Polymorphic microsatellite loci for Haumania danckelmaniana and transferability to H. liebrechtsiana (Marantaceae).

PREMISE OF THE STUDY: Microsatellite markers were developed for the species Haumania danckelmaniana (Marantaceae) from central tropical Africa. METHODS AND
RESULTS: Microsatellite isolation was performed simultaneously on three different species of Marantaceae through a procedure that combines multiplex microsatellite enrichment and next-generation sequencing. From 80 primers selected for initial screening, 20 markers positively amplified in H. danckelmaniana, of which 10 presented unambiguous amplification products within the expected size range and eight were polymorphic with four to nine alleles per locus. Positive transferability with the related species H. liebrechtsiana was observed for the same 10 markers.
CONCLUSIONS: The polymorphic microsatellite markers are suitable for studies in genetic diversity and structure, mating system, and gene flow in H. danckelmaniana and the closely related species H. liebrechtsiana.

Haumania J. Léonard is a plant genus of the family Marantaceae endemic to central tropical Africa (Dhetchuvi, 1996). The genus comprises three species of climbers confined to the understory, gaps, and forest edges of lowland tropical rainforest. Haumania danckelmaniana (J. Braun & K. Schum.) Milne-Redh. is distributed from Cameroon and Equatorial Guinea to Gabon and northern Republic of the Congo. Haumania liebrechtsiana (De Wild. & T. Durand) J. Léonard can be found from Gabon to the Republic of the Congo and the Democratic Republic of the Congo. Haumania leonardiana G. Evrard & Bamps is distributed in northern Democratic Republic of the Congo. With their parapatric distribution pattern across phytogeographic domains in central Africa, species of the genus Haumania are of great interest in the field of phylogeography to extend our knowledge of the patterns and processes of speciation and intraspecific diversification in this tropical region. In this study, we isolated polymorphic microsatellite loci from H. danckelmaniana and showed that they can be transferred to the closely related species H. liebrechtsiana, allowing for further phylogeographic investigations in tropical central Africa.

METHODS AND RESULTS

Microsatellite primers were isolated in H. danckelmaniana at Genoscreen (Lille, France) using the 454 GS-FLX Titanium platform (454 Life Sciences, a Roche Company, Branford, Connecticut, USA) through a procedure that combines multiplex microsatellite enrichment and pyrosequencing (Malausa et al., 2011; Micheneau et al., 2011). Total DNA was extracted from silica gel–dried leaves using the NucleoSpin Plant kit (Macherey-Nagel, Düren, Germany). A mixture of ca. 5 μg of DNA of three species to simultaneously recover microsatellite primers in a single next-generation sequencing run (H. danckelmaniana, Hypselodelphys poggeana (K. Schum.) Milne-Redh., Marantochloa incertifolia Dhetchuvi, including multiple samples from the same locality per species; Appendix 1) was sent to Genoscreen, and was used to isolate microsatellite loci using a 1/32nd GS-FLX plate of the Roche Sequencer (454 Life Sciences, a Roche Company), following the protocol of Malausa et al. (2011).

We used Primer3 (Rozen and Skaletsky, 1999) implemented in the QDD bioinformatics pipeline (Meglécz et al., 2010) with the criteria described in Malausa et al. (2011) to automatically design 5657 primer pairs targeting 1285 microsatellite loci. From these, we selected 80 primer pairs representing the longest di- and trinucleotide repeats (≥8 repeats), and having more than 10 flanking nucleotides between microsatellite motifs and designed primers. The 80 designed primer pairs were first tested individually to verify amplification in H. danckelmaniana, with the following PCR conditions: 1 μL buffer (10×), 0.4 μL MgCl2 (25 mM), 0.3 μL dNTPs (10 mM each), 0.2 μL of each primer (0.01 mM), 0.05 μL Taq polymerase (TopTaq DNA Polymerase, 5 U/μL; QIAGEN, Venlo, The Netherlands), 1 μL of template DNA (of ca. 10–50 ng/μL, specimen ACL0711), and H2O to make a final volume of 10 μL. Amplifications were performed as follows: 94°C (4 min), followed by 40 cycles of 94°C (30 s), 56°C (45 s), 72°C (1 min), and a final extension at 72°C for 10 min. Twenty markers generated products as indicated on a 1% agarose gel stained with SYBR Safe (Invitrogen, Merelbeke, Belgium).

