Literature DB >> 26894321

New use for an old drug: COX-independent anti-inflammatory effects of sulindac in models of cystic fibrosis.

Jérémy Rocca1,2,3, Sylvie Manin1,3, Anne Hulin3, Abdel Aissat1,2,3,4, Wilfried Verbecq-Morlot2,3, Virginie Prulière-Escabasse1,2,3,5, Adeline Wohlhuter-Haddad1,6, Ralph Epaud1,2,3, Pascale Fanen1,2,3,4, Agathe Tarze1,2,3.   

Abstract

BACKGROUND AND
PURPOSE: Pulmonary disease is the main cause of morbidity and mortality in cystic fibrosis (CF) patients due to exacerbated inflammation. To date, the only anti-inflammatory drug available to CF patients is high-dose ibuprofen, which can slow pulmonary disease progression, but whose cyclooxygenase-dependent digestive adverse effects limit its clinical use. Here we have tested sulindac, another non-steroidal anti-inflammatory drug with an undefined anti-inflammatory effect in CF airway epithelial cells. EXPERIMENTAL APPROACH: Using in vitro and in vivo models, we NF-κB activity and IL-8 secretion. In HeLa-F508del cells, we performed luciferase reporter gene assays in order to measure i) IL-8 promoter activity, and ii) the activity of synthetic promoter containing NF-κB responsive elements. We quantified IL-8 secretion in airway epithelial CFBE cells cultured at an air-liquid interface and in a mouse model of CF. KEY
RESULTS: Sulindac inhibited the transcriptional activity of NF-κB and decreased IL-8 transcription and secretion in TNF-α stimulated CF cells via a cyclooxygenase-independent mechanism. This effect was confirmed in vivo in a mouse model of CF induced by intra-tracheal instillation of LPS, with a significant decrease of the induction of mRNA for MIP-2, following treatment with sulindac. CONCLUSION AND IMPLICATIONS: Overall, sulindac decrease lung inflammation by a mechanism independent of cycolooxygenase. This drug could be beneficially employed in CF.
© 2016 The Authors. British Journal of Pharmacology published by John Wiley & Sons Ltd on behalf of British Pharmacological Society.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26894321      PMCID: PMC4867744          DOI: 10.1111/bph.13464

Source DB:  PubMed          Journal:  Br J Pharmacol        ISSN: 0007-1188            Impact factor:   8.739


cystic fibrosis CF transmembrane conductance regulator inhibitor of NF‐κB keratinocyte‐derived chemokine bronchoalveolar lavage fluid cyclooxygenase non‐steroidal anti‐inflammatory drug

Tables of Links

These Tables list key protein targets and ligands in this article which are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Pawson et al., 2014) and are permanently archived in the Concise Guide to PHARMACOLOGY 2015/16 (Alexander et al., 2015a, 2015b).

Introduction

Cystic fibrosis (CF) is caused by mutations within the CF transmembrane conductance regulator (CFTR) gene leading to defective epithelial chloride transport in many organs. In the airway, CF is characterized by excessive mucus production, chronic bacterial infection, exaggerated inflammatory response, and progressive tissue damage. The identification of novel drugs to reduce lung inflammation is therefore considered a key therapeutic approach to prevent progressive lung tissue deterioration in CF (Koehler et al., 2004; Lands and Stanojevic, 2007; Taylor‐Cousar et al., 2010). Currently, the only therapy recommended by the CF Foundation to specifically alleviate the excessive airway inflammatory response is high‐dose ibuprofen, a non‐steroidal anti‐inflammatory drug (NSAID). Two independent clinical trials showed that high‐dose ibuprofen can slow disease progression (Konstan et al., 1991; Konstan et al., 2007; Lands and Stanojevic, 2007), but the risk of adverse effects such as gastrointestinal complications have limited its clinical use. Mechanisms independent of cyclooxygenase (COX) have been proposed to explain ibuprofen benefits in CF such as the inhibition of NF‐κB activity (Dauletbaev et al., 2010). However, this inhibition was not accompanied by decreased IL‐8 production (Dauletbaev et al., 2010). IL‐8 is the major PMN chemoattractant secreted by airway epithelial cells, whose secretion is reported in numerous studies to be increased in CF airway fluids (Jacquot et al., 2008). Here, we have assessed compounds with anti‐inflammatory activity (measured as decreased IL‐8 production) and with fewer COX‐related side‐effects. Sulindac sulfoxide (sulindac hereafter) (Z‐5‐fluoro‐2‐methyl‐1‐[4‐(methylsulfinyl) benzylidene]‐1H‐indene‐3‐acetic acid) is an NSAID that decreases PG production by inhibition of COX and is currently used in the treatment of chronic inflammatory diseases such as arthritis. It is a prodrug that can either be reversibly reduced to a pharmacologically active sulfide derivative, that inhibits COX, or be irreversibly oxidized to a sulfone derivative, inactive on COX. The reversible biotransformation of sulindac in equilibrium with sulfide provides a long half‐life for the active drug and a favorable gastrointestinal tolerance (Duggan et al., 1980; Duggan, 1981). Moreover, sulindac can act in the lung, as it dereased induced pulmonary fibrosis in rats (Verma et al., 2013). Interestingly, sulindac possesses a chemopreventive activity shown to involve COX‐independent mechanisms (Piazza et al., 1997; Han et al., 1998; Yamamoto et al., 1999; Babbar et al., 2003). The known targets modulated by sulindac to explain these properties and that are relevant to CF pathogenesis include ceramide (Chan et al., 1998 ), the PPARs (Babbar et al., 2003; Jarvis et al., 2005), PDEs acting on cGMP (Soh et al., 2000) and NF‐κB pathways (Yamamoto et al., 1999; Loveridge et al., 2008). In this study, we investigated the action of sulindac on lung inflammation in the context of CF therapy. We found that, like ibuprofen, sulindac inhibited NF‐κB transcriptional activity. However, in contrast to ibuprofen, sulindac also decreased IL‐8 transcription and secretion.

