severe reduction of 27S and 7S levels, with a concomitant decrease in the 27S/35S, 7S/35S, 27S/Scr1 and 7S/Scr1 ratios, indicative of an ITS1 processing defect, as has been previously observed (Figure 2B,C; Bergès et al., 1994; Sun and Woolford, 1994). The Nop4 L306P mutant showed an intermediate growth defect and also displayed an intermediate, but statistically significant, ITS1 processing defect as indicated by reduced 27S/35S, 7S/35S and 7S/Scr1 ratios (Figure 2B,C).
The ANE syndrome mutation disrupts Nop4 protein-protein interactions
As the LSU processome interactome revealed that Nop4 functions as a hub protein (McCann et al., 2015), we tested whether the ANE mutation in Nop4 abrogates protein-protein interactions using a directed yeast two-hybrid (Y2H) assay (Figure 3A). Nop4 WT and Nop4 L306P were expressed at comparable levels as prey fusion proteins from the Y2H vector, pACT2, in PJ69-4α (Figure 3B). Yeast expressing either of these prey proteins or no Nop4 (empty vector; EV) were co-transformed with the Y2H bait vector, pAS2-1, encoding 5 Nop4-interacting proteins (Table 1; McCann et al., 2015), including Nop4 itself, and tested for interaction by serial dilution on the indicated selective medium (Figure 3C).
Figure 3.
The ANE syndrome mutation in Nop4 disrupts protein-protein interactions.
(A) Schematic of Y2H analysis. Nop4 WT or Nop4 L306P were cloned into the prey vector (pACT2) while five Nop4 interacting proteins (Noc2, Mak5, Nop4, Nsa2 and Dbp10) were cloned into the bait vector (pAS2-1). Each bait was individually co-transformed into the yeast strain PJ69-α with empty vector (EV), Nop4 WT or Nop4 L306P prey and spotted onto medium to confirm the presence of both Y2H plasmids (SD-Leu-Trp) and onto medium to test for protein-protein interactions (SD-Leu-Trp-His + 6 mM 3-AT). (B) Nop4 WT and Nop4 L306P are expressed at equivalent levels from the Y2H vector pACT2. Total protein was extracted from PJ69-4α yeast transformed with EV or expressing Nop4 WT or Nop4 L306P from the Y2H prey vector, pACT2. Nop4 WT and Nop4 L306P are expressed as fusions with the GAL4 activation domain and a 3xHA tag. Protein extracts were separated by SDS-PAGE and analyzed by α-HA western blot. As a loading control, a western blot using α-Mpp10 was performed. The expression levels of Nop4 WT and Nop4 L306P relative to Mpp10 were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 L306P = 1.1 (C) Y2H analysis by serial dilution reveals that the ANE syndrome (L306P) mutation disrupts some Nop4 protein-protein interactions. Two biological replicates of a subset of interacting proteins were performed starting with co-transformation of the bait and prey plasmids into the Y2H strain. (D) The ANE syndrome (L306P) mutation reduces protein-protein interactions as determined by co-immunoprecipitation. Yeast extract was generated from yeast expressing either Nop4 WT or Nop4 L306P and one of its interacting partners and incubated with α-FLAG resin. Co-immunoprecipitations were assessed by α-HA western blot. The expected molecular weights of the Nop4 interacting proteins are: Dbp10 = 113 kDa, Mak5 = 87 kDa, Noc2 = 82 kDa, Nop4 = 78 kDa and Nsa2 = 30 kDa. (E) The ratio of co-purified 3xFLAG tagged Nop4 WT or Nop4 L306P to co-immunoprecipitated 3xHA tagged interacting partner was calculated from three replicate experiments and plotted with error bars representing the standard deviation. The significance of the co-immunoprecipitation ratio of Nop4 L306P compared to WT for each interacting partner was evaluated using a t-test. ****indicates a p value < 0.0001. ***indicates a p value < 0.001. **indicates a p value <0.01. NS = not significant. Three biological replicates were performed.
DOI:
http://dx.doi.org/10.7554/eLife.16381.009
DOI:
http://dx.doi.org/10.7554/eLife.16381.010
Table 1.
Nop4 interacts with 23 large subunit assembly factors with high confidence. The Nop4 interacting proteins were identified by yeast two-hybrid and were assigned a confidence score in (McCann et al., 2015).
DOI:
http://dx.doi.org/10.7554/eLife.16381.011
Nop4 Interacting Partner
Confidence Score (from McCann et al., 2015)
Nop4
92%
Loc1
92%
Ebp2
85%
Nop12
85%
Nsa2
85%
Mak5
84%
Cgr1
70%
Cic1
70%
Has1
70%
Noc2
70%
Nop13
70%
Nsr1
70%
Rrp12
70%
Rrp14
70%
Mak21
68%
Dbp10
63%
Drs1
63%
Nop16
63%
Nug1
63%
Prp43
63%
Spb4
63%
Tma16
63%
Nog1
53%
The ANE syndrome mutation in Nop4 disrupts protein-protein interactions.
(A) Schematic of Y2H analysis. Nop4 WT or Nop4 L306P were cloned into the prey vector (pACT2) while five Nop4 interacting proteins (Noc2, Mak5, Nop4, Nsa2 and Dbp10) were cloned into the bait vector (pAS2-1). Each bait was individually co-transformed into the yeast strain PJ69-α with empty vector (EV), Nop4 WT or Nop4 L306P prey and spotted onto medium to confirm the presence of both Y2H plasmids (SD-Leu-Trp) and onto medium to test for protein-protein interactions (SD-Leu-Trp-His + 6 mM 3-AT). (B) Nop4 WT and Nop4 L306P are expressed at equivalent levels from the Y2H vector pACT2. Total protein was extracted from PJ69-4α yeast transformed with EV or expressing Nop4 WT or Nop4 L306P from the Y2H prey vector, pACT2. Nop4 WT and Nop4 L306P are expressed as fusions with the GAL4 activation domain and a 3xHA tag. Protein extracts were separated by SDS-PAGE and analyzed by α-HA western blot. As a loading control, a western blot using α-Mpp10 was performed. The expression levels of Nop4 WT and Nop4 L306P relative to Mpp10 were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 L306P = 1.1 (C) Y2H analysis by serial dilution reveals that the ANE syndrome (L306P) mutation disrupts some Nop4 protein-protein interactions. Two biological replicates of a subset of interacting proteins were performed starting with co-transformation of the bait and prey plasmids into the Y2H strain. (D) The ANE syndrome (L306P) mutation reduces protein-protein interactions as determined by co-immunoprecipitation. Yeast extract was generated from yeast expressing either Nop4 WT or Nop4 L306P and one of its interacting partners and incubated with α-FLAG resin. Co-immunoprecipitations were assessed by α-HA western blot. The expected molecular weights of the Nop4 interacting proteins are: Dbp10 = 113 kDa, Mak5 = 87 kDa, Noc2 = 82 kDa, Nop4 = 78 kDa and Nsa2 = 30 kDa. (E) The ratio of co-purified 3xFLAG tagged Nop4 WT or Nop4 L306P to co-immunoprecipitated 3xHA tagged interacting partner was calculated from three replicate experiments and plotted with error bars representing the standard deviation. The significance of the co-immunoprecipitation ratio of Nop4 L306P compared to WT for each interacting partner was evaluated using a t-test. ****indicates a p value < 0.0001. ***indicates a p value < 0.001. **indicates a p value <0.01. NS = not significant. Three biological replicates were performed.DOI:
http://dx.doi.org/10.7554/eLife.16381.009
Quantitation and statistical analyses for Figure 3E.
DOI:
http://dx.doi.org/10.7554/eLife.16381.010Nop4 interacts with 23 large subunit assembly factors with high confidence. The Nop4 interacting proteins were identified by yeast two-hybrid and were assigned a confidence score in (McCann et al., 2015).DOI:
http://dx.doi.org/10.7554/eLife.16381.011The presence of the ANE syndrome mutation (L306P) disrupted the interaction between Nop4 and 4 of the 5 interacting partners we tested (Figure 3C), including Nop4 itself. While all 5 bait proteins interacted with Nop4 WT, as indicated by growth on SD-Leu-Trp-His + 6 mM 3-AT, Mak5, Nop4, and Nsa2 did not interact with Nop4 L306P, as no growth was observed (Figure 3C). Noc2 did interact with Nop4 L306P, but growth was reduced compared to WT. In contrast, Dbp10 interaction with Nop4 was unaffected by the L306P mutation (Figure 3C). Thus, the presence of the ANE syndrome mutation (L306P) disrupts Nop4 interaction with a subset of Nop4’s interacting proteins (Mak5, Nop4, Nsa2 and Noc2) by Y2H, suggesting that the ANE syndrome mutation disrupts Nop4 function as a hub protein in the LSU processome.To confirm our findings, we utilized a co-immunoprecipitation method developed to validate Y2H datasets (McCann et al., 2015) to assay for changes in protein-protein interactions in the presence of the ANE syndrome mutation (L306P). Nop4 WT and Nop4 L306P were expressed as 3xHA fusion proteins from the modified yeastexpression vector p414GPD-3xFLAG and the 5 Nop4-interacting proteins were expressed as 3xFLAG fusion proteins from the modified yeastexpression vector p415GPD-3xHA (Mumberg et al., 1995; McCann et al., 2015). The plasmids were co-transformed into yeast, immunoprecipitations were performed with anti-FLAG resin and the co-purifying Nop4 proteins were visualized by Western blotting with an antibody to the 3xHA tag (Figure 3D). The ratio of co-purifying 3xHA-Nop4 or 3xHA-Nop4 L306P to co-immunoprecipitated 3xFLAG-interacting protein was calculated and normalized to WT for each interacting partner (Figure 3E). Interestingly, 3xHA-Nop4 L306P co-purified significantly less efficiently than 3xHA-Nop4 WT with all interacting partners assayed, except Dbp10, as was observed by Y2H. Thus, the ANE syndrome mutation disrupts or reduces a subset of Nop4 protein-protein interactions.
RRM3 and RRM4 of Nop4 mediate protein binding
We hypothesized that Nop4RRM3 may be important for protein binding since it contains the ANE syndrome mutation (L306P) that, when present, abrogates interaction with a subset of Nop4 interacting proteins (Figure 1A; Figure 3C–E). Although RRM domains typically bind RNA, there are several published examples of RRMs that bind proteins rather than RNA (Fribourg et al., 2003; Lau et al., 2003; Selenko et al., 2003; Bono et al., 2004; Kadlec et al., 2004). To determine the contribution of the 4 RRMs to Nop4’s function as a protein-binding hub, we divided Nop4 into two fragments. One fragment contained RRM1 and RRM2 (Nop4 RRM 1–2), and the second fragment contained RRM3 and RRM4 (Nop4RRM 3–4; Figure 4A). We also attempted to determine if RRM3 alone was sufficient to mediate protein-protein interactions, however, RRM3 can not be stably expressed from the yeast two-hybrid vector (data not shown).
Figure 4.
RRM3 and RRM4 of Nop4 mediate protein-protein interactions.
(A) Schematic representation of Nop4 RRM domains and the N- and C-terminal fragments containing RRMs 1 and 2 (RRM 1–2; residues 1–250) or 3 and 4 (RRM 3–4; residues 252–685), respectively. (B) Nop4 WT and the Nop4 fragments are differentially expressed from the Y2H vector pACT2. Total protein was extracted from PJ69-4α yeast transformed with empty vector (EV) or expressing Nop4 WT (78 kDa), Nop4 RRM 1–2 (28.3 kDa) or Nop4 RRM 3–4 (49.4 kDa) from the Y2H prey vector, pACT2. Nop4 WT, Nop4 RRM 1–2 and Nop4 RRM 3–4 are expressed as fusions with the GAL4 activation domain and a 3xHA tag. Protein extracts were separated by SDS-PAGE and analyzed by α-HA western blot. As a loading control, a western blot using α-Glucose-6-Phosphate Dehydrogenase (G-6-PDH) was performed. The expression levels of Nop4 WT, Nop4 RRM 1–2 and Nop4 RRM 3–4 relative to G-6-PDH were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 RRM 1–2 = 7.4, Nop4 RRM 3–4 = 0.29. (C) Y2H analysis demonstrates that Nop4 RRM 3–4 mediates protein-protein interactions. Nop4 WT and the Nop4 fragments described in (a) were tested as preys for interaction with 23 Nop4 interacting proteins as baits. The baits are labeled for the empty vector (EV) control plate. Growth on selective medium (SD-Leu-Trp-His + 6 mM 3-AT) indicates an interacting bait-prey pair. Two biological replicates were performed starting with the transformation of the bait and prey plasmids into the Y2H strains.
DOI:
http://dx.doi.org/10.7554/eLife.16381.012
RRM3 and RRM4 of Nop4 mediate protein-protein interactions.