For these 20 markers, unambiguous amplification and levels of polymorphism were tested on up to seven individuals chosen across the entire species’ distribution range (Appendix 1) using a modified protocol of Schuelke (2000), which incorporates three primers (M13-like protocol) (for further details see Micheneau et al., 2011). Ten markers presented unambiguous amplification products within the expected size range, and eight of these were polymorphic (for primers see Table 1). These latter 10 loci also amplified in the closely related species H. liebrechtsiana using the same protocol as described for H. danckelmaniana.

Table 1.

Characterization of 10 microsatellite markers isolated from Haumania danckelmaniana.

Locus	Primer sequences (5′–3′)	Fluorescent labela	Repeat motif	Allele size range (bp)	A	Ta (°C)	GenBank accession no.
F2†	F: TGAAATGGAGGCACAGCTAA	Q4-PET	(TTC)16	123–155	6	59.93	KT806120
	R: AAAATTGGCATGGAGAGGTG
F28†	F: CATGGTGGTCTCCACTTTGC	Q1-6-FAM	(TCG)9	184–206	8	60.02	KT806121
	R: CCGACCACGTCTTACCAAGT
F41‡	F: GCAATTCTTTCCTGCTCACC	Q1-6-FAM	(TG)9	184	1	60.57	KT806122
	R: TGGGGACTTCGCAAGATAAA
F62†	F: ATTTCTTATCGCCTGCCTCA	Q3-VIC	(AG)8	256–263	5	60.15	KT806123
	R: TCTTCATGTGGTGTCTGGTCTC
F65†	F: TCCTCTTCATTCACTCGCTAGA	Q1-6-FAM	(TCT)8	235–244	4	60.54	KT806124
	R: TCTGCAAAGACAAACACAATCA
F66†	F: GAAGCAAGGCAATCACCATT	Q2-NED	(AAG)8	179–200	8	60.00	KT806125
	R: GCATAAATTCTCCACTAGCATGG
F67‡	F: TTTTAACGGAATCTTGCAGGG	Q4-PET	(CT)8	123	1	59.97	KT806126
	R: TTTTGCAGGAACCACCTACC
F70†	F: GCAATGCAGGCCATAGGTAA	Q4-PET	(ACG)8	198–211	5	60.21	KT806127
	R: CGCTTTACGAGGGCATTTTA
F74†	F: ACGCCTAGCAGCCAAGTAGA	Q3-VIC	(AGA)8	175–185	5	60.21	KT806128
	R: CGCAACCCCATACTCCATAC
F80‡	F: GGACTCAAAAGGAATCCTAAGACA	Q1-6-FAM	(CT)8	256–305	9	59.85	KT806129
	R: TGATCAAGGTGGGATGATGA

Note: A = number of alleles; Ta = annealing temperature.

Q1 = TGTAAAACGACGGCCAGT (Schuelke, 2000); Q2 = TAGGAGTGCAGCAAGCAT; Q3 = CACTGCTTAGAGCGATGC; Q4 = CTAGTTATTGCTCAGCGGT (Q2–Q4, after Culley et al., 2008).

†Locus included in multiplex.

‡Locus amplified in simplex.

With the eight polymorphic markers, preliminary population genetic analyses were carried out in two populations per species (H. danckelmaniana: Ivindo [Gabon, N = 22, coordinates: 0°11′21.84″S, 12°33′32.04″E] and Pallisco [Cameroon, N = 96, coordinates: 3°28′52.32″N, 13°34′41.88″E]; H. liebrechtsiana: East Mont de Cristal A and B [Gabon, N = 27, coordinates A: 0°35′48.84″N, 11°12′16.92″E and N = 72, coordinates B: 0°33′16.20″N, 11°6′20.16″E]). Seven of these loci were amplified in one multiplex reaction (see Table 1) using the QIAGEN Multiplex kit in a final 15-μL reaction volume. PCRs were carried out as follows: 7.5 μL Multiplex PCR Master Mix, 1.5 μL primer mix (with Q-tailed forward primers at 0.7 μM and reverse primers at 2 μM), 0.15 μL of each fluorescent Q1–Q4 primers (10 μM), 1.5 μL DNA, and 3.9 μL H2O. The multiplex PCR program consisted of 95°C for 15 min; followed by 23–30 cycles each of 94°C (30 s), 57°C (90 s), and 72°C (90 s); followed by 10 cycles each of 94°C (30 s), 53°C (45 s), and 72°C (45 s); and a final extension at 60°C for 30 min. The remaining locus (F80) was amplified in a separate PCR with a Taq DNA polymerase (QIAGEN) under the following conditions: 94°C (4 min); followed by 20 cycles each of 94°C (30 s), 56°C (45 s), and 72°C (1 min); plus 10 cycles each of 94°C (30 s), 53°C (45 s), and 72°C (45 s); and a final extension at 72°C for 10 min. One microliter of each PCR product was directly added to 12 μL HiDi formamide and 0.2 μL GeneScan 500 LIZ Size Standard and run on an ABI 3730 sequencer (Applied Biosystems, Lennik, The Netherlands). Alleles were defined using Peak Scanner software (Applied Biosystems). In a few individuals, some primer pairs did not yield amplification. Expected (He) and observed heterozygosities (Ho) and tests for deviation from Hardy–Weinberg equilibrium (HWE) were estimated in SPAGeDi version 1.3 (Hardy and Vekemans, 2002). Results were adjusted for multiple comparisons using a sequential Bonferroni correction.