Methods

Cells

Stably transfected HeLa cells expressing wild‐type CFTR (HeLa‐WT), F508delCFTR (HeLaF508del) or pTracer (HeLa) were grown in DMEM containing 10% fetal calf serum (from Invitrogen). Human bronchial epithelial cell line CFBE41o‐, derived from a CF patient and stably expressing wild‐type CFTR (CFBE‐WT) and F508del CFTR (CFBE‐F508del) (Kunzelmann et al., 1993; Gruenert et al., 2004; Illek et al., 2008). CFBE cells were obtained and used following a special agreement with UCSF. CFBE cells were grown on Transwell inserts (Costar) in MEM containing 10% FCS (Kunzelmann et al., 1993; Gruenert et al., 2004). Cells seeded at 2.5 x 105 cells cm‐2 were placed at an air‐liquid interface after 24h and allowed to polarize for at least 6 days. MucilairTM epithelium is a 3D human airway epithelia reconstituted in vitro obtained from primary human bronchial cells from a single CF donor, homozygous for F508del (Epithelix, Geneva, Switzerland). All cells were grown at 37°C with 5% CO2. For treatment, drugs were added in DMEM with 1% FBS.

Plasmid construction and luciferase reporter assay

To assay the transcriptional activity of NF‐κB, a luciferase reporter plasmid, NF‐κB‐Luc (Stratagene, California, USA), containing five sequential NF‐κB binding sites upstream of a minimum promoter element, was used. To assay the transcriptional activity of IL‐8, a luciferase reporter plasmid containing the IL‐8 promoter (‐133 bp from the transcription start site) fused to the Luciferase gene was used (Edwards et al., 2005). Cells were transfected with the TurbofectTM In Vitro Transfection Reagent (Fermentas, Villebon, France), according to the manufacturer's protocol. A Renilla luciferase reporter construct (pRL‐TK, Promega, San Luis Obispo, CA, USA) was co‐transfected with each firefly luciferase construct. After 48 hours of transfection, cells were exposed to 10 ng·mL‐1 TNF‐α for 1 hour. Cells were pre‐treated and treated with sulindac, ibuprofen or vehicle control 1 hour before and 4 hours after induction with TNF‐α. Cells were lysed with the Passive Lysis Buffer (Promega, San Luis Obispo, CA, USA), and luciferase activity was determined with the Dual Luciferase Assay System (Promega, San Luis Obispo, CA, USA) using a luminometer (Tristar; Berthold, Thoiry, France). Relative luciferase activity was calculated by normalizing firefly luciferase activity against Renilla luciferase activity.

Protein extraction and Western blots

HeLaF508del cells were treated 24 h with VX‐809 (10 μM). Total protein fraction was extracted with RIPA buffer and Complete Mini EDTA‐free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN). For Western blots, equal amounts of proteins were resolved by 7% SDS‐PAGE and transferred onto polyvinylidene fluoride membrane (GE Healthcare, LittleChalfont, UK). The membranes were probed with specific antibodies anti‐CFTR 24‐1 (1:200) (R&D Systems, Minneapolis, MN, USA) and anti‐β actin (A5441; 1/10,000) (Sigma‐Aldrich, St‐Louis, USA) and detected with horseradish peroxidase (HRP)‐conjugated goat anti‐mouse IgG (1:50,000) (Sigma–Aldrich, St‐Louis, USA). The signal was detected using the enhanced chemiluminescence ECL Advance kit (GE Healthcare) and visualized using the G:BOX‐iChemi (Syngene, SynopticsLTD, UK).