(A) Schematic representation of Nop4 RRM domains and the N- and C-terminal fragments containing RRMs 1 and 2 (RRM 1–2; residues 1–250) or 3 and 4 (RRM 3–4; residues 252–685), respectively. (B) Nop4 WT and the Nop4 fragments are differentially expressed from the Y2H vector pACT2. Total protein was extracted from PJ69-4α yeast transformed with empty vector (EV) or expressing Nop4 WT (78 kDa), Nop4 RRM 1–2 (28.3 kDa) or Nop4RRM 3–4 (49.4 kDa) from the Y2H prey vector, pACT2. Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 are expressed as fusions with the GAL4 activation domain and a 3xHA tag. Protein extracts were separated by SDS-PAGE and analyzed by α-HA western blot. As a loading control, a western blot using α-Glucose-6-Phosphate Dehydrogenase (G-6-PDH) was performed. The expression levels of Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 relative to G-6-PDH were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 RRM 1–2 = 7.4, Nop4RRM 3–4 = 0.29. (C) Y2H analysis demonstrates that Nop4RRM 3–4 mediates protein-protein interactions. Nop4 WT and the Nop4 fragments described in (a) were tested as preys for interaction with 23 Nop4 interacting proteins as baits. The baits are labeled for the empty vector (EV) control plate. Growth on selective medium (SD-Leu-Trp-His + 6 mM 3-AT) indicates an interacting bait-prey pair. Two biological replicates were performed starting with the transformation of the bait and prey plasmids into the Y2H strains.DOI:
http://dx.doi.org/10.7554/eLife.16381.012We found that Nop4RRM 3–4 mediated the protein-protein interactions observed in the LSU processome interactome using a directed Y2H assay. Full-length Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 were expressed as prey fusion proteins (Figure 4B) and tested with 23 Nop4 interacting proteins (Table 1; McCann et al., 2015) expressed as bait fusions (James et al., 1996). Each prey was mated against each bait in an array-based Y2H assay and interactions were identified by growth on selective medium (Figure 4C; de Folter and Immink, 2011; McCann et al., 2015). As was previously observed in the LSU processome interactome, Nop4 WT interacted with the majority of the defined Nop4 interacting proteins after two weeks (Figure 4C; McCann et al., 2015). To our surprise, Nop4 RRM 1–2 did not interact with any of the Nop4 interacting proteins. In contrast, Nop4RRM 3–4 interacted with the majority of the defined interacting set of proteins, similar to the full-length Nop4 WT (Figure 4C). Thus, Nop4RRMs 3 and 4 are necessary and sufficient for these protein-protein interactions and are thereby likely to mediate Nop4’s function as a hub protein in the LSU processome.
RRM3 and RRM4 are sufficient for Nop4’s essential function
Nop4RRM 3–4 is also sufficient to complement the growth defect observed upon Nop4 depletion. We constitutively expressed either full length Nop4 WT, Nop4 RRM 1–2 or Nop4RRM 3–4 from plasmids in a yeast strain in which endogenous Nop4 was depleted (Figure 1B). Western blotting of total protein demonstrated that plasmid-borne, FLAG-tagged Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 were expressed, albeit at very different levels (Figure 5A). Serial dilutions of strains bearing the plasmids: empty vector (EV), Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 were spotted onto plates containing glucose and incubated at 30°C, 37°C, 23°C and 17°C. As expected, EV did not complement the growth defect at any temperature whereas Nop4 WT complemented at all temperatures (Figure 5B). Like EV, Nop4 RRM 1–2 did not complement the growth defect. However, Nop4RRM 3–4 complemented the growth defect at 23°C and 17°C and partially complemented at 30°C (Figure 5B).
Figure 5.
RRM3 and RRM4 of Nop4 are necessary and sufficient to complement the growth defect due to Nop4 depletion.
(A) Nop4 WT and the Nop4 fragments are differentially expressed from the yeast expression vector p414GPD-3xFLAG-GW. Total protein was extracted from YPH499 GAL::3xHA-NOP4 yeast transformed with empty vector (EV) or expressing Nop4 WT (78 kDa), Nop4 RRM 1–2 (28.3 kDa) or Nop4 RRM 3–4 (49.4 kDa) from the yeast expression vector, p414GPD-3xFLAG-GW. Protein extracts were separated by SDS-PAGE and analyzed by α-FLAG western blot. As a loading control, a western blot using α-Mpp10 was performed. The expression levels of Nop4 WT, Nop4 RRM 1–2 and Nop4 RRM 3–4 relative to Mpp10 were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 RRM 1–2 = 4.9, Nop4 RRM 3–4 = 0.27. (B) Serial dilutions of yeast expressing the indicated Nop4 fragments were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C. (C) Yeast expressing the indicated Nop4 fragments were transferred from SG/R-Trp-Leu to SD-Trp-Leu to deplete the endogenous Nop4. Growth was monitored for 24 hr at 30°C by measuring the absorbance at OD600. The log2 of the OD600 was plotted over time and the slope was used to estimate the doubling time. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain. (D) Yeast expressing the indicated Nop4 fragments were transferred from SG/R-Trp-Leu to SD-Trp-Leu to deplete the endogenous Nop4. Growth was monitored for 48 hr at 23°C by measuring the absorbance at OD600. The log2 of the OD600 was plotted over time and the slope was used to estimate the doubling time. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain.
DOI:
http://dx.doi.org/10.7554/eLife.16381.013
(A) Expression of the Nop4 fragments from the yeast two-hybrid vector pACT2 ensures nuclear targeting. Yeast expressing 3xHA-Nop4 WT, 3xHA-Nop4 RRM 1–2 or 3xHA-Nop4 RRM 3–4 from the yeast two-hybrid vector, pACT2, after depletion of endogenous Nop4 for 48 hr at 23°C were stained with DAPI (blue) and HA antibodies (green). The immunofluorescence microscopy images were merged. Nop4 WT, Nop4 RRM 1–2 and Nop4 RRM 3–4 localize primarily to the nucleus. (B) Serial dilutions of yeast expressing the indicated Nop4 fragments from pACT2 were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C.
DOI:
http://dx.doi.org/10.7554/eLife.16381.014
RRM3 and RRM4 of Nop4 are necessary and sufficient to complement the growth defect due to Nop4 depletion.
(A) Nop4 WT and the Nop4 fragments are differentially expressed from the yeastexpression vector p414GPD-3xFLAG-GW. Total protein was extracted from YPH499 GAL::3xHA-NOP4yeast transformed with empty vector (EV) or expressing Nop4 WT (78 kDa), Nop4 RRM 1–2 (28.3 kDa) or Nop4RRM 3–4 (49.4 kDa) from the yeastexpression vector, p414GPD-3xFLAG-GW. Protein extracts were separated by SDS-PAGE and analyzed by α-FLAG western blot. As a loading control, a western blot using α-Mpp10 was performed. The expression levels of Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 relative to Mpp10 were quantitated and normalized to Nop4 WT: Nop4 WT = 1, Nop4 RRM 1–2 = 4.9, Nop4RRM 3–4 = 0.27. (B) Serial dilutions of yeast expressing the indicated Nop4 fragments were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C. (C) Yeast expressing the indicated Nop4 fragments were transferred from SG/R-Trp-Leu to SD-Trp-Leu to deplete the endogenous Nop4. Growth was monitored for 24 hr at 30°C by measuring the absorbance at OD600. The log2 of the OD600 was plotted over time and the slope was used to estimate the doubling time. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain. (D) Yeast expressing the indicated Nop4 fragments were transferred from SG/R-Trp-Leu to SD-Trp-Leu to deplete the endogenous Nop4. Growth was monitored for 48 hr at 23°C by measuring the absorbance at OD600. The log2 of the OD600 was plotted over time and the slope was used to estimate the doubling time. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain.DOI:
http://dx.doi.org/10.7554/eLife.16381.013
Nop4 RRM 1–2 fails to complement even when targeted to the nucleus.
(A) Expression of the Nop4 fragments from the yeast two-hybrid vector pACT2 ensures nuclear targeting. Yeast expressing 3xHA-Nop4 WT, 3xHA-Nop4 RRM 1–2 or 3xHA-Nop4RRM 3–4 from the yeast two-hybrid vector, pACT2, after depletion of endogenous Nop4 for 48 hr at 23°C were stained with DAPI (blue) and HA antibodies (green). The immunofluorescence microscopy images were merged. Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4 localize primarily to the nucleus. (B) Serial dilutions of yeast expressing the indicated Nop4 fragments from pACT2 were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C.DOI:
http://dx.doi.org/10.7554/eLife.16381.014As an additional test, we analyzed complementation in liquid medium at 30°C and 23°C. Endogenous Nop4 was depleted and the growth of strains expressing no Nop4 (empty vector; EV), Nop4 WT, Nop4 RRM 1–2 and Nop4RRM 3–4, was monitored for 24 hr at 30°C or 48 hr at 23°C (Figure 5C,D). Similar to results on solid medium, Nop4RRM 3–4 did not significantly complement the growth defect at 30°C but did complement the growth defect at 23°C, whereas Nop4 RRM 1–2 did not complement at either temperature (Figure 5C,D). The failure of Nop4 RRM 1–2 to complement the growth defect is not due to aberrant localization of the protein fragment. Nop4 RRM 1–2 also fails to complement when expressed from the yeast two-hybrid vector, pACT2, which ensures targeting of the fragment to the nucleus (Figure 5—figure supplement 1A,B), suggesting that this domain is not essential for Nop4 function. In contrast, the ability of Nop4RRM 3–4 to complement the growth defect in both solid and liquid medium suggests that the essential function of Nop4 is mediated through RRMs 3 and 4.
Figure 5—figure supplement 1.
Nop4 RRM 1–2 fails to complement even when targeted to the nucleus.
(A) Expression of the Nop4 fragments from the yeast two-hybrid vector pACT2 ensures nuclear targeting. Yeast expressing 3xHA-Nop4 WT, 3xHA-Nop4 RRM 1–2 or 3xHA-Nop4 RRM 3–4 from the yeast two-hybrid vector, pACT2, after depletion of endogenous Nop4 for 48 hr at 23°C were stained with DAPI (blue) and HA antibodies (green). The immunofluorescence microscopy images were merged. Nop4 WT, Nop4 RRM 1–2 and Nop4 RRM 3–4 localize primarily to the nucleus. (B) Serial dilutions of yeast expressing the indicated Nop4 fragments from pACT2 were grown on solid medium for 3 days at 30°C and 37°C or for 5 days at 23°C and 17°C.
DOI:
http://dx.doi.org/10.7554/eLife.16381.014
Expression of Nop4RRM 3–4 is sufficient to partially restore pre-rRNA processing. To determine whether complementation of the growth defect is due to rescue of the pre-rRNA processing defect, total RNA was harvested from strains depleted of endogenous Nop4 for 48 hr at 23°C or for 24 hr at 30°C and bearing plasmids expressing no Nop4 (EV), Nop4 WT, Nop4 RRM 1–2 or Nop4RRM 3–4. The 25S and 18S rRNAs were visualized by ethidium bromide staining, quantified and the ratio of 25S/18S was calculated and normalized to WT for each time point (Figure 6A,B). Complementation of growth correlated with the rescue of pre-rRNA processing. As expected, Nop4 WT restored the 25S/18S ratio compared to EV at both 23°C and 30°C. Nop4 RRM 1–2 did not complement growth and did not rescue the 25S/18S ratio at either temperature (Figure 6A,B). In contrast, Nop4RRM 3–4 was sufficient to significantly rescue the 25S/18S ratio compared to EV at 23°C, but not at 30°C (Figure 6B), consistent with a restoration of 25S levels at 23°C.
Figure 6.
Nop4 RRM 3–4 is necessary and sufficient to complement the pre-rRNA processing defect after Nop4 depletion.
(A) Top panel: Total RNA extracted from yeast expressing the indicated Nop4 fragment after depletion of endogenous Nop4 for 24 hr at 30°C or for 48 hr at 23°C was visualized by ethidium bromide staining. Bottom panel: Northern blot analysis of total RNA using oligonucleotide probe e, which is complementary to a region of ITS2 of the pre-rRNA. As a loading control, we used an oligonucleotide complementary to the Scr1 RNA. Three biological replicates were performed. (B) The ratios of the mature rRNAs (25S/18S) and the ratios of the precursors to the loading control Scr1 (35S/Scr1, 27S/Scr1S and 7S/Scr1) were calculated from three replicate experiments and were plotted with error bars representing the standard deviation. The significance of the ratios of 25S/18S, 35S/Scr1, 27S/Scr1 and 7S/Scr1 of Nop4 WT, Nop4 RRM 1–2 or Nop4 RRM 3–4 compared to EV was evaluated using one-way ANOVA. ****indicates a p value < 0.0001. **indicates a p value < 0.01.
DOI:
http://dx.doi.org/10.7554/eLife.16381.015
DOI:
http://dx.doi.org/10.7554/eLife.16381.016
Nop4 RRM 3–4 is necessary and sufficient to complement the pre-rRNA processing defect after Nop4 depletion.