He and Ho ranged from 0.354 to 0.720 and 0.318 to 0.810 (H. danckelmaniana Ivindo population), from 0.081 to 0.683 and 0.083 to 0.625 (H. danckelmaniana Pallisco population), from 0.073 to 0.866 and 0 to 0.818 (H. liebrechtsiana East Mont de Cristal A population), and from 0.135 to 0.859 and 0.085 to 0.775 (H. liebrechtsiana East Mont de Cristal B population), respectively (Table 2). Two loci showed a deviation from HWE in the Cameroon population of H. danckelmaniana and two and five loci showed the same in H. liebrechtsiana in the populations from Gabon and Cameroon, respectively. To check whether departure from HWE at a given locus might be explained by the presence of null alleles, we used the software INEST (Chybicki and Burczyk, 2009), which jointly estimates inbreeding and null allele frequencies under the individual inbreeding model. Null allele frequency estimates were significantly different from zero at all except two loci that deviated from HWE, indicating the presence of null alleles. In all cases, the estimated frequency of null alleles was <23%.

Table 2.

Characterization of eight polymorphic microsatellite loci from two populations of Haumania danckelmaniana and H. liebrechtsiana.

	H. danckelmaniana										H. liebrechtsiana
	Ivindo (Gabon)					Pallisco (Cameroon)					East Mont de Cristal, A (Gabon)					East Mont de Cristal, B (Gabon)
Locus	N	A	Ho	He	rb	N	A	Ho	Hec	rb	N	A	Ho	Hec	rb	N	A	Ho	Hec	rb
F2	22	4	0.409	0.614	0.143 ± 0.156	96	5	0.625	0.586	0.017 ± 0.030	27	7	0.148	0.142	0.083 ± 0.132	72	7	0.431	0.452	0.027 ± 0.046
F28	22	5	0.524	0.538	0.071 ± 0.112	92	5	0.511	0.491	0.027 ± 0.044	27	7	0.381	0.780**	0.230 ± 0.160d	65	7	0.492	0.787**	0.167 ± 0.084d
F62	22	3	0.682	0.622	0.053 ± 0.080	93	5	0.355	0.591**	0.149 ± 0.084d	27	3	0.593	0.654	0.073 ± 0.102	72	4	0.500	0.703**	0.118 ± 0.086d
F65	16	4	0.686	0.720	0.0635 ± 0.132	42	2	0.083	0.081	0.0634 ± 0.104	13	5	0.308	0.662**	0.107 ± 0.170	34	10	0.441	0.750**	0.063 ± 0.112
F66	21	2	0.409	0.485	0.110 ± 0.142	89	7	0.472	0.624**	0.101 ± 0.070d	21	6	0.333	0.357	0.080 ± 0.116	72	8	0.361	0.365	0.039 ± 0.060
F70	21	4	0.810	0.650	0.041 ± 0.070	93	5	0.591	0.683	0.055 ± 0.062	27	4	0.444	0.556	0.107 ± 0.124	71	8	0.775	0.797	0.026 ± 0.040
F74	22	3	0.318	0.354	0.083 ± 0.130	97	3	0.113	0.127	0.065 ± 0.078	27	4	0.000	0.073	0.157 ± 0.180	71	5	0.085	0.135**	0.103 ± 0.104d
F80	20	6	0.450	0.533	0.097 ± 0.134	87	7	0.402	0.480	0.082 ± 0.070	22	6	0.818	0.866	0.064 ± 0.086	57	11	0.509	0.859**	0.185 ± 0.088d

Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = sample size; r = null allele frequency.

For population details refer to Appendix 1.

pij ± (2*SE).