Cytokine quantification

Levels of IL‐8 in the cell media were measured with the IMMULITE 1000 Automated Analyzer (Diagnostic Products Corp., Los Angeles, CA, USA) and commercially available chemiluminescent enzyme immunometric assay (Immulite®,DPC, Los Angeles, CA, USA), according to the manufacturer's instructions. In CFBE cells and bronchoalveolar lavage fluid (BALF), cytokines were quantified by ELISA (R&D Systems, Minneapolis, MN, USA), according to the manufacturer's instructions.

Animals models and ethical statement

All animal care and experimental protocols complied with INSERM guidelines and were approved by the Regional Ethical Committee C2EA‐16 (n°12.074‐11/12/12‐17). The experimental procedures used in the work were as humane as possible. The animal studies are reported as recommended by the ARRIVE guidelines (Kilkenny et al., 2010; McGrath & Lilley, 2015). Adult male C57BL/6J mice (8 weeks old; average weight 23‐26 g; Janvier, Le Genest‐Saint‐Isle, France) were fed normal mouse chow and water ad libitum. Adult (8‐16 weeks old) CF male mice homozygous for the F508delCFTR mutation (F508del/F508del) in the 129/FVB outbred background (cftrtm1Eur) (van Doorninck et al., 1995) (average weight 22 to 29 g) and their normal homozygous WT littermates (+/+) (average weight 22 to 33 g) were obtained from the “Centre de Distribution, de Typage et d'Archivage Animal” UPS44 CNRS (Orleans, France). To prevent CF‐induced intestinal obstruction, Movicol (55.4 g·L‐1) was added in drinking water and animals were fed with 2918 Teklad global 18% protein Rodent Diet (Harlan, Gannat, France)) ad libitum. All mice were reared and housed under standard conditions with air filtration (21±2°C; 12h Light/12h dark).

Sulindac quantification in mice

To optimize the timing of treatment of mice with sulindac, we developed a mass spectrometry‐based analysis technique to quantify sulindac in mouse serum and lung samples. C57BL/6J mice were injected i.p. with 40 mg·kg‐1 sulindac. At several time points, serum and lungs were collected and stored at ‐80°C. Sulindac was quantified by liquid chromatography–tandem mass spectrometry (LC‐MS/MS), performed by electrospray ionization in positive mode using a triple quadrupole mass spectrometer.

Stock and working solutions, internal standard, calibration standards

For each drug, a primary stock solution was prepared at 5 mg·mL‐1 in methanol or DMSO/methanol (v/v, 50/50) for sulindac and then stored at ‐80°C. Stock solutions were mixed together in order to get a methanolic working solution containing drug at 1 mg·mL‐1. It was used for the preparation of the calibration standards ranging from 39 to 10,000 ng·mL‐1. A 1 mg·mL‐1 diclofenac stock solution was prepared and used as internal standard. The calibration standard plasma samples were stored at ‐80°C prior to analysis. Ten‐point calibration standard curves have been calculated and fitted by least‐squares linear regression of the peak‐area ratio of each drug to IS against the concentrations of the corresponding drug in each standard. The assay proved to be linear and acceptable, as the regression coefficients were >0.99 for each of the three standard curves.