(A) Top panel: Total RNA extracted from yeast expressing the indicated Nop4 fragment after depletion of endogenous Nop4 for 24 hr at 30°C or for 48 hr at 23°C was visualized by ethidium bromide staining. Bottom panel: Northern blot analysis of total RNA using oligonucleotide probe e, which is complementary to a region of ITS2 of the pre-rRNA. As a loading control, we used an oligonucleotide complementary to the Scr1 RNA. Three biological replicates were performed. (B) The ratios of the mature rRNAs (25S/18S) and the ratios of the precursors to the loading control Scr1 (35S/Scr1, 27S/Scr1S and 7S/Scr1) were calculated from three replicate experiments and were plotted with error bars representing the standard deviation. The significance of the ratios of 25S/18S, 35S/Scr1, 27S/Scr1 and 7S/Scr1 of Nop4 WT, Nop4 RRM 1–2 or Nop4RRM 3–4 compared to EV was evaluated using one-way ANOVA. ****indicates a p value < 0.0001. **indicates a p value < 0.01.DOI:
http://dx.doi.org/10.7554/eLife.16381.015
Quantitation and statistical analyses for Figure 6B.
DOI:
http://dx.doi.org/10.7554/eLife.16381.016To further assess the rescue of pre-rRNA processing, we also examined pre-rRNA processing by northern blotting using an oligonucleotide probe in ITS2 (Figure 2A). Depletion of Nop4 (EV) led to a reduction in the 27S and 7S pre-rRNAs but did not affect the levels of the 35S pre-rRNA, as has been observed before (Bergès et al., 1994; Sun and Woolford, 1994; Qiu et al., 2008). Expression of Nop4 WT restored pre-rRNA processing and the levels of the 27S and 7S pre-rRNA intermediates compared to the EV control at both 23°C and 30°C (Figure 6A,B). Strikingly, expression of Nop4RRM 3–4, but not Nop4 RRM 1–2, significantly restored the levels of the 27S and 7S intermediates at 23°C but failed to rescue at 30°C (Figure 6B). Thus, pre-rRNA processing parallels the observed growth complementation and suggests that the essential function of Nop4 in ribosome assembly is mediated through the protein binding RRMs, RRM3 and RRM4.
The ANE syndrome mutation disrupts the structure of human RBM28 RRM3
As the ANE syndrome mutation in yeastNop4 causes pre-rRNA processing defects and reduces protein-protein interactions with a subset of proteins that we tested, we hypothesized that the mutation causes a structural change in RRM3. To test this, we analyzed WT and mutant humanRBM28RRM3 domains (amino acids 330–419) by circular dichroism (CD) and NMR. We used RBM28RRM3 because Nop4RRM3 was not soluble. We found that the L351P mutation disrupts the backbone structure of the RBM28RRM3 domain. The CD spectra of WT and L351P RBM28RRM3 showed notable differences in ellipticities [θ] at 208, 215 and 222 nm (Figure 7A), indicating that the amino acid substitution reduced α-helical and β-sheet content. The CD spectrum of the L351P mutant protein with a minimum only at ~200 nm indicated the presence of random coil. We confirmed the disruption of domain folding by NMR. 15N-HSQC of WT RBM28RRM3 showed well dispersed resonances (Figure 7B), indicating the presence of both α-helices and β-strands, as expected for an RRM domain(Nagai et al., 1990). In contrast, the majority of resonances in the spectrum of L351P ANE syndrome mutant RRM3 were clustered around 8.0~8.5 ppm in the proton dimension, demonstrating that the mutant protein backbone is disordered. A homology model of the humanRBM28RRM3, based on an NMR structure of mouseRBM28RRM3, indicates that L351 is buried within the core of the domain (Figure 7C). Mutation to proline would be expected to disrupt helix α1 and the overall tertiary structure of this RRM.
Figure 7.
The ANE syndrome mutation, L351P, in human RBM28 disrupts RRM3 domain structure.
(A) Circular dichroism spectra of WT human RBM28 RRM3 (black) and L351P mutant (red). Four technical replicates were performed. (B) 15N-HSQC spectra of WT hRBM28 RRM3 (amino acids 330–419) (black) and L351P mutant (red) are superimposed and plotted at the same contour level. In addition to clustering of resonances around 8.0~8.5 ppm in the proton dimension, dispersion of glutamine and asparagine side chains (7.0~7.8 ppm in the 1H dimension and 111~114 ppm in the 15N dimension) is reduced considerably, consistent with protein backbone disruption. Thirty-two technical replicates were performed. (C) Ribbon diagram of a homology model of human RBM28 RRM3. The model including residues 330–419 was generated using the Phyre2 server (Kelley et al., 2015), and the best template was a solution structure of mouse RBM28 RRM3 (90% sequence identity with human RBM28, PDB ID 1X4H). L351 is shown with red space-filling spheres and typical RNA interacting residues in RNP motifs are colored yellow.
DOI:
http://dx.doi.org/10.7554/eLife.16381.017
The ANE syndrome mutation, L351P, in human RBM28 disrupts RRM3 domain structure.
(A) Circular dichroism spectra of WT humanRBM28RRM3 (black) and L351P mutant (red). Four technical replicates were performed. (B) 15N-HSQC spectra of WT hRBM28 RRM3 (amino acids 330–419) (black) and L351P mutant (red) are superimposed and plotted at the same contour level. In addition to clustering of resonances around 8.0~8.5 ppm in the proton dimension, dispersion of glutamine and asparagine side chains (7.0~7.8 ppm in the 1H dimension and 111~114 ppm in the 15N dimension) is reduced considerably, consistent with protein backbone disruption. Thirty-two technical replicates were performed. (C) Ribbon diagram of a homology model of humanRBM28RRM3. The model including residues 330–419 was generated using the Phyre2 server (Kelley et al., 2015), and the best template was a solution structure of mouseRBM28RRM3 (90% sequence identity with humanRBM28, PDB ID 1X4H). L351 is shown with red space-filling spheres and typical RNA interacting residues in RNP motifs are colored yellow.DOI:
http://dx.doi.org/10.7554/eLife.16381.017
Discussion
We determined that the molecular pathogenesis of ANE syndrome (L351P in the nucleolar protein, RBM28) results from disrupted RRM3 protein structure that reduces its function as a hub protein in the LSU processome and causes defects in pre-rRNA processing. Introducing the ANE syndrome mutation into RRM3 of the yeast ortholog, Nop4 (L306P), causes growth and pre-rRNA processing defects, as well as reduced association with interacting protein partners. RRMs 3 and 4 of Nop4 alone are necessary and sufficient for Nop4 protein-protein interactions and for yeast growth and pre-rRNA processing. Biophysical methods indicate that RRM3 containing the ANE syndrome mutation is unfolded. Taken together, these results provide evidence that ANE syndrome is a ribosomopathy with a molecular defect in nucleolar steps of ribosome biogenesis.The finding that an essential function of Nop4 is to mediate protein binding was unexpected. Nop4 has been cross-linked to pre-rRNA (Bergès et al., 1994; Sun and Woolford, 1994; Granneman et al., 2011), leading to the expectation that its 4 RRMs would be essential for RNA binding. We show by Y2H analysis that the C-terminal half of Nop4 (RRMs 3 and 4) mediates protein-protein interactions and hub protein function in the LSU processome. Strikingly, this half of Nop4 is necessary and sufficient to complement the growth and pre-rRNA processing defects observed upon depletion of endogenous Nop4. As the ANE syndrome mutation occurs in RRM3 and disrupts Nop4 protein-protein interactions, ANE syndrome is therefore likely a disease of altered protein interaction rather than of RNA binding. We are now in a position to determine which interactions are critical for Nop4 function and how disruptions of those specific interactions contribute to ANE syndrome pathogenesis.Nevertheless, Nop4 is undoubtedly an RNA-binding protein. Nop4 binds RNA in vitro (Sun and Woolford, 1997), co-immunoprecipitates the 27S and 7S pre-rRNAs and crosslinks to the 25S within the pre-rRNA in vivo (Granneman et al., 2011). Additionally, all 4 RRMs are important for Nop4 function as mutations in any of the RRMs disrupt growth and LSU assembly at 37°C (Sun and Woolford, 1997). Although RRMs 1 and 2 are not required for Nop4’s hub protein function or sufficient for growth, they may bind the pre-rRNA. Furthermore, while RRMs 3 and 4 mediate protein binding, the possibility that they may also bind RNA is not precluded.How does an RRM facilitate protein binding and thus hub protein function? Several examples of RRMs mediating interactions with other proteins have been identified including in the U2AF35-U2AF65, the U2AF65-SF1, the Snu17-Bud13, and the Y14-Mago complexes (Kielkopf et al., 2001; Fribourg et al., 2003; Lau et al., 2003; Selenko et al., 2003; Tripsianes et al., 2014). An RRM is comprised of a 4-stranded β-sheet, which forms the primary RNA binding interface, and 2 α-helices (Maris et al., 2005; Cléry et al., 2008). The α-helices of the RRM often mediate interaction between protein pairs, leaving the β-sheet accessible for RNA binding (Kielkopf et al., 2001; Selenko et al., 2003; Tripsianes et al., 2014). Alternatively, in the case of the Y14-Mago complex, the interaction is through the β-sheet, which precludes RNA binding (Fribourg et al., 2003; Lau et al., 2003). RRMs also can serve as oligomerization domains. In the case of Human antigen R (HuR), the third RRM promotes dimerization through its α-helices (Scheiba et al., 2014). These examples highlight the possibility that RRMs 3 and 4 of Nop4 may mediate protein binding and hub function through more than one of its structural motifs. The ANE mutation lies in an α-helix and the mutation disrupts not only the α-helix, but unfolds the RRM tertiary structure. Since the mutation abrogates some but not all protein-protein interactions, a subset of Nop4 interactions may be mediated by unstructured peptide elements in RRM3 or by the RRM4 domain.Fibroblasts from patients with ANE syndrome have ribosome levels reduced to approximately 60% of controls (Nousbeck et al., 2008), consistent with the modest defects in ribosome biogenesis that we can now associate with the ANE syndrome mutation. In the yeast model system, the mutation confers reduced growth and mild pre-rRNA processing defects when compared to the Nop4 null (EV). Thus, the ANE syndrome mutation is a hypomorphic allele, consistent with its autosomal recessive inheritance (Nousbeck et al., 2008). This hypomorphism may, in part, explain how the ANE syndrome mutation is compatible with life, as the presence of the mutation leads to a partially functional RBM28 protein.
Materials and methods
Amino acid sequence alignment
The amino acid sequence of Nop4 was obtained from the Saccharomyces Genome Database (www.yeastgenome.org). The amino acid sequence of humanRBM28 (accession number NP_060547) was obtained from the Protein Database (http://www.ncbi.nlm.nih.gov/protein/). The amino acid sequences of RBM28 from M. mulatta, M. musculus, X. tropicalis and D. rerio were obtained from Uniprot (www.uniprot.org). Amino acid alignments were determined using either ClustalX (Jeanmougin et al., 1998) or MegAlign Pro version 12.2.0 from DNASTAR. Madison, WI.
Yeast strains and plasmids
A GAL::3HA-NOP4 strain was generated in the parental strain YPH499 (MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1) as described in (Charette and Baserga, 2010) that expresses 3HA-tagged Nop4 from the endogenous locus when grown in medium containing galactose but represses endogenous Nop4expression when grown in medium containing glucose. The strain was confirmed by western blot using α-HA-HRP (Roche, Indianapolis, Indiana ).NOP4 was shuttled into the Gateway-modified yeastexpression vector p414GPD-3xFLAG-GW (TRP1) or the Gateway-modified Y2H prey vector pACT2 (LEU2) and RBM28 was shuttled into p414GPD-3xFLAG-GW (TRP1) by Gateway cloning (Life Technologies) as in (Charette and Baserga, 2010). Site-directed mutagenesis to introduce the L306P missense mutation was performed using a Change-IT kit (Affymetrix, Santa Clara, California). RBM28, Nop4 WT and Nop4 L306P were all fully sequenced by either the W.M. Keck Foundation facility at the Yale School of Medicine or by GENEWIZ, Inc. Expression of RBM28, Nop4 WT and Nop4 L306P from p414GPD-3xFLAG-GW or pACT2 was analyzed by western blot using either α-3xFLAG-HRP (Sigma, St. Louis, Missouri) or α-HA-HRP (Roche, Indianapolis, Indiana). As a loading control, a western blot using α-Mpp10 (Dunbar et al., 1997) was performed.The Nop4 fragments in Figure 4A were cloned into a Gateway Entry vector (pDONR221) and subsequently shuttled into the Y2H prey vector (pACT2) or the yeastexpression vector p414GPD-3xFLAG-GW by Gateway cloning (Life Technologies) as in (Charette and Baserga, 2010). All clones were fully sequenced by either the W.M. Keck Foundation facility at the Yale School of Medicine or by GENEWIZ, Inc. Expression of the Nop4 fragments from p414GPD-3xFLAG-GW and pACT2 was analyzed by western blot using either α-3xFLAG-HRP (Sigma, St. Louis, Missouri) or α-HA-HRP (Roche). As a loading control, a western blot using α-G-6-PDH (Sigma) or using α-Mpp10 (Dunbar et al., 1997) was performed.