Asterisks indicate significant deviation from Hardy–Weinberg equilibrium after sequential Bonferroni correction (*P < 0.05, **P < 0.01, ***P < 0.001). Note that there were no deviations at the P < 0.05 or P < 0.001 level.

Indication for presence of null alleles based on INEST after 10,000 iterations.

CONCLUSIONS

The simple sequence repeat markers herein described are the first developed for H. danckelmaniana. These microsatellites are important tools for genetic studies in H. danckelmaniana and may be used to evaluate the genetic variability of the related species H. liebrechtsiana, aiming to elucidate questions regarding genetic diversity, spatial genetic structure, mating system, and gene flow.

Appendix 1.

Voucher information for Marantaceae specimens used in this study.

Species	DNA voucher	Country	Locality	Latitude	Longitude	Herbarium specimen	Collector	Collection datea
Haumania danckelmaniana (J. Braun & K. Schum.) Milne-Redh.	ACL0041b	Gabon	Ivindo	0°11′21.84″N	12°33′32.04″E	AL944	Ley, A.C.	27.11.2008
Haumania danckelmaniana	ACL0045b	Gabon	Mont de Cristal—east	0°36′42.48″N	11°12′48.96″E	AL710	Ley, A.C.	19.11.2008
Haumania danckelmaniana	ACL0051b	Gabon	Matote	0°52′01.20″N	13°31′09.12″E	AL1158	Ley, A.C.	05.12.2008
Haumania danckelmaniana	ACL0711b	Gabon	Bonzadie	0°46′40.44″N	13°08′13.56″E	AL511	Ley, A.C.	08.12.2008
Haumania danckelmaniana	ACL0724b	Gabon	Doussala	2°19′49.80″S	10°36′39.96″E	AL382	Ley, A.C.	04.11.2008
Haumania danckelmaniana	ACL0736b	Gabon	Mandji	1°40′50.52″S	10°21′11.16″E	AL549	Ley, A.C.	13.11.2008
Haumania danckelmaniana	ACL0776b	Gabon	Ivindo	0°10′06.60″N	12°29′57.48″E	AL899	Ley, A.C.	26.11.2008
Haumania danckelmaniana	ACL0846b	Republic of the Congo	CIB Pokola	2°09′01.80″N	16°10′37.92″E	JFG 62	Gillet, J.-F.	19.03.2009
Haumania danckelmaniana	ACL0992b	Cameroon	Mt. Elefant	2°48′09.36″N	10°01′42.24″E	AL491	Ley, A.C.	20.01.2009
Haumania danckelmaniana	ACL0994b	Cameroon	Mt. Elefant	2°48′06.84″N	10°01′28.20″E	AL504	Ley, A.C.	20.01.2009
Haumania danckelmaniana	ACL1003b	Cameroon	Mt. Elefant	2°47′54.96″N	10°01′11.28″E	AL523	Ley, A.C.	20.01.2009
Haumania danckelmaniana	ACL0878c	Cameroon	Bibondi	3°18′10.80″N	10°38′58.20″E	AL755	Ley, A.C.	06.02.2009
Haumania danckelmaniana	ACL0880c	Cameroon	Bibondi	3°18′10.80″N	10°38′58.20″E	AL755	Ley, A.C.	06.02.2009
Haumania danckelmaniana	ACL0882c	Cameroon	Bibondi	3°18′10.80″N	10°38′58.20″E	AL755	Ley, A.C.	06.02.2009
Haumania danckelmaniana	ACL0883c	Cameroon	Bibondi	3°18′10.80″N	10°38′58.20″E	AL755	Ley, A.C.	06.02.2009
Haumania danckelmaniana
Marantochloa incertifolia Dhetchuvi	ACL4317c	Gabon	Makokou	0°30′45.00″N	12°48′13.68″E	AL179	Ley, A.C.	23.09.2005
Hypselodelphys poggeana (K. Schum.) Miln.-Redh.	ACL1495c	Gabon	Mbigou, Mikoandza	2°01′20.64″S	12°3′11.88″E	AL413	Ley, A.C.	07.11.2008
Hypselodelphys poggeana	ACL1499c	Gabon	Mbigou, Mikoandza	2°01′20.64″S	12°3′11.88″E	AL413	Ley, A.C.	07.11.2008

Dates are presented in the format day.month.year.

Specimens used to test primer amplification and variability.

Specimens used to isolate microsatellite loci through multiplex microsatellite enrichment and next-generation sequencing.