LC‐MS/MS conditions

The liquid chromatography consisted of a Thermo Scientific (Courtaboeuf, France) Accela® autosampler and a quaternary pump. Separation was performed on an Hypersil Gold® (2.1 x 100 mm; pore size 1.9 μm) analytical column placed in a thermostated column heater at 50°C. The chromatographic system was coupled to a triple quadrupole (TSQ) Quantum Ultra mass spectrometer (MS) from Thermo Fisher Scientific, equipped with an Ion Max electrospray ionization (ESI) interface and operated with XCalibur 2.07 software (Thermo Fisher Scientific Inc., Courtaboeuf France). The mobile phase used for chromatography was 10 mM ammonium formate buffer containing 0.1% (v/v) formic acid (solution A), and acetonitrile with 0.1 % (v/v) formic acid (solution B). The mobile phase was delivered using the following stepwise gradient elution program: run from 50:50 (A:B) to obtain 20:80 (A:B) at 13 minutes, conditions 50:50 (A:B) maintained from 13.1 to 15 minutes for equilibration. The thermostated column heater was set at 50°C and the autosampler was maintained at 4°C. The MS conditions were as follows: ESI in positive mode, capillary temperature: 325 °C: 10V, tube lens voltages were 110 and 240 for sulindac and diclofenac; collision energies (50 and 15 V); spray voltage: 3500 V; sheath and auxiliary gas (nitrogen) flow‐rate: 45 psi and 25 (arbitrary units), respectively. The Q2 collision gas (argon) pressure was 1.5 mTorr. Data were acquired in selected reaction monitoring (SRM) mode. Two transitions were selected for each analyte in order to improve the specificity of the assay: one was used for the quantitation 357.1 ‐ 233 for sulindac and 339.97 ‐ 321.9 for diclofenac and the other one for confirmation 357.1 ‐ 248 for sulindac (ion ratio of 80%). Quadrupole resolution on Q1 and Q3 were set to 0.7 FWHM. Scan width was 0.05 amu, scan time 0.04 ms. Data acquisition and processing were performed using the Xcalibur® (version 2.07) (ThermoScientific, San Jose, CA, USA). The assay proved to be linear and acceptable, as the regression coefficients were >0.99 for each of the twenty standard curves. The LLOQ was established at 39 ng·mL‐1 for sulindac. Mean intra‐day and inter‐day precisions were good with CVs within 4.3 and 9.8%. Matrix effects and extraction yields ranged from 84.6 to 109 % and 84.0 to 101.2% respectively.

Sample extraction procedures

Methanol (100μL for serum or 300μL for lung) containing 10 ng·mL‐1 diclofenac was added to each experimental sample. Standards were extracted in the same conditions. After vortexing, each sample was centrifuged at 6,000 x g at 4°C for 15 minutes. Samples of supernatant (50μL) were diluted two‐fold in the mobile phase A and 25 μL were injected into the HPLC system.

Model of acute lung injury (ALI) in mice

CF mice and WT littermates received intra‐tracheal instillation of 400 μg·kg‐1 LPS from P.aeruginosa (Sigma, St. Louis, MO) or an equivalent volume of saline, 1 h after i.p injection of 40 mg·kg‐1 sulindac. Three hours later, mice were anesthetized with 110 mg·kg‐1 ketamine and 4.8 mg·kg‐1 xylazine and bronchoalveolar lavage was performed by cannulating the trachea and lavaging with 4 x 0.5 mL sterile saline.

RNA extraction and mRNA quantification

RNA from lungs were extracted with Trizol® Reagent (Invitrogen), according to the manufacturer's instructions. The mRNA was DNAse treated for 30 min at 37°C before heat denaturation of the enzyme (Fermentas). The treated RNA (300 ng) was reverse transcribed using Maxima First Strand cDNA Synthesis Kit for RT‐qPCR (Fermentas). Resulting cDNA was then diluted by 5 in sterile distilled water and subsequently used as a template. Quantitative PCR was performed using SYBR Green Taq Ready Mix (Qiagen). Samples were amplified in a LightCycler® 480 System (Roche). Results were normalized to the amount of 18S RNA. RT and Q‐PCR analyses were performed in duplicate. The 2‐ΔΔCt method was applied to estimate relative transcript levels. The primer sequences were as follows: 18S_forward 5′‐AACTTTCGATGGTAGTCGCCGT‐3′,18S_reverse 5′‐TCCTTGGATGTGGTAGCCGTTT‐3′, KC_forward 5'‐AAGCTCCCTTGGTTCAGAAA ‐3', KC_reverse 5'‐TCAGAAGCCAGCGTTCAC‐3', CXCL2_forward 5'‐ GCCAAGGGTTGACTTCAAGA‐3', CXCL2_reverse 5'‐ CTTCAGGGTCAAGGCAAACT ‐3'.

Data and statistical analysis

These studies comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2015). The experimental procedures or treatment and data analyses were carried out with randomization and blinding. For in vivo studies, all groups were initially designed to contain 10 mice by group for C57BL/6J background and 6 mice for 129/FVB background. Sizes of the mice groups were different due to early death or technical difficulties in BALF procedure. For statistical analyses, we used raw data except for mRNA quantification by RT qPCR which have been normalized to the amount of 18S RNA. We used non parametric methods (Wilcoxon‐Mann‐Whitney for two groups' comparison or Kruskal‐Wallis for ≥3 groups comparison followed by Dunn's post hoc tests when F reached significance). For in vitro studies, we performed a minimum of 5 independent experiments, where individual data points were based on at least technical duplicates each. For statistical analysis, we used normalized data to reduced variability of baseline between independent experiments. Data were normalized in fold over vehicle without TNF‐α mean. For two group's comparison, we used unpaired Student's t‐test. When we compared ≥3 different groups, we first used one‐way ANOVA, and if F reached significance, two post hoc tests were used: the Dunnett post hoc test when comparing each group with Veh., or the Sidak post hoc test whenever multiple groups comparison was necessary. All analyses were performed on GraphPad Prism® version 6.0 software and P‐values of <0.05 were considered significant. For graphic representation, experimental values are expressed as a percentage of the mean value from the WT cells treated with Veh + TNF‐α.