Growth assays
For analysis of the complementation by RBM28 of the growth defect conferred by Nop4 depletion, the YPH499 GAL::3xHA-NOP4yeast strain was transformed with either empty vector (EV) or plasmids expressing Nop4 or RBM28. For serial dilutions, 0.2 mL of cells at an OD600 of 1 were resuspended in 1 mL water, diluted 1/10 and spotted onto SG/R-Trp or SD-Trp. Cells were incubated at 30°C or 37°C for 3 days or at 23°C or 17°C for 5 days. Two biological replicates were performed starting with transformation of the plasmids into the yeast strain.For analysis of the effect of the ANE syndrome mutation (L306P) on growth, the YPH499 GAL::3xHA-Nop4yeast strain was transformed with either empty vector (EV), or plasmids expressing Nop4 WT or Nop4 L306P. For serial dilutions, 0.2 mL of cells at an OD600 of 1 were resuspended in 1 mL water, diluted 1/10 and spotted onto medium containing 2% w/v galactose and 2% w/v raffinose and lacking tryptophan (SG/R-Trp) or onto medium containing 2% w/v glucose (dextrose) and lacking tryptophan (SD-Trp). Cells were incubated at 30°C or 37°C for 3 days or at 23°C or 17°C for 5 days. Four biological replicates were performed starting with transformation of the plasmids into the yeast strain. For analysis in liquid medium, the GAL::3xHA-NOP4yeast strain transformed with empty vector (EV) or expressing either 3xFLAG-tagged Nop4 WT or Nop4 L306P from the p414GPD vector was depleted of endogenous Nop4 by first growing cultures to mid-log phase (OD600 = 0.4–0.8) in SG/R-Trp at 30°C and then transferring the cultures to the non-permissive (SD-Trp) medium and 23°C. The cells were maintained in mid-log phase (OD600 < 0.8) by dilution of the culture with fresh SD-Trp media. Growth was monitored by OD600 measurement for 48 hr. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain.For analysis of the complementation by the Nop4 fragments of the growth defect conferred by Nop4 depletion, the YPH499 GAL::3xHA-NOP4yeast strain was co-transformed with empty p415GPD-3xHA-GW and either empty p414GPD-3xFLAG-GW vector (EV) or p414GPD-3xFLAG-GW expressing the Nop4 fragments. For serial dilutions, 0.2 mL of cells at an OD600 of 1 were resuspended in 1 mL water, diluted 1/10 and spotted onto SG/R-Trp-Leu or SD-Trp-Leu. Cells were incubated at 30°C or 37°C for 3 days or at 23°C or 17°C for 5 days. Two biological replicates were performed starting with transformation of the plasmids into the yeast strain. For analysis in liquid medium of the complementation by the Nop4 fragments of the growth defect conferred by Nop4 depletion, the YPH499 GAL::3xHA-NOP4yeast strain expressing one of the 3xFLAG-tagged Nop4 fragments was depleted of endogenous Nop4 by first growing cultures to mid-log phase (OD600 = 0.4–0.8) in SG/R-Trp-Leu at 30°C and then transferring the cultures to the non-permissive (SD-Trp-Leu) medium and growing at either 30°C or 23°C. The cells were maintained in mid-log phase (OD600 < 0.8) by dilution of the culture with fresh SD-Trp-Leu media. Growth was monitored by OD600 measurement for 24 hr at 30°C or for 48 hr at 23°C. Three biological replicates were performed starting with transformation of the plasmids into the yeast strain.For analysis of the complementation of the growth defect conferred by Nop4 depletion by the Nop4 fragments expressed from pACT2, the YPH499 GAL::3xHA-NOP4yeast strain was transformed with either pACT2 Nop4 WT, pACT2 Nop4 RRM 1–2 or pACT2 Nop4RRM 3–4. For serial dilutions, 0.2 mL of cells at an OD600 of 1 were resuspended in 1 mL water, diluted 1/10 and spotted onto SG/R- Leu or SD- Leu. Cells were incubated at 30°C or 37°C for 3 days or at 23°C or 17°C for 5 days. Two biological replicates were performed starting with transformation of the plasmids into the yeast strain.
RNA and northern blot analysis
For analysis of the effect of the ANE syndrome mutation, the YPH499 GAL::3xHA-NOP4yeast strain was transformed with EV or plasmids expressing either Nop4 WT or Nop4 L306P from the p414GPD-3xFLAG vector. The strain was depleted of endogenous Nop4 as described above. Cells (20 mL) at an OD600 of ~0.5 were collected from each culture after 0 and 48 hr of growth at 23°C. Total RNA was extracted as described in (Dunbar et al., 1997). For analysis of the mature rRNAs, 5 μg of total RNA per sample was separated by electrophoresis on a 1% agarose gel. RNA was visualized by ethidium bromide staining, and the bands were quantified by densitometric analysis using ImageJ (Schneider et al., 2012). For northern blot analysis, 3 μg of total RNA per sample was separated by electrophoresis on a 1% agarose/1.25% formaldehyde gel, transferred to a nylon membrane (Hybond-XL, GE Healthcare, Buckinghamshire, England) and detected by hybridization with radiolabelled oligonucleotide e (5´ – GGCCAGCAATTTCAAGT – 3´) and radiolabelled oligonucleotideScr1 (5’ – CGTGTCTAGCCGCGAGGAAGGATTTGTTCC – 3’) as described in (Wehner and Baserga, 2002; Qiu et al., 2014). The 35S, 27S and 7S pre-rRNAs and the Scr1 RNA were quantified using a Biorad Personal Molecular Imager. The ratios of 27S or 7S to the 35S pre-rRNA and the ratios of the 35S, 27S or 7S to Scr1 were calculated. Four biological replicates were performed for each experiment. GraphPad PRISM was used to calculate the means of the ratios and plotted with error bars (SD). Significance compared to the WT control was determined using one-way ANOVA.For analysis of the complementation by the Nop4 fragments of the pre-rRNA processing defect, the YPH499 GAL::3xHA-NOP4yeast strain transformed with EV or expressing one of the 3xFLAG-tagged Nop4 fragments was depleted of endogenous Nop4 as described. Cells (20 mL) at an OD600 of ~0.5 were collected from each culture after either 24 hr of growth at 30°C or after 48 hr of growth at 23°C. Total RNA was extracted as described in (Dunbar et al., 1997). For northern blot analysis, 3 μg of total RNA per sample was separated by electrophoresis on a 1% agarose/1.25% formaldehyde gel, transferred to a nylon membrane (Hybond-XL, GE Healthcare, Buckinghamshire, England) and detected by hybridization with radiolabelled oligonucleotide probe e (5´ – GGCCAGCAATTTCAAGT – 3´), which is complementary to ITS2 of the yeast pre-rRNA, and probe Scr1 (5´-CGTGTCTAGCCGCGAGGAAGGATTTGTTCC-3´), which is complementary to the RNA Scr1, as described in (Wehner and Baserga, 2002). The 7S, 27S and 35S pre-rRNA species were quantified on a Biorad Personal Molecular Imager, and the ratios of 7S, 27S or 35S to Scr1 were calculated. Three biological replicates were performed for each experiment. GraphPad PRISM was used to calculate the means of the ratios and plotted with error bars (SD). Significance compared to the EV control was determined using one-way ANOVA.
Yeast two-hybrid analysis
For Y2H analysis to determine the effect of the ANE syndrome mutation (L306P; Figure 3) on protein-protein interactions, a subset of the Nop4 interacting proteins identified in (McCann et al., 2015) were expressed from the Y2H bait vector (pAS2-1) and were co-transformed with either empty pACT2 vector, Nop4 WT or Nop4 L306P into the yeast strain PJ69-4α. Co-transformed yeast were serially diluted by resuspending 0.2 mL of cells at an OD600 of 1 in 1 mL water, diluting 1/10 and spotting onto medium selecting for the presence of both plasmids (SD-Leu-Trp) and medium selecting for Y2H interactions [SD-Leu-Trp-His + 6 mM 3-Amino-1,2,4 triazole (3-AT)]. Cells were incubated at 30°C for 7 days. Two biological replicates of a subset of interacting proteins were performed starting with co-transformation of the bait and prey plasmids into the Y2H strain.For Y2H analysis of Nop4 fragments (Figure 4), Nop4 WT and the Nop4 fragments were shuttled into the Y2H prey vector (pACT2) by Gateway (Invitrogen) recombination and individually transformed into the yeast strain PJ69-4a. The Nop4 interacting proteins identified in (McCann et al., 2015) were shuttled into the Y2H bait vector (pAS2-1) and transformed into the yeast strain PJ69-4α as an array. All baits were mated against all preys in a semi-high-throughput Y2H matrix screen (de Folter and Immink, 2011). The mated yeast were transferred to SD-Leu-Trp plates to select for diploids bearing both the bait and prey vectors. Diploids were then transferred to the selective medium: SD-Leu-Trp-His + 6mM 3-AT. Growth on selective medium greater than that of the negative control after 2 weeks was indicative of an interacting bait-prey pair. Two biological replicates were performed starting with the transformation of the bait and prey plasmids into the Y2H strains.
Co-immunoprecipitations
A subset of the Nop4 interacting proteins identified in (McCann et al., 2015) were expressed from p414GPD-3xFLAG-GW and were co-transformed with either p415GPD-3xHA-GW Nop4 WT or Nop4 L306P into the yeast strain YPH499 (MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1). The resulting transformed strains were grown in medium containing 2% dextrose and lacking leucine and tryptophan (SD-Leu-Trp) at 30°C. Negative control strains were only transformed with p415GPD-3xHA-GW clones and were grown in medium containing 2% dextrose and lacking leucine (SD-Leu) at 30°C. For each co-immunoprecipitation, 20 mL of cells at an OD600 of ~0.5 was collected, washed with water and resuspended in NET2 (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.01% Nonidet P-40) with 1x HALT protease inhibitors (Thermo Fisher Scientific, Rockford, Illinois). Cells were lysed with 0.5-mm glass beads. The lysate was cleared by centrifugation at 15,000g for 10 min at 4°C. Aliquots of 500 µL of lysate were incubated with α-FLAG beads (Sigma) for 1 hr at 4°C. The beads were washed five times with NET2 and resuspended in 25 µL SDS loading dye. Immunoprecipitates were separated on 4–12% Bis-Tris PAGE and transferred to a PVDF membrane. Western blot analysis with α-HA (Abcam, Cambridge, Massachusetts) and α-FLAG-HRP (Sigma) was performed. The protein bands were quantified using ImageJ (Schneider et al., 2012) and the ratio of HA to FLAG was calculated. GraphPad PRISM was used to plot the means of the ratios with error bars (SD). Significance compared to the WT control for each interacting protein was determined using a t-test. Three biological replicates were performed.
Immunofluorescence
For analysis of the Nop4 fragment localization, the YPH499 GAL::3xHA-NOP4yeast strain was transformed with either pACT2 Nop4 WT, pACT2 Nop4 RRM 1–2 or pACT2 Nop4RRM 3–4 and endogenous Nop4 was depleted for 48 hr at 23°C as described above. For immunofluorescence, 50 mL of cells at an OD600 of ~0.5 was collected, washed with water, resuspended in Fixing buffer (100 mM Sucrose, 5% paraformaldehyde) and incubated at room temperature for 45 min. The cells were then washed three times with Buffer B (100 mM K2HPO4 pH 7.5, 1.2 M sorbitol), resupsended in 1 ml of Spheroplasting buffer (100 mM K2HPO4 pH 7.5, 1.2 M sorbitol, 30 mM β-mercaptoethanol) containing lyticase (Sigma) at 800 U/mL and incubated for 8 min at 30°C. The reaction was stopped by adding 5 mL of ice-cold Buffer B. The yeast were washed once with ice-cold Buffer B, resuspended in 1 ml of Buffer B and 500 µL were plated into each well of a 12-well plate containing a poly-D-lysine coated cover glass. Cells were incubated for 1 hr at 4°C, washed once with Buffer B and permeabilized overnight in 70% ethanol at -20°C. Fixed and permeabilized cells incubated with mouse anti-HA.11 (BioLegend, San Diego, California) diluted 1:1000 for 90 min at room temperature. The secondary antibody (Alexa Fluor 488donkey anti-Mouse; Life Technologies, Carlsbad, California) was used at a dilution of 1:1000 and was incubated for 1 hr at room temperature. Cover glasses were mounted with Prolong Gold containing DAPI (Life Technologies) and cells were imaged on a wide-field, epifluorescence microscope using a x100 oil-immersion objective (Carl Zeiss).
