| Literature DB >> 27007894 |
Ari P Araujo-Neto1, Hygor Ferreira-Fernandes1, Carolina M M Amaral2, Lina G Santos3, Antônio C Freitas2, Jacinto C Silva-Neto4, Juan A Rey5, Rommel R Burbano6, Benedito B da Silva3, France K N Yoshioka1, Giovanny R Pinto1.
Abstract
Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied.Entities:
Year: 2016 PMID: 27007894 PMCID: PMC4807381 DOI: 10.1590/1678-4685-GMB-2015-0122
Source DB: PubMed Journal: Genet Mol Biol ISSN: 1415-4757 Impact factor: 1.771
Primers used for amplification of the region of interest, and size of the PCR product.
| Primers | Base sequence (5'-3') | T | Size | Product (bp) |
|---|---|---|---|---|
| MDM2 – F | GATTTCGGACGGCTCTCGCGG | 66,5° C | 21 | 121 |
| MDM2 – R | CATCCGGACCTCCCGCGCTG | 66,5° C | 20 | |
| MY09 | CGTCC(AC)A(AG)(AG)GGA(T)ACTGATC | 55° C | 23 | 450 |
| MY11 | GC(AC)CAGGG(AT)CATAA(CT)AATGG | 55° C | 23 | |
| GP5+ | TTTGTTACTGTGGTAGATACTAC | 45° C | 23 | 150 |
| GP6+ | GAAAAATAAACTGTAAATCATATTC | 45° C | 25 | |
| Pr1 (HPV-16) | TCAAAAGCCACTGTGTCCTGA | 57° C | 21 | 119 |
| Pr2 (HPV-16) | CGTGTTCTTGATGATCTGCAA | 57° C | 21 |
T: annealing temperature;
bp: base pairs
Clinico-pathological characteristics of the samples
| Variable | Prostatic tumors (n = 104) |
|---|---|
| Mean age (SD) | 68 ± 8.5 |
| Gleason Grade (n = 97) | |
| Low (Gleason 2-6) | 6.2% |
| Moderate (Gleason 7) | 60.8% |
| High (Gleason 8-10) | 33.0% |
| Tumor extension (n = 96) | |
| T1 | 5.2% |
| T2 | 21.9% |
| T3 | 64.6% |
| T4 | 8.3% |
| Regional lymph nodes (n = 74) | |
| Absent | 85.1% |
| Present | 14.9% |
| Distant metastasis (n = 59) | |
| Absent | 86.4% |
| Present | 13.6% |
| HPV DNA (n = 104) | |
| Absent | 100% |
| Present | 0% |