Materials

Sulindac, sulindac sulfone, ibuprofen, human TNF‐α, NS‐398 and CFTR(inh)‐172 (inh172) were purchased from Sigma (St. Louis, MO) and VX‐809 (lumacaftor) was purchased from AbMol BioScience (Houston, USA).

Results

Effect of sulindac on the NF‐κB pathway

To demonstrate the effects of sulindac on NF‐κB activity, HeLa cells were transfected with an NF‐κB luciferase reporter plasmid and NF‐κB transcription activity was stimulated by 10 ng·mL‐1 TNF‐α. Cells were treated with various concentrations of NSAIDs. As shown in Fig. 1A, compared with vehicle, ibuprofen significantly inhibited TNF‐α‐induced NF‐κB activities at 500 μM and EC50 was extrapolated to be 1,813 μM. Sulindac caused a dose‐dependent decrease in TNF‐α‐induced luciferase activity in HeLa cells (Fig. 1B) and in the lung epithelial cell line, BEAS‐2B (Fig. 1C). Sulindac significantly inhibited NF‐κB activities at concentrations equal or greater than 300 μM and EC50 values were 420 μM in HeLa cells and 347 μM in BEAS‐2B cells. Sulindac is a prodrug that can be metabolized to sulindac sulfone or sulindac sulfide (Fig. 2A). From studies in cancer research, sulindac is known to inhibit NF‐κB activity at concentrations between 200 and 1,000 μM, without toxicity (Yamamoto et al., 1999; Loveridge et al., 2008; Mackenzie et al., 2010). We chose an intermediate dose of 500 μM of the prodrug to evaluate its anti‐NF‐κB activity on HeLa cells stably transfected with CFTR wild type (HeLa‐WT) and CFTR F508del (HeLaF508del). To evaluate NF‐κB activity, cells were transfected with an NF‐κB luciferase reporter plasmid and pretreated with sulindac, ibuprofen or vehicle for 30 minutes. NF‐κB activity was then stimulated by 10 ng·mL‐1 TNF‐α for 1h and cells were treated with or without sulindac or ibuprofen for 4h as shown in Fig. 2B. NF‐κB activity was greater in the HeLaF508del cells, both under basal conditions and in response to TNF‐α, than in the HeLa‐WT cells under TNF‐α stimulation (Fig. 2C, left panel). To compare the effects of drugs in both cell types, the NF‐κB activities were normalized and expressed as the percentage of induction in HeLa‐WT cells treated with vehicle and induced by TNF‐α (Fig. 2C, right panel). Basal NF‐κB activity was not significantly modified by ibuprofen or sulindac (Figure S1). NF‐κB activity induced by TNF‐α was similarly decreased by ibuprofen and sulindac in HeLa‐WT and in HeLaF508del cells (Fig. 2C).
Figure 1

Concentration‐dependent inhibition of sulindac and ibuprofen on NF‐κB transcriptional activity. Concentration‐response data for the effects of ibuprofen (n=6) (A), sulindac (n=7) on Hela cells (B) and sulindac (n=7) on airway epithelial cells BEAS‐2B (C), on NF‐κB activity. Left panels represent TNF‐induced NF‐κB transcriptional activity expressed as a percentage of vehicle (Veh.) +TNF‐α, at doses ranging from 0 μM to 500 μM of NSAIDs. Right panels represent linear regression of percentage of inhibition of NF‐κB activity in function of log[dose] to determine EC50 values for ibuprofen and sulindac. *P < 0.05, significantly different from Veh. +TNF‐α.

Figure 2

Sulindac and sulindac sulfone inhibit NF‐κB transcriptional activity in HeLa‐WT and HeLa‐F508del cells by a COX‐independent mechanism. (A) Chemical structures of sulindac (Sul.) and metabolites. (B) Treatment protocol used to study the NF‐κB transcriptional activity on HeLa cells. (C) Left panel represents the NF‐κB transcriptional activity expressed in RLU in vehicle condition with or without TNF‐α. Right panel represents TNF‐induced NF‐κB transcriptional activity expressed as a percentage of WT Veh. +TNF‐α (n=10). (D) Effects of sulindac on cells treated with NS‐398, a selective cyclooxygenase‐2 (COX‐2) inhibitor (n=5) and (C) treated with sulindac sulfone (COX‐inactive metabolite) (n=6). *P < 0.05, significantly different from Veh. +TNF‐α. in same HeLa cells; # P < 0.05, WT significantly different from F508del.