Protein expression and purification
E. coli codon-optimized cDNAs encoding the wild type (WT) and L351P mutant humanRBM28RRM3 (330-419) were obtained by gene synthesis (Genewiz, Inc.). The cDNAs were subcloned into pSMT3 with an N-terminal His6-SUMO tag. WT and L351P humanRBM28RRM3 domains were overexpressed in E. coli strain BL21-CodonPlus (DE3)-RIL (Agilent Technologies, Santa Clara, California) at 20 °C overnight after induction with 0.5 mM IPTG. The cells were collected by centrifugation, and pellets were resuspended in lysis buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl) and stored at −80 °C until use.Cells expressing WT humanRBM28RRM3 domain were disrupted by sonication. The soluble fraction was applied to a Ni-NTAagarose column and thoroughly washed with lysis buffer containing 20 mM imidazole. The target SUMO fusion protein was eluted with lysis buffer containing 400 mM imidazole. The fusion protein was cleaved overnight with 0.2 mg of Ulp1 protease. The cleaved fusion protein sample was applied to a HiLoad 16/60 Superdex 75 column (GE Healthcare) equilibrated with lysis buffer containing 1 mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP). The eluted fractions containing WT hRBM28 RRM3 protein were pooled and applied to a Ni-NTAagarose column again to remove released SUMO protein. The protein sample was dialyzed against a buffer containing 50 mM Tris-HCl, pH 8.0, 100 mM NaCl and 0.5 mM TCEP and purified further using a HiTrap Q HR anion-exchange column (GE Healthcare). Bound proteins were eluted using a linear gradient from 0.05 to 1 M NaCl in 50 mM Tris-HCl, pH 8.0 and 0.5 mM TCEP. Peak fractions containing WT hRBM28 RRM3 were pooled and concentrated.L351P mutant humanRBM28RRM3 domain was purified by the same procedure as WT protein up to the first Ni-NTAagarose column. The eluted SUMO fusion protein was cleaved overnight with Ulp1 protease in conjunction with dialysis into 50 mM Tris-HCl, pH 8.0, 100 mM NaCl and 0.5 mM TCEP. The cleaved fusion protein sample was applied to a HiTrap Q HR anion-exchange column and eluted with a linear gradient from 0.1 to 1 M NaCl in 50 mM Tris-HCl, pH 8.0 and 0.5 mM TCEP. The eluted fractions containing L351P hRBM28 RRM3 protein were pooled and reapplied to a Ni-NTAagarose column. The protein was concentrated and purified further using a HiLoad 16/60 Superdex 75 column equilibrated with lysis buffer containing 0.5 mM TCEP. Two peaks of L351P hRBM28 RRM3 eluted from the Superdex 75 column. Because the peak eluting at 58.5 ml contained many contaminating proteins, only the fractions containing the peak eluting at 72.2 ml were pooled and concentrated.
Circular dichroism (CD) spectroscopy
The CD spectra of WT and L351P mutant humanRBM28RRM3 domains were measured on a JASCO J-810 CD spectrometer at room temperature. For each sample (200 μL in a 0.1 cm light-path cell), four scans were accumulated in the wavelength range of 190–260 nm with a 0.2 nm step size. Protein samples were 100 μg/mL in 20 mM Na phosphate buffer, pH 7.0, 100 mM NaCl and 0.2 mM TCEP. The raw CD data were adjusted by subtracting a buffer blank. Four technical replicates were performed.
NMR measurement
15N-/13C-labeled WT and L351P humanRBM28RRM3 domains were prepared as described above, except that E. coli cultures were grown in M9 medium containing appropriate isotopes. The protein samples for NMR experiments were 0.4 mM in 20 mM sodium phosphate buffer, pH 7.0, 100 mM NaCl, 0.2 mM TCEP and 10% (v/v) D2O. 15N-HSQC spectra were collected on a Varian Inova 60 MHz magnet installed with a cryo-probe at 298 K. The data were processed and plotted using NMRPipe (Delaglio et al., 1995) and NMRViewJ (Johnson, 2004). Thirty-two technical replicates were performed.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.[Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The previous decision letter after peer review is shown below.]Thank you for submitting your work entitled "The molecular basis for ANE syndrome revealed by the large ribosomal subunit processome interactome" for consideration by eLife. Your article has been reviewed by three reviewers in addition to a Reviewing Editor, and James Manley was the Senior Editor. The decision was reached after consultation between the four reviewers. Based on these discussions, and the individual reviews below, we regret to inform you that your work cannot be considered further for publication in eLife.While all reviewers thought that the subject matter was significant, there was some disagreement regarding the overall quality of the work. In particular, two of the referees felt that the experiments did not go far enough in dissecting the molecular defect caused by the mutation. They also raised a number of technical points, most importantly the question of the effect of temperature. Even the more positive reviewer raised similar technical points. The reviewers concluded that there was insufficient enthusiasm for the work to warrant publication in eLife. Because eLife does not encourage major revision we are declining the paper.Reviewer #1:In this interesting paper the authors study the biochemical consequences of a missense mutation in the nucleolar protein RBM28 known to be causative for ANE syndrome. Most of the experiments are conducted on the yeast ortholog of RBM28, Nop4. They show that mutant Nop4 causes a growth defect in yeast traced down to impaired rRNA processing. They further show that the mutant protein fails to interact with a number of its binding partners. The mutation is in RRM3 of the protein. This domain previously thought to bind RNA is a protein-protein interaction site. Finally, they show that the Leu->Pro mutation disrupts the structural integrity of RRM3 The work is clearly presented and provides new insight into ANE syndrome. The quality and impact of the work make it suitable for eLife.Reviewer #2:The manuscript by McCann et al. entitled "The Molecular Basis for ANE Syndrome Revealed by the Large Ribosomal Subunit Processome Interactions" describes an experimental approach that uses modeling in budding yeast to probe the molecular defects that underlie ANE syndrome. In humans, this disease is caused by a L->P amino acid substitution in the RBM28 protein. The budding yeast orthologue of RBM28, Nop4, has a conserved leucine that is located in the analogous domain as the change detected in patients.As RBM28 can replace the function of the essential Nop4 protein, the authors modeled the disease-causing amino acid substitution in the budding yeastNop4 protein. The authors use a nice complement of functional studies coupled with dissection of the key interacting domain and finally structural studies. The study is fairly straightforward but does provide insight into what mechanisms might underline disease and also provides insight into key interactions required for proper large subunit assembly.The authors make the surprising finding that RRM3 and 4 of Nop4 are sufficient to confer function and they seem to do so by mediating protein-protein interactions. One experimental issue is that Nop4 functions within the nucleolus and thus needs to be targeted there to function. A quick perusal of the literature shows no published information on how Nop4 enters the nucleus – which it must do to access the nucleolus. There are a number of predicted classical nuclear localization motifs and most are in the C-terminal domain of the protein. While this is not an issue for the two-hybrid system which presumably contains a nuclear targeting module, this could be an issue for the functional studies. The authors should really include localization as an aspect of their studies to validate their conclusions that the Rrm3-4 mediates the essential function of Nop4 and that Rrm1-2 is not sufficient to do so (see detailed comments below).With the broad interactions examined, the use of the two-hybrid is quite reasonable; however, for at least some of the interactions, the authors should validate the loss of interaction with a biochemical approach. They could easily choose binding partners for which antibodies are available or employ commercially available TAP-tagged proteins.One minor issue that should be clarified is the reference to the Leucine to Proline amino acid substation as a point mutation. While this change in the codons could easily occur due to a single point mutation in the DNA that changes a leucine codon to a proline codon (presumably this is what happens in the patients?) – it is the amino acid change that is the consequence of the point mutation that causes the functional change. The authors should merely keep this in mind in finalizing the text.Overall there are some relatively minor points that could enhance the impact of the studies but the experiments are nicely set up and the data presented support the conclusions drawn.Specific Comments:Figure 1 presents the phenotype observed. Figure 1A presents a schematic that compares RBM28 with Nop4. Although the detailed amino acid sequences of these proteins are included as a supplemental figure, providing the sequence of amino acids immediately surrounding the conserved leucine would make the information presented in Figure 1A far more convincing that the leucine is located within a conserved domain – without forcing the reader to refer to the supplemental figure.Figure 3 employs two-hybrid screening to identify interactions that are lot or maintained with the L306P amino acid change. The approach is reasonable for the broad screening. However, the authors should validate at least a few of these differential interactions through a biochemical approach (co-immunoprecipitation being the logical approach). Such biochemistry would complement the rationale use of the two-hybrid analyses.Figure 5 assesses the domains of Nop4 required for function. The immunoblot shown in Figure 5A is very difficult to interpret. The RRM1-2 domain appears very degraded. The authors need to provide a different blot showing that at least some protein of the predicted size is generated. Arrows marking the correct bands (corresponding to the predicted size) would help. Addition of molecular weight markers would also help in this and other immunoblots shown. The immunoblot shown in Figure 5A does not really compare to the one shown in Figure 4B (albeit they are different constructs- one FLAG-tagged and one for two-hybrid).The authors really do not comment on the temperature sensitive rescue of rRNA processing and growth by the Rrm3-4 fragment (Figure 5 and 6). The legend for Figure 6 does not mention the different temperatures. The authors need to provide some insight into why this rescue is temperature-dependent. Do they suspect that the domain may be less stable at higher temperatures? Some immunoblotting carried out from cells grown at the different temperatures might help to address this temperature-sensitive effect.The other experimental issue that should be addressed for this analysis is the localization of the protein domains. These fragments appear to be FLAG-tagged so it should be straightforward to examine the localization of the protein domains and append an NLS if needed. Could the two-hybrid clones be used to test for function?It would be nice to have a bit more information about how RBM28 rescues the yeast phenotype and whether the amino acid substitution in the human protein recapitulates the defects seen with the altered yeast protein.The authors are now in a position to determine which interactions are critical for the function of Nop4. This point could be mentioned in the Discussion.Reviewer #3:The authors have taken the observation, by others, that a recessive mutation in RBM28, a human homologue of Nop4 of yeast, causes ribosomopathy, and expanded on it with reference to their recent very nice work on the Processosome (McCann et al. G&D). They show that when this mutation is transferred to the yeast gene, the formation of 25S rRNA is partially disrupted, (Figure 2) and that the interaction of Nop4 with a number of other proteins is reduced (Figure 3). These are interesting findings, but perhaps not surprising since the mutation causes substantial reduction of 60S ribosome synthesis in human cells. The rest of the paper is concerned with Nop4 and its fragments in yeast, where they conclude that only the C=terminal half of Nop4 is sufficient for growth, but only at 23 degrees. Quite similar experiments were reported by Sun & Woolford in 1997 (L611) that suggested all 4 RRMs were essential. But the difference is simply a matter of temperatures used for growth. Finally, (Figure 7) some protein structural measurements suggest that the L>P mutation disrupts the structure of RRM3 suggesting that leads to loss of interactions with other members of the processosome.I have a number of problems with the data, but overall I feel the authors have sold themselves short by not investigating just how the mutation affects 60S ribosome synthesis, which the yeast system is perfect for. Instead they have confined themselves to nibbling around the edges of a problem that they are in the perfect position to solve. While I am not in a position to critique Figure 7, again it seems to me that more could be done, e.g. the effects of mutation & temperature on structure and on interaction with other proteins (Figure 3).In summary, the data presented are for the most part sound, but the conclusions contribute only marginally to deep analysis of the problem.Reviewer #4:In this manuscript McCann et al. investigate the molecular basis of ANE syndrome pathogenesis. ANE syndrome is caused by a mutation in the nucleolar protein RBM28 (L351P) which affects the LSU processome resulting in ribosome biogenesis defects. McCann et. al use yeast as a model to study the effect of ANE mutation on the structure and function (as a hub protein) using the homologous protein, Nop4p. The authors first validate the model system, demonstrate that the ANE mutation affects Nop4 "hub" function, investigate the molecular biology of the RRM3 and RRM4 domains of Nop4 and conclude with biophysical analyses demonstrating that the L351P mutation disrupts folding of the RRM3 domain. This is a very straightforward study employing basic yeast molecular genetics and complemented with some nice biophysical studies. The conclusions are warranted by the data. However, the work could benefit from some minor improvement, and some of the data analyses are questionable.Figure 1.The abbreviation EV is not explained/mentioned in the figure legend and text. Figure 1C is missing quantification. This is important because Nousbeck et. al 2008 reported that decreased expression of mutant RBM28 in ANEpatient cells. Also, the presence of additional bands in the anti-FLAG and anti-Mpp10 blots are not explained.The growth defect for the Nop4 L306P expressing strain is described as 'severe' as compared to the EV expressing strain (for 1D and 1E). However, the EV expressing strain is essentially "dead' (in 1D). Thus, the proper comparison should be of the mutant to the WT. This renders the growth defect 'moderate'.The growth assays in Figure 1E have some issues: a) the time points are randomly selected (more time points are clustered around 20 