Concentration‐dependent inhibition of sulindac and ibuprofen on NF‐κB transcriptional activity. Concentration‐response data for the effects of ibuprofen (n=6) (A), sulindac (n=7) on Hela cells (B) and sulindac (n=7) on airway epithelial cells BEAS‐2B (C), on NF‐κB activity. Left panels represent TNF‐induced NF‐κB transcriptional activity expressed as a percentage of vehicle (Veh.) +TNF‐α, at doses ranging from 0 μM to 500 μM of NSAIDs. Right panels represent linear regression of percentage of inhibition of NF‐κB activity in function of log[dose] to determine EC50 values for ibuprofen and sulindac. *P < 0.05, significantly different from Veh. +TNF‐α. Sulindac and sulindac sulfone inhibit NF‐κB transcriptional activity in HeLa‐WT and HeLaF508del cells by a COX‐independent mechanism. (A) Chemical structures of sulindac (Sul.) and metabolites. (B) Treatment protocol used to study the NF‐κB transcriptional activity on HeLa cells. (C) Left panel represents the NF‐κB transcriptional activity expressed in RLU in vehicle condition with or without TNF‐α. Right panel represents TNF‐induced NF‐κB transcriptional activity expressed as a percentage of WT Veh. +TNF‐α (n=10). (D) Effects of sulindac on cells treated with NS‐398, a selective cyclooxygenase‐2 (COX‐2) inhibitor (n=5) and (C) treated with sulindac sulfone (COX‐inactive metabolite) (n=6). *P < 0.05, significantly different from Veh. +TNF‐α. in same HeLa cells; # P < 0.05, WT significantly different from F508del. In order to explore whether these sulindac effects were dependent on its known anti‐COX activity, we tested effects of another COX inhibitor, NS‐398 (Zhu et al., 2008) and the COX‐inactive metabolite, sulindac sulfone. Treatment by NS‐398 did not significantly modify TNF‐α‐induced NF‐κB activity with or without sulindac in HeLa‐WT and HeLaF508del cells (Fig. 2D). Moreover sulindac sulfone decreased NF‐κB activity similarly to sulindac (Fig. 2E). To investigate the mechanism of action of sulindac on the NF‐κB pathway, we analysed subcellular localizations of p65, an NF‐κB subunit, and IκB. The cytosolic proteins were used to detect IκB by Western blot. TNF‐α induced a rapid degradation of more than 90% of IκB, and this was not modified by sulindac pretreatment (Figure S2). We then checked the subcellular distribution of p65 by immunofluorescence and by quantitative Western blot assay after cell fractionation. In control cells, p65 had a cytosolic distribution and TNF‐α induced a rapid and full nuclear translocation. Treatment with sulindac did not modify p65 localization, either qualitatively or quantitatively, under either in basal or induced conditions (Figure S2).

Effect of sulindac on the IL‐8 pathway

To investigate whether the inhibition of NF‐κB activity by sulindac had a downstream effect on the IL‐8 promoter, we used a luciferase reporter assay (de Becdelievre et al., 2013). HeLa cells transiently transfected with this construct were treated with vehicle, sulindac or ibuprofen and inflammation was induced by TNF‐α as shown Fig. 3A. As previously described in other cells, ibuprofen did not affect IL‐8 promoter activity (Dauletbaev et al., 2010). However, sulindac significantly decreased IL‐8 promoter activity in HeLa‐WT and in HeLaF508del cells (Fig. 3B).
Figure 3

Sulindac inhibits IL‐8 promoter activity in HeLa‐WT and HeLa‐F508del cells by a COX‐independent mechanism. (A) Treatment protocol used in the study of the IL‐8 promoter activation in HeLa cells. (B) Effect of sulindac (Sul.) and ibuprofen (Ibu.) on the transcriptional activity of the IL‐8 promoter (n=8) on HeLa‐WT and HeLa‐F508del cells. (C) Effects of sulindac on cells treated with NS‐398, a selective cyclooxygenase‐2 (COX‐2) inhibitor (n=6) and (D) effects of sulindac sulfone (COX‐inactive metabolite) (n=9). For all the panels the IL‐8 promoter activity was represented as normalized induction expressed as percentage of WT Veh. +TNF‐α. *P < 0.05, significantly different from Veh. +TNF‐α in same HeLa cells. # P < 0.05, WT significantly different from F508del.

Sulindac inhibits IL‐8 promoter activity in HeLa‐WT and HeLaF508del cells by a COX‐independent mechanism. (A) Treatment protocol used in the study of the IL‐8 promoter activation in HeLa cells. (B) Effect of sulindac (Sul.) and ibuprofen (Ibu.) on the transcriptional activity of the IL‐8 promoter (n=8) on HeLa‐WT and HeLaF508del cells. (C) Effects of sulindac on cells treated with NS‐398, a selective cyclooxygenase‐2 (COX‐2) inhibitor (n=6) and (D) effects of sulindac sulfone (COX‐inactive metabolite) (n=9). For all the panels the IL‐8 promoter activity was represented as normalized induction expressed as percentage of WT Veh. +TNF‐α. *P < 0.05, significantly different from Veh. +TNF‐α in same HeLa cells. # P < 0.05, WT significantly different from F508del. Treatment with NS‐398 did not modify TNF‐α‐induced IL‐8 promoter activity in HeLa cells treated with vehicle or sulindac (Fig. 3C). Lastly, the sulfone metabolite of sulindac inhibited IL‐8 promoter activity, as effectively as sulindac (Fig. 3D). We then tested the effect of sulindac on NF‐κB and IL‐8 promoter activity, in combination with VX‐809 (lumacaftor), a CFTR corrector that can rapidly improve CFTR maturation in F508del cells (Van Goor et al., 2011) (Fig. 4). HeLaF508del cells transiently transfected with the reporter system were treated with VX‐809, then treated with vehicle or sulindac and inflammation was induced by TNF‐α, as shown Fig. 4B. VX‐809 treatment induced maturation of CFTR F508del (Fig. 4A) and inhibited NF‐κB activity and IL‐8 promoter activity (Fig. 4C and 4D). However, adding VX‐809 to sulindac had no significant additive effect on NF‐κB activity and IL‐8 promoter activity although levels of NF‐κB activity tended to be lower with the combination (Fig. 4C and 4D).
Figure 4

CFTR correction by VX‐809 in HeLa‐F508del cells has no effect on inhibition by Sulindac of NF‐κB and IL‐8 promoter activities. (A) Representative immunoblot of CFTR pattern of HeLa‐F508del cells after 24 hours of treatment with VX‐809. (Band B: immature CFTR; band C: mature CFTR) (B) Treatment protocol used to study the effect of sulindac with the CFTR corrector VX‐809 on HeLa‐F508del cells. (C) Effect of sulindac with or without VX‐809 on the transcriptional NF‐κB activity (n=9) and (D) on the transcriptional activity of the IL‐8 promoter (n=9). *P < 0.05, significantly different from Veh. +TNF‐α, without VX‐809.

CFTR correction by VX‐809 in HeLaF508del cells has no effect on inhibition by Sulindac of NF‐κB and IL‐8 promoter activities. (A) Representative immunoblot of CFTR pattern of HeLaF508del cells after 24 hours of treatment with VX‐809. (Band B: immature CFTR; band C: mature CFTR) (B) Treatment protocol used to study the effect of sulindac with the CFTR corrector VX‐809 on HeLaF508del cells. (C) Effect of sulindac with or without VX‐809 on the transcriptional NF‐κB activity (n=9) and (D) on the transcriptional activity of the IL‐8 promoter (n=9). *P < 0.05, significantly different from Veh. +TNF‐α, without VX‐809. To explore if this transcriptional effect was reproduced at the protein level, we assayed IL‐8 protein secretion into the culture medium (Fig. 5A). HeLaF508del cells secreted twice as much IL‐8 as the HeLa‐WT cells under basal conditions, and three‐fold more IL‐8 than HeLa‐WT cells following upon TNF‐α stimulation (i.e., approximately 32‐fold and 48‐fold respectively) (Fig. 5B, left panel). The preliminary data indicated that sulindac, but not ibuprofen, reduced this stimulation by TNF‐α, decreasing IL‐8 secretion similarly in HeLa‐WT and in F508del cells (Fig. 5B, right panel).
Figure 5

Sulindac reduces IL‐8 secretion in HeLa cells. (A) Treatment protocol used to study IL‐8 secretion in the cell media on HeLa‐WT and HeLa‐F508del cells. (B) Left panels represent the IL‐8 secretion in the vehicle condition. In right panels, IL‐8 secretion was normalized and expressed as a percentage of induction in WT Veh. +TNF‐α (n=3).