hrs). b) the data could be quantified, i.e. doubling times should be calculated. c) While the EV expressing strain is dead in the dilution spot assays, it seems to have grown to in the liquid media. This can be explained as a consequence of residual Nop4 after gene shutoff.Figure 1—figure supplement 3: While it is clear that the authors did identify the correct yeastleucine residue to mutate, the use of a simple 1 to 1 protein alignment also gives the impression of someone having done the minimal effort. Additional alignments and phylogenetic analyses are simple to perform, and would lend more credibility to the choice of which leucine to mutate.Figure 2.There are some significant problems with this figure, especially as it compares with Figure 6. In general, it appears that Figure 2 and Figure 6 were performed by different people at different times each having different standards for quality and data interpretation.In the text, the reference to Figure 2A in the first paragraph of the subsection “The ANE syndrome mutation causes pre-rRNA processing defects in yeast” is confusing. The text would seem to indicate that the figure shows that "…the mature 25S rRNA and the 27S and 7S pre-rRNA precursors are severely reduced in yeast depleted of Nop4". However, Figure 2A only shows the processing schema.Figure 2B top panel (gel) uses Ethidium bromide to quantify the 25S and 18S rRNA. The method is not terribly sensitive for quantitation. To be honest, I cannot discern the differences between the wild-type and mutant in either the top or bottom panels of Figure 2B that are graphed in panel C. Additionally, in the 48 hr EV lane, there is so little rRNA (because the cells are dead) that it borders on disingenuous to claim any quantitation in Panel C. Compare these gels/autorads to those shown in Figure 6: these ones are much less informative.Unlike Figure 6A, Figure 2B is missing a loading control.The claim that Nop4 L306P results in 'severe reduction in 27S and 7S levels…' (subsection “The ANE syndrome mutation causes pre-rRNA processing defects in yeast”, last paragraph) is not supported by the quantification in 2C. The fold change as compared to WT is moderate.The claim that the EV control had most severe reduction in 25S/18S ratio and also 27S and 7S levels (subsection “The ANE syndrome mutation causes pre-rRNA processing defects in yeast”) again borders on disingenuous, because this mutant is dead, or at the very least, in the process of dying.The statistical comparisons in Figure 2C are different than those in Figure 6B. Here, comparisons are performed with respect to wild-type (which is correct). In 6B, the comparisons are with respect to empty vector (which is wrong, again because EV is dead).Figure 3.It is unclear why such a small panel of bait reporters were assayed here, especially in light of the fact that the lab possesses 23 bait reporters already (as shown in Figure 4). Again, were Figure 3 and Figure 4 done by different people? Assaying the entire panel would illuminate the role of Nop4 in the interactome and the consequences of the mutation.Including the Nop4 interactome map of as an additional panel (from McCann, K. L et.al 2015. Genes Dev) might be helpful in illuminating which partners, and thus which pathways in ribosome biogenesis, may be affected by this mutation.Figure 4.Figure 4B. Western lot analysis should be accompanied with a quantification graph. Also, compare this to Figure 5A. Why are they so different?Figure 4C. Since the mutation associated with ANE is in RRM3, one would like to see a construct expressing RRM1, 2 and 4 only. This would be a great negative control.The protocol notes that the growth time for the Y2H assay in 4C was 2 weeks. Those familiar with Y2H assays might be concerned about the high false positive rate when these assays are performed in the cold for such a long time.Co-immunoprecipitation assays would serve as orthogonal test of the protein -protein interactions.Figure 5.Figure 5A, lanes 2 and 3 have a lot of background. Additionally, the figure lacks quantification.Again the growth assays in 5C and 5D a) contain random time points (time points not equally spaced) b) missing quantification of doubling time and c) the EV control is dead in the dilution spot assays, however it grows in liquid media.In Figure 5C the scale on Y-axis is misleading. It seems that the log scale on Y-axis starts at 'zero' because the origin is not labeled. The next tick upward on the Y-axis is also not labeled.Figure 6.Again, Figure 6A top panel (gel) uses Ethidium bromide to quantify the 25S and 18S rRNA. However, here, we can actually see a difference at 30°C.In 6B the significance of the ratios 25S/18S, 35S/Scr1, 27S/Scr1 and 7S/Scr1 is calculated as compared to the EV control. However, EV control strain is dead. As noted above, the proper comparison should be to WT.There is no way to compare the quantitative graphs in Figure 2C with Figure 6B because Figure 2B lacks a loading control. This results in an apples to oranges comparison that only serves to confuse the reader. For example, the claim that RRM 3-4 significantly restored the pre-rRNA processing defects at 23°C is supported by the data in 6B as there is a discernable difference in the ratios. However, the similar analyses shown in Figure 2C indicate that the differences are lesser, but the claim is that the effects are greater. I am totally confused.Figure 7.This is the biophysical characterization of the mutant, but it is done with the RRM3 fragment of the human protein. While I do not have a problem with the switch from yeast-based studies to the human protein, an explanation for why would be informative. (Indeed, one might ask, if the human protein can complement deletion of Nop4 in yeast, why weren't these studies performed using the human protein to begin with?). Figure 7B (NMR data) requires more explanation to illuminate the differences between the WT and the mutant protein structure. As written, the information content is minimal.Figure 7C needs labels: a) WT and mutant protein and b) location of the mutation L351P.Reviewer #4 (Additional data files and statistical comments):As noted in the long form review, quantitative analyses are lacking in some places, and the statistical analyses performed in Figures 2 and 6 need to be aligned.[Editors’ note: the author responses to the first round of peer review follow.]Reviewer #2:The authors make the surprising finding that RRM3 and 4 of Nop4 are sufficient to confer function and they seem to do so by mediating protein-protein interactions. One experimental issue is that Nop4 functions within the nucleolus and thus needs to be targeted there to function. A quick perusal of the literature shows no published information on how Nop4 enters the nucleus – which it must do to access the nucleolus. There are a number of predicted classical nuclear localization motifs and most are in the C-terminal domain of the protein. While this is not an issue for the two-hybrid system which presumably contains a nuclear targeting module, this could be an issue for the functional studies. The authors should really include localization as an aspect of their studies to validate their conclusions that the Rrm3-4 mediates the essential function of Nop4 and that Rrm1-2 is not sufficient to do so (see detailed comments below).Reviewer #2 makes an excellent point that the failure to rescue by RRM1-2 may simply be due to a mislocalization of this fragment. To address this concern, we repeated the growth complementation assays in Figure 5B and C using the yeast two-hybrid vector, pACT2, which will ensure nuclear localization. We found that even when targeted to the nucleus, RRM1-2 fails to rescue the growth defect conferred by depletion of endogenous Nop4 in both solid and liquid medium. Additionally, using immunofluorescence, we confirmed the nuclear localization of the Nop4 fragments expressed from the yeast two-hybrid vector, pACT2. These results have been included in the Results section and have been added to Figure 5—figure supplement 1.With the broad interactions examined, the use of the two-hybrid is quite reasonable; however, for at least some of the interactions, the authors should validate the loss of interaction with a biochemical approach. They could easily choose binding partners for which antibodies are available or employ commercially available TAP-tagged proteins.We have now done this and included the results in new panels of Figure 3. To validate the loss of interaction in the presence of the ANE syndrome mutation, we employed the co-immunoprecipitation approach described in (McCann et al. 2015, Genes & Dev). This assay utilizes yeastexpression vectors that express 3xHA or 3xFLAG tagged proteins of interest. We prefer not to use commercially available strains or antibodies as we find that making them ourselves provides greater experimental reliability. We assayed for the loss of interaction between Nop4 and Noc2, Mak5, Nop4, Nsa2 and Dbp10 when the ANE syndrome mutation (L306P) is present. We found that the co-immunoprecipitation results mirrored the yeast two-hybrid results. In the presence of the ANE syndrome mutation (L306P), the amount of co-purifying Nop4 was significantly reduced when immunoprecipitating with Noc2, Mak5, Nop4 and Nsa2 but was not significantly affected when immunoprecipitating with Dbp10. These results are discussed in the Results section and have been added to new panels in Figure 3.One minor issue that should be clarified is the reference to the Leucine to Proline amino acid substation as a point mutation. While this change in the codons could easily occur due to a single point mutation in the DNA that changes a leucine codon to a proline codon (presumably this is what happens in the patients?) – it is the amino acid change that is the consequence of the point mutation that causes the functional change. The authors should merely keep this in mind in finalizing the text.Thank you for this important comment. We have edited the text such that we refer to the Leucine to Proline mutation as an amino acid substitution rather than as a point mutation.Overall there are some relatively minor points that could enhance the impact of the studies but the experiments are nicely set up and the data presented support the conclusions drawn. Specific Comments: We have now done this. Figure 1A has been changed to include the amino acid alignment of the ~30 amino acids of RRM3 surrounding the conserved leucine that is mutated in ANE syndrome. The alignment has also been expanded to include four other species.Figure 3 employs two-hybrid screening to identify interactions that are lot or maintained with the L306P amino acid change. The approach is reasonable for the broad screening. However, the authors should validate at least a few of these differential interactions through a biochemical approach (co-immunoprecipitation being the logical approach). Such biochemistry would complement the rationale use of the two-hybrid analyses.We have now done this as stated above. We validated the loss of interaction in the presence of the ANE syndrome mutation, through the co-immunoprecipitation approach described in (McCann et al. 2015, Genes & Dev). We assayed for the loss of interaction between Nop4 and Noc2, Mak5, Nop4, Nsa2 and Dbp10 when the ANE syndrome mutation (L306P) is present. We found that significantly less Nop4 L306P was co-purified with Noc2, Mak5, Nop4 and Nsa2. These data are included in the Results and has been added to Figure 3.We have replaced the blot in Figure 5A and added molecular weight markers. The predicted sizes of the different domains have been added to the figure legend. Additionally, we have added either molecular weight markers or arrows marking the correct bands to all the western blots in the manuscript.The authors really do not comment on the temperature sensitive rescue of rRNA processing and growth by the Rrm3-4 fragment (Figures 5 and 6). The legend for Figure 6 does not mention the different temperatures. The authors need to provide some insight into why this rescue is temperature-dependent. Do they suspect that the domain may be less stable at higher temperatures? Some immunoblotting carried out from cells grown at the different temperatures might help to address this temperature-sensitive effect.We have added the temperature and length of depletion to the figure legend. At present we cannot speculate why rescue would work better at 30°C and 23°C than at 37°C though a likely explanation, as the reviewer points out, is that at higher temperatures the domain folds less well.The other experimental issue that should be addressed for this analysis is the localization of the protein domains. These fragments appear to be FLAG-tagged so it should be straightforward to examine the localization of the protein domains and append an NLS if needed. Could the two-hybrid clones be used to test for function? As we stated above, we have addressed this concern by repeating the growth complementation assays in Figure 5B and C using the yeast two-hybrid vector, pACT2, which will ensure nuclear localization. We found that even when targeted to the nucleus, RRM1-2 fails to rescue the growth defect conferred by depletion of endogenous Nop4. Furthermore, we confirmed the nuclear localization of the Nop4 fragments expressed from the yeast two-hybrid vector, pACT2, using immunofluorescence. These data have been included in the Results section and have been added to Figure 5—figure supplement 1.It would be nice to have a bit more information about how RBM28 rescues the yeast phenotype and whether the amino acid substitution in the human protein recapitulates the defects seen with the altered yeast protein. Although it has been shown by others that RBM28 can complement the growth defect upon inactivation of Nop4 (Kachroo et al. Science 2015), we have repeated the complementation experiment using a strain where we can conditionally deplete Nop4 by changing the carbon source in the growth medium from galactose to glucose (dextrose) (Figure 1B). We have discussed these new results in the Results section and included them in Figure 1—figure supplement 2. As previously reported in Kachroo et al., we found that RBM28 was able to complement the growth defect observed upon depletion of Nop4 at 37 °C, 30 °C and 23 °C, but not at 17°C, on solid medium.We chose not to study the mutated human protein (RBM28 L351P) in yeast because the mutation would be studied out of its natural context. Determining the effects of the human mutation in a more relevant experimental system, such as human cell culture or Xenopus tropicalis, both of which we have used previously to study ribosomopathies (Griffin et al. PLoS Geneti. 2015, Freed et al. PLoS Geneti. 2015), is an important future goal for my laboratory.The authors are now in a position to determine which interactions are critical for the function of Nop4. This point could be mentioned in the Discussion. We have added this to the Discussion.Reviewer #3:The authors have taken the observation, by others, that a recessive mutation in RBM28, a human homologue of Nop4 of yeast, causes ribosomopathy, and expanded on it with reference to their recent very nice work on the Processosome (McCann et al. G&D). They show that when this mutation is transferred to the yeast gene, the formation of 25S rRNA is partially disrupted, ( With all due respect, the reviewer is mistaken that we know that “the mutation causes substantial reduction of 60S ribosome synthesis in human cells.” Indeed, this is not known, either for human or yeast cells. Our work here is the first time the consequences of the mutation have been investigated experimentally in either organism. In Nousbeck et al. (2008) where the ANE syndrome was first described, the authors counted mature free cytoplasmic ribosomes in micrographs of cultured fibroblasts by transmission EM, and found that numbers were reduced in patients with ANE syndrome. That is the extent of the experiment: no analysis of 40S or 60S synthesis was done. So we do not yet know how the ANE syndrome mutation affects ribosome biogenesis in any organism. That is one reason why our work presented here is so important and highly significant.In addition, it is not true that “quite similar experiments were reported by Sun & Woolford in 1997.” While it is true that they made a missense mutation in RRM3, this mutation was at a different amino acid than the ANE syndrome mutation. They did not examine the effects of the ANE syndrome mutation, as it had not been discovered yet.I have a number of problems with the data, but overall I feel the authors have sold themselves short by not investigating just how the mutation affects 60S ribosome synthesis, which the yeast system is perfect for. Instead they have confined themselves to nibbling around the edges of a problem that they are in the perfect position to solve. While I am not in a position to critique We are concerned that the reviewer has read our manuscript with the mistaken impression that much of the work has previously been done, and therefore that our work does not provide much new insight. We vigorously disagree.First, as discussed above, the ANE syndrome mutation has not been studied at the biochemical level before in any organism. The results from patient material presented in Nousbeck et al. indicate reduced levels of free cytoplasmic ribosomes by counting them in electron micrographs. This is a non-biochemical and somewhat crude level of analysis that was probably a result of the limitations of obtaining patient material. This study here is the first to define the consequences of the ANE syndrome mutation in any organism, and therefore is valuable for furthering our understanding of this ribosomopathy, and of ribosome biogenesis in general.Second, introducing the orthologous amino acid change that causes ANE syndrome into yeastNop4, we were able to pinpoint its effects on growth and pre-rRNA processing, and to define precisely how defective the mutated Nop4 is for the first time. Similarly, these experiments have not been done or published before in any organism. It is critical for understanding the molecular basis of ANE syndrome to determine the extent to which the mutated protein causes defective pre- rRNA processing, as we have done.Third, based on our recent published work finding that Nop4 is a hub protein in the LSU processosome interactome (McCann et al. Genes Dev 2015), we have gone one to show unexpected and surprising aspects of the function of the RRMs in Nop4. While RRMs are named for being RNA binding domains, we find here that instead they play a critical role in protein interaction. Introduction of the ANE syndrome mutation into RRM3 reduces interaction with a subset of proteins, as we have now shown by two methods. Furthermore, RRMs 3-4 are sufficient for protein interaction and growth, a truly novel finding.We do not understand how this extensive work that required 7 figures with an average of about 4 parts, all of which are new experiments that have never been done before and that provide a molecular basis for the ANE syndrome for the first time, can be considered “nibbling around the edges of a problem.” The reviewer writes that “the authors have sold themselves short by not investigating just how the mutation affects 60S ribosome synthesis.” But this is exactly what we have done.Reviewer #4:In this manuscript McCann et al.investigate the molecular basis of ANE syndrome pathogenesis. ANE syndrome is caused by a mutation in the nucleolar protein RBM28 (L351P) which affects the LSU processome resulting in ribosome biogenesis defects. McCann et. al use yeast as a model to study the effect of ANE mutation on the structure and function (as a hub protein) using the homologous protein, Nop4p. The authors first validate the model system, demonstrate that the ANE mutation affects Nop4 "hub" function, investigate the molecular biology of the RRM3 and RRM4 domains of Nop4 and conclude with biophysical analyses demonstrating that the L351P mutation disrupts folding of the RRM3 domain. This is a very straightforward study employing basic yeast molecular genetics and complemented with some nice biophysical studies. The conclusions are warranted by the data. However, the work could benefit from some minor improvement, and some of the data analyses are questionable.The abbreviation EV is not explained/mentioned in the figure legend and text.We are sorry that this was not clear enough. While, the abbreviation EV is explained in the Results and in the legend for Figure 3 we did not explain it consistently in the entire manuscript. We have now edited the text such that EV is defined in every section of the Results and in every figure legend, as requested.Figure 1C is missing quantification. This is important because Nousbeck et. al 2008 reported that decreased expression of mutant RBM28 in ANEpatient cells. Also, the presence of additional bands in the anti-FLAG and anti-Mpp10 blots are not explained.While the reviewer makes an excellent point that Nousbeck et al. observed a substantial difference in expression of RBM28 in the humanANEpatient cells, this experiment is different. Both Nop4 WT and Nop4 L306P are being constitutively expressed from a highly expressing promoter on a plasmid. Thus, we would expect them to be expressed at fairly similar levels, which is what we observe when we quantitate the bands. We have now included the quantitation in the figure legend. Additionally, we have labeled the extra bands in the figure and explained them in the figure legend.The growth defect for the Nop4 L306P expressing strain is described as 'severe' as compared to the EV expressing strain (for 1D and 1E). However, the EV expressing strain is essentially "dead' (in 1D). Thus, the proper comparison should be of the mutant to the WT. This renders the growth defect 'moderate'.We are sorry to disagree with this reviewer but this is factually incorrect. While the reviewer claims that the growth defect for Nop4 L306P is described as “severe as compared to the EV expressing strain,” the text actually reads: “The L306P mutation impaired growth at all temperatures tested compared to WT, although the defect was not as severe as that observed with the EV control (Figure 1D).” We agree with this reviewer that the growth defect was moderate which is also consistent with our conclusion that the ANE syndrome mutation is a hypomorphic allele.The growth assays in Figure 1E have some issues: a) the time points are randomly selected (more time points are clustered around 20 hrs).The growth curve in Figure 1E has been replaced with a growth curve with more time points that are less clustered around 20 hours. It is important to note that the result is the same even though there are more time points and they are less clustered.b) The data could be quantified, i.e. doubling times should be calculated.Accurate doubling times cannot be calculated from this type of experiment because the growth rate changes over time. However, we have estimated the doubling times based on the new growth curve in Figure 1E. The doubling times have been included in both the figure and the Results.c) While the EV expressing strain is dead in the dilution spot assays, it seems to have grown to in the liquid media. This can be explained as a consequence of residual Nop4 after gene shutoff. The reviewer is correct that the empty vector (EV) expressing strain does not grow in the dilution spot assays but does grow in liquid media. The EV strain is able to grow in liquid media because the GAL promoter is known to be leaky (Park et al. Yeast 2011). Furthermore, growth in liquid medium is quantitative and allows for the estimation of doubling times. This is why we assay growth both ways.Figure 1—figure supplement 3: While it is clear that the authors did identify the correct yeastleucine residue to mutate, the use of a simple 1 to 1 protein alignment also gives the impression of someone having done the minimal effort. Additional alignments and phylogenetic analyses are simple to perform, and would lend more credibility to the choice of which leucine to mutate.We have repeated the alignment analyses with more species included rhesus (M. mulatta), mouse (M. musculus), frogs (X. tropicalis) and fish (D. rerio). We have edited Figure 1A such that it now includes the expanded amino acid alignment of the ~30 amino acids of RRM3 surrounding the conserved leucine that is mutated in ANE syndrome.Additionally, we have added a new supplemental figure (new Figure 1—figure supplement 1) that is the full alignment of RRM3 from humans, yeast, rhesus, mouse, frogs and fish.From these expanded analyses, we can confidently conclude that we had identified and mutated the correct leucine in yeastNop4 as the reviewer points out.Figure 2.There are some significant problems with this figure, especially as it compares with Figure 6. In general, it appears that Figure 2 and Figure 6 were performed by different people at different times each having different standards for quality and data interpretation.In the text, the reference to Yes, the reviewer is absolutely correct that we reference the processing schema in Figure 2A. We were trying to help the reader understand the complexity of pre-rRNA processing and the nature of the Nop4 depletion phenotype by pointing them to a diagram. As the Nop4 depletion processing phenotype has already been published, we included the references to the relevant papers (Sun and Woolford EMBO 1994, Berges et al. EMBO 1994). However, to be more clear, we have also included a reference to the northern blots in Figure 2B, which show the same defect.Figure 2B top panel (gel) uses Ethidium bromide to quantify the 25S and 18S rRNA. The method is not terribly sensitive for quantitation. To be honest, I cannot discern the differences between the wild-type and mutant in either the top or bottom panels of Figure 2B that are graphed in panel C. Additionally, in the 48 hr EV lane, there is so little rRNA (because the cells are dead) that it borders on disingenuous to claim any quantitation in Panel C. Compare these gels/autorads to those shown in Figure 6: these ones are much less informative.Ethidium bromide is commonly used to visualize and quantify the mature rRNAs in both yeast and human cell systems (Tafforeau et al. Mol Cell 2013, Freed and Baserga NAR 2010, Fatica et al. MCB 2003, Tollervey et al. Cell 1993, Russell and Tollervey J. Cell Biol. 1992).We have included Author response table 1 and Author response image 1 to substantiate our claim that the ANE syndrome mutation disrupts processing of the 25S based on the ethidium bromide staining and subsequent quantitative analysis of the mature 25S and 18S rRNAs. Author response table 1 contains the quantitative analysis of the 25S and 18S rRNAs by ethidium bromide staining. Image J is much more sensitive than the naked eye and was able to detect signal from the empty vector (EV) lane. Author response image 1 includes a longer exposure of the ethidium bromide stained gel from Figure 2B. In this longer exposure, the 25S rRNA is much more visible (Author response image 1A). However, we chose not to use this particular image in the figure because the other lanes are significantly overexposed. Additionally, we have included an image of one methylene blue stained membrane that was subsequently used for northern blot analysis (Author response image 1B left panel). Methylene blue also detects the mature 25S and 18S rRNAs. We have repeated the quantitative analysis of the 25S and 18S rRNAs and obtained the same result (Author response image 1B right panel).
Author response image 1.
The ANE syndrome mutation (L306P) disrupts 25S production in yeast.
(A) Left panel: longer exposure of the ethidium bromide stained gel in Figure 2B. Total RNA was extracted from yeast expressing no Nop4 (EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for the indicated time. Right panel: The ratios of the mature rRNAs (25S/18S) were calculated from four replicate EtBr experiments and were plotted with error bars representing the standard deviation. Significance compared to WT was evaluated using one-way ANOVA. (B) Left panel: Methylene blue stained membrane of the northern blot in Figure 2B. Total RNA was extracted from yeast expressing no Nop4 (EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for the indicated time. Right panel: The ratios of the mature rRNAs (25S/18S) were calculated from four replicate methylene blue experiments and were plotted with error bars representing the standard deviation. Significance compared to WT was evaluated using one-way ANOVA. **** indicates a p value <0.0001. ***indicates a p value <0.001.
DOI:
http://dx.doi.org/10.7554/eLife.16381.019
We are sorry that the reviewer does not discern a difference between the wild-type and the mutant by eye. This is why it is so important to include a quantitative analysis. We agree with the reviewer that the differences are subtle, which is consistent with the ANE syndrome mutation being a hypomorphic allele. However, as we have demonstrated, there is a method independent, reproducible, statistically significant difference between 25S/18S ratios for the wild-type and the ANE syndromeNop4 mutant protein.Author response table 1: ethidium bromide raw data and quantitation25S18S25S/18S25S/18S NormEV 06259.44710810.880.5789951.115136709EV 08290.41810043.830.8254241.058714794EV 08786.4476811.0331.2900311.238299455EV 05530.1548089.9830.683580.916887383EV 48201.021986.2340.2038270.18200229EV 48795.7492513.8610.3165450.283377889EV 48616.7991853.6690.3327450.150671679EV 48316.6071720.5980.184010.188479377Nop4 WT 04093.647884.2960.5192141Nop4 WT 07770.0049966.0540.7796471Nop4 WT 04694.1544505.9121.0417771Nop4 WT 04193.2765624.4470.7455451Nop4 WT 4810630.429492.1751.1199141Nop4 WT 488969.2968029.5181.117041Nop4 WT 4810882.324927.6692.2084111Nop4 WT 488543.3478750.8610.9762861Nop4 L306P 04376.9838405.1750.5207491.002954827Nop4 L306P 07532.9839358.9330.8048981.032387275Nop4 L306P 05838.3474754.1541.2280521.178805166Nop4 L306P 06387.3977497.690.8519151.142675222Nop4 L306P 481967.6696570.5390.2994680.267403102Nop4 L306P 481861.0123429.5980.5426330.485777142Nop4 L306P 489506.0546683.791.4222550.644017451Nop4 L306P 487573.76111640.350.6506470.666451283
The ANE syndrome mutation (L306P) disrupts 25S production in yeast.
(A) Left panel: longer exposure of the ethidium bromide stained gel in Figure 2B. Total RNA was extracted from yeast expressing no Nop4 (EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for the indicated time. Right panel: The ratios of the mature rRNAs (25S/18S) were calculated from four replicate EtBr experiments and were plotted with error bars representing the standard deviation. Significance compared to WT was evaluated using one-way ANOVA. (B) Left panel: Methylene blue stained membrane of the northern blot in Figure 2B. Total RNA was extracted from yeast expressing no Nop4 (EV), Nop4 WT or Nop4 L306P after depletion of endogenous Nop4 for the indicated time. Right panel: The ratios of the mature rRNAs (25S/18S) were calculated from four replicate methylene blue experiments and were plotted with error bars representing the standard deviation. Significance compared to WT was evaluated using one-way ANOVA. **** indicates a p value <0.0001. ***indicates a p value <0.001.DOI:
http://dx.doi.org/10.7554/eLife.16381.019Unlike Figure 6A, Figure 2B is missing a loading control.To address this concern, we have re-probed the relevant northern blots with the loading control, Scr1. Additionally, we have updated our analysis of the data to include the ratios of the individual pre-rRNA species to the loading control. The Scr1 loading control blots and the additional quantitative analyses are now included in Figure 2B, C. We have also edited the Results to include this new data. The quantitation of the levels of the individual pre-rRNA species compared to the loading control further supports our claim that the ANE syndrome mutation disrupts processing of the large subunit ribosomal RNAs, as there is a subtle but statistically significant decrease of the 7S pre-rRNA in the presence of the ANE syndrome mutation.The claim that Nop4 L306P results in 'severe reduction in 27S and 7S levels…' (subsection “The ANE syndrome mutation causes pre-rRNA processing defects in yeast”, last paragraph) is not supported by the quantification in 2C. The fold change as compared to WT is moderate.We are sorry to disagree with this reviewer but this is factually incorrect. In the text, we wrote: “Depletion of Nop4 resulted in a severe reduction of 27S and 7S levels, with a concomitant decrease in the 27S/35S and 7S/35S ratios, indicative of an ITS1 processing defect, as has been previously observed (Figure 2B, C; Bergès et al. 1994, Sun and Woolford 1994). The Nop4 L306P mutant showed an intermediate growth defect and also displayed an intermediate, but statistically significant ITS1 processing defect as indicated by reduced 27S/35S and 7S/35S ratios (Figure 2B, C).” We did not claim that the mutation resulted in a severe reduction. To attempt to make this more clear, we have rewritten this section.The claim that the EV control had most severe reduction in 25S/18S ratio and also 27S and 7S levels (subsection “The ANE syndrome mutation causes pre-rRNA processing defects in yeast”) again borders on disingenuous, because this mutant is dead, or at the very least, in the process of dying.An empty vector (EV) is frequently used in my laboratory and in others as a null control in experiments to ascertain the affect of depletion or mutation on yeast growth and/or ribosome biogenesis (Ferreira-Cerca et al. NAR 2014, Qiu et al. PNAS 2014, Tomecki et al. EMBO 2010, Freed and Baserga NAR 2010, Bohnsack et al. Mol Cell 2009, Bohnsack et al. EMBO 2008, Leulliot et al. NAR 2007, Bleichert et al. PNAS 2006, Kos and Tollervey Mol Cell 2005). Nop4 is essential and yeast depleted of Nop4 (EV null control) will eventually die. However, as the growth curves in Figure 1E and Figure 5C, D demonstrate, we harvested RNA while the EV control strain was still doubling.The statistical comparisons in Figure 2C are different than those in Figure 6B. Here, comparisons are performed with respect to wild-type (which is correct). In 6B, the comparisons are with respect to empty vector (which is wrong, again because EV is dead).The statistical comparisons in Figure 2 and Figure 6 are different because the experiments, and therefore, the null hypotheses, are different. In Figure 2, the experiment was to test whether the presence of the mutation disrupts Nop4 function. The null hypothesis is that the mutation does not alter Nop4 function. The expectation is that the mutant will behave like the wild type. Therefore, the statistical analyses were done comparing the mutant to wild type.In Figure 6, the experiment was to test whether a fragment of Nop4 can complement the pre-rRNA processing defect due to Nop4 depletion. The null hypothesis is that the fragments will not complement. The expectation, then, is that the fragments will behave like the empty vector control (no complementation). Thus, the statistical analyses were done comparing the fragments to the empty vector.Figure 3.It is unclear why such a small panel of bait reporters were assayed here, especially in light of the fact that the lab possesses 23 bait reporters already (as shown in Figure 4). Again, were Figure 3 and Figure 4 done by different people? Assaying the entire panel would illuminate the role of Nop4 in the interactome and the consequences of the mutation.Figure 3 was intended to demonstrate that the presence of the ANE syndrome mutation (L306P) disrupts some, but not all, protein-protein interactions. The reviewer does make a good point that assaying the entire panel would be important for thoroughly mapping the interactions that are disrupted by the mutation. We plan to complete the yeast two-hybrid with the entire panel of bait reporters as part of a future manuscript.Including the Nop4 interactome map of as an additional panel (from McCann, K. L et.al 2015. Genes Dev) might be helpful in illuminating which partners, and thus which pathways in ribosome biogenesis, may be affected by this mutation.Copyright prohibits us from re-publishing this figure. We made a table and have now included it in the supplementary material for the reviewer’s convenience.Figure 4.Figure 4B. Western lot analysis should be accompanied with a quantification graph. Also, compare this to Figure 5A. Why are they so different?We have quantitated the bands and have updated the figure legend to include this information. While the western blot in Figure 5A has been replaced with a cleaner image (with quantitation), both the original blot and the new blot in 5A show the same trends as seen in the western blot in Figure 4B: Nop4 RRM 1-2 is expressed at much higher levels than Nop4 WT while Nop4RRM 3-4 is expressed at lower levels than Nop4 WT. It is not clear why there are such dramatic differences in expression. However, since the trends remain the same across different expression vectors (pACT in Figure 4B and p414GPD 3xFLAG in Figure 5A), this result is likely due to differences in the function, localization and/or stability of the fragments.Figure 4C. Since the mutation associated with ANE is in RRM3, one would like to see a construct expressing RRM1, 2 and 4 only. This would be a great negative control.We agree with the reviewer that it is critical to determine how the individual RRMs in Nop4 contribute to Nop4 function. It has been shown previously that all 4 RRMs are essential for Nop4 function in vivo. More specifically, mutations to highly conserved amino acids within the individual RRMs of Nop4 were all temperature sensitive and all perturbed assembly of the large ribosomal subunit (Sun and Woolford JBC 1997). However, the precise function of each RRM of Nop4 has yet to be determined. This is an important future goal for my laboratory.For this manuscript, we did generate a construct expressing only RRM3 and attempted to determine if RRM3 alone was sufficient to mediate protein-protein interactions by yeast two-hybrid. However, RRM3 alone is not expressed and therefore its function could not be assayed in any experiments. This has been added to the Results.The protocol notes that the growth time for the Y2H assay in 4C was 2 weeks. Those familiar with Y2H assays might be concerned about the high false positive rate when these assays are performed in the cold for such a long time.We are confused about why the reviewer thought we did the experiment at 4°C, where yeast will not grow, as this was not written in the text. We are also confused about the literature that the reviewer draws on about the high false positive rates for Y2H experiments performed in the cold. We are not aware of such a literature and we have been doing Y2H experiments since 1999 (Lee & Baserga 1999 MCB).As with other, published Y2H experiments from us and others (McCann 2015 Genes & Development, Rolland 2014 Cell, Hegele 2012 Mol. Cell, Charette and Baserga 2010 RNA, Freed and Baserga 2010 NAR, Wong 2007 MBC, Ito 2001 PNAS, Drees 2001 JCB, Uetz 2000 Nature), the Y2H experiments in this manuscript were always performed at 30°C. This was included in the methods for the ANE syndromeY2H experiment but had not been included for the fragment Y2H experiment. The published screen (McCann 2015 Genes & Development) was actually incubated for 3 weeks at 30°C. We have now indicated the 30°C temperature in the methods for this experiment.Co-immunoprecipitation assays would serve as orthogonal test of the protein -protein interactions.The use of the yeast two-hybrid assay to identify protein-protein interactions has been validated extensively by our lab and others (McCann 2015 Genes & Development, Hegele 2012 Mol. Cell, Wang 2011 Mol Syst Biol., Suter 2007 Genome Res.). The vast majority of high-confidence interactions identified by yeast two-hybrid are recapitulated by co-immunoprecipitation. All of the Nop4 interactions examined here have been previously validated by co-immunoprecipitation (McCann 2015 Genes & Development). Thus, we feel confident in our use of the yeast two-hybrid assay to identify biologically relevant protein-protein interactions. The yeast two-hybrid assay in Figure 4C was performed twice and the same interactions were observed. Most importantly, there is a striking difference between the number of interactions mediated by Nop4 RRM 1-2 and Nop4RRM 3-4 despite the fact that Nop4 RRM 1-2 is expressed at higher levels (Figure 4B).Figure 5.Figure 5A, lanes 2 and 3 have a lot of background. Additionally, the figure lacks quantification.We have replaced the western blot in Figure 5A. We have also included a lighter exposure of the Nop4 RRM 1-2 since it is significantly overexpressed in comparison to Nop4 WT and Nop4RRM 3-4. We have included the quantitation in the figure legend.Again the growth assays in 5C and 5D a) contain random time points (time points not equally spaced);We are sorry that the reviewer is unhappy with the spacing of the time points for these growth assays. However, both growth assays have been carried out three times, with each replicate having the same number of time points, and the end result is always the same. Having more or better-spaced time points does not change that.b) Missing quantification of doubling time;As we stated above, accurate doubling times cannot be calculated from this type of experiment because the growth rate changes over time. However, we have estimated the doubling times and included them in the figure and the Results.c) The EV control is dead in the dilution spot assays, however it grows in liquid media.Again, the reviewer is correct that the empty vector (EV) expressing strain does not grow in the dilution spot assays but does grow in liquid media. This is not a concern for the reasons listed above.In Figure 5C the scale on Y-axis is misleading. It seems that the log scale on Y-axis starts at 'zero' because the origin is not labeled. The next tick upward on the Y-axis is also not labeled.We have added the appropriate labels for the Y-axis.Figure 6.Again, Figure 6A top panel (gel) uses Ethidium bromide to quantify the 25S and 18S rRNA. However, here, we can actually see a difference at 30°C.We are glad that the reviewer can visually detect a difference in 25S rRNA levels by ethidium bromide staining. As the quantitation of the ratio of 25S/18S in Figure 2 and Figure 6 demonstrates, the Nop4 RRM 1-2 and Nop4RRM 3-4 fragments have a much greater reduction in the 25S/18S ratio than the ANE syndrome mutation (L306P), which is why it is easier to observe by eye.In 6B the significance of the ratios 25S/18S, 35S/Scr1, 27S/Scr1 and 7S/Scr1 is calculated as compared to the EV control. However, EV control strain is dead. As noted above, the proper comparison should be to WT.We are sorry, but we disagree with the reviewer. This experiment is to test whether a fragment of Nop4 can complement the pre-rRNA processing defect due to Nop4 depletion. In this case, the null hypothesis is that the fragments will not complement, meaning they will behave like the empty vector (EV) control. Thus, the statistical analyses were done comparing the fragments to the empty vector. This is distinctly different than Figure 2 where the null hypothesis is that the mutation does not disrupt Nop4 function and is thereby expected to behave like Nop4 WT. That is why the statistical analyses were done comparing the mutant to the wild type in Figure 2.There is no way to compare the quantitative graphs in Figure 2C with Figure 6B because Figure 2B lacks a loading control. This results in an apples to oranges comparison that only serves to confuse the reader. For example, the claim that RRM 3-4 significantly restored the pre-rRNA processing defects at 23°C is supported by the data in 6B as there is a discernable difference in the ratios. However, the similar analyses shown in Figure 2C indicate that the differences are lesser, but the claim is that the effects are greater. I am totally confused.We have included a loading control, Scr1, to Figure 2B and have added the quantitative analysis of the ratios of the pre-rRNA precursors 35S, 27S and 7S to Scr1 in Figure 2C. This now allows for a comparison of the data in Figure 2 to the data in Figure 6. However, it is important to remember that while the assays are the same, the questions we are asking in Figure 2 vs. Figure 6 are different.Additionally, as we stated above, we claimed that the ANE syndrome mutation causes a statistically significant, moderate processing defect. At no point in the manuscript did we compare the data in Figure 2 and Figure 6 and claim that the differences in Figure 2C are greater.Figure 7.This is the biophysical characterization of the mutant, but it is done with the RRM3 fragment of the human protein. While I do not have a problem with the switch from yeast-based studies to the human protein, an explanation for why would be informative. (Indeed, one might ask, if the human protein can complement deletion of Nop4 in yeast, why weren't these studies performed using the human protein to begin with?).We have included a sentence to explain that we switched to the human protein for the structural studies because the yeast protein was not soluble at the high concentrations needed for the biophysical studies.Figure 7B (NMR data) requires more explanation to illuminate the differences between the WT and the mutant protein structure. As written, the information content is minimal.We are uncertain what additional explanation is requested for the NMR data. As stated in the manuscript, we can conclude that the WT RBM28RRM3 is a folded, globular protein based on the well-dispersed resonances in the 15N-HSQC spectrum, and we can conclude that the L351P substitution disrupts the domain structure based on the clustering of resonances from 8.0 to 8.5 ppm in the 1H dimension of the 15N-HSQC spectrum. Additional analysis is included in the figure legend indicating that decreased dispersion of glutamine and asparagine side chain resonances are also consistent with disrupted domain structure.Figure 7C needs labels: a) WT and mutant protein and b) location of the mutation L351P.We have added labels to clarify that Figure 7C is a ribbon diagram of a homology model of the WT humanRBM28RRM3 with the amino acid that is mutated in ANE syndrome (L351) shown with red space-filling spheres. The two images are different views of the same model and do not represent the WT vs. the mutant protein, since the mutant protein is unstructured. We added a rotational arrow to make this clear.Reviewer #4 (Additional data files and statistical comments):As noted in the long form review, quantitative analyses are lacking in some places, and the statistical analyses performed in Figures 2 and 6 need to be aligned.We have included quantitative analyses of all western blots. We did not change the statistical analyses for the reasons stated above.
Authors: Carson J Bryant; Cláudia F Lorea; Hiram Larangeira de Almeida; Letícia Weinert; Leonardo Vedolin; Filippo Pinto E Vairo; Susan J Baserga Journal: Proc Natl Acad Sci U S A Date: 2021-05-11 Impact factor: 11.205
Authors: Jana Královicová; Ivana Ševcíková; Eva Stejskalová; Mina Obuca; Michael Hiller; David Stanek; Igor Vorechovský Journal: Nucleic Acids Res Date: 2018-07-06 Impact factor: 16.971