Sulindac reduces IL‐8 secretion in HeLa cells. (A) Treatment protocol used to study IL‐8 secretion in the cell media on HeLa‐WT and HeLaF508del cells. (B) Left panels represent the IL‐8 secretion in the vehicle condition. In right panels, IL‐8 secretion was normalized and expressed as a percentage of induction in WT Veh. +TNF‐α (n=3). These effects were also demonstrated in monolayers of polarized human bronchial epithelial cells, expressing recombinant CFTR (CFBE cells; Fig. 6). In these cells, IL‐8 secretion was induced by apical addition of 40 ng·mL‐1 TNF‐α, 5 μg·mL‐1 LPS and 2 ng·mL‐1 IL‐1β (referred to as CytoMix). In CFBE‐F508del cells, the CytoMix induced apical IL‐8 secretion up to four‐fold (Fig. 6A, left panel) and sulindac significantly reduced this secretion (Fig. 6A, right panel). In order to test this effect in a CF model which mimics all classes of CFTR mutations (Fanen et al., 2014), we inhibited CFTR activity with 10 μM inh172. At this concentration, inh172 is a potent and specific reversible allosteric inhibitor for CFTR function (Ma et al., 2002; Kopeikin et al., 2010; Melis et al., 2014). Inh172 treatment mimics the CF inflammatory profile and can used to create a CF like model (with its own control) (Perez et al., 2007). In CFBE‐WT cells, the CytoMix induced apical IL‐8 secretion up to nine‐fold, relative to basal secretion level (Fig. 6B, left panel) and this secretion of IL‐8 was attenuated by sulindac.. CFTR inhibition (with inh172) had no effect under basal conditions and the CytoMix still significantly increased IL‐8 secretion (Fig. 6B, left panel). Under sulindac treatment, this increased secretion induced by the CytoMix was effectively blocked (Fig. 6B, right panel). In a final series of experiments, inhibition of IL‐8 secretion by sulindac was demonstrated in primary human bronchial epithelial cells derived from a CF donor, homozygous for F508del (MucilairTM, Epithelix) (Fig. 7). In these cell cultures, basal IL‐8 secretion was significantly decreased by 100 μM and by 500 μM of sulindac (Fig. 7).
Figure 6

Sulindac reduces IL‐8 secretion in polarized CFBE cells. Treatment protocol used to study IL‐8 secretion on polarized (A) CFBE‐F508del cells (n=6) and (B) CFBE‐ WT cells without or with inhibition of CFTR function by inh172 (n=8), at an air‐liquid interface. IL‐8 secretion was measured in the apical media at the end of the treatment. (A) and (B) Upper panels represent treatment protocol. Left panels represent the IL‐8 secretion in the diluent condition. In right panels, IL‐8 secretion was normalized and expressed as a percentage of induction in control cells with diluent and stimulated condition (Mix.). *P < 0.05, significantly different from Veh. + CytoMix in the same cells. # P< 0.05, WT significantly different from WT+inh172.

Figure 7

Sulindac reduces IL‐8 secretion in primary human bronchial epithelium from CF donor (F508del/F508del) (MucilairTM). IL‐8 secretion was measured in basolateral media after treatment with vehicle (Veh.), 100 μM of sulindac (Sul. 100 μM) or 500 μM of sulindac (Sul. 500 μM) (n=6). *P < 0.05, significantly different from Veh. +TNF‐α.

Sulindac reduces IL‐8 secretion in polarized CFBE cells. Treatment protocol used to study IL‐8 secretion on polarized (A) CFBE‐F508del cells (n=6) and (B) CFBE‐ WT cells without or with inhibition of CFTR function by inh172 (n=8), at an air‐liquid interface. IL‐8 secretion was measured in the apical media at the end of the treatment. (A) and (B) Upper panels represent treatment protocol. Left panels represent the IL‐8 secretion in the diluent condition. In right panels, IL‐8 secretion was normalized and expressed as a percentage of induction in control cells with diluent and stimulated condition (Mix.). *P < 0.05, significantly different from Veh. + CytoMix in the same cells. # P< 0.05, WT significantly different from WT+inh172. Sulindac reduces IL‐8 secretion in primary human bronchial epithelium from CF donor (F508del/F508del) (MucilairTM). IL‐8 secretion was measured in basolateral media after treatment with vehicle (Veh.), 100 μM of sulindac (Sul. 100 μM) or 500 μM of sulindac (Sul. 500 μM) (n=6). *P < 0.05, significantly different from Veh. +TNF‐α.

Effect of sulindac on lung inflammation

To test this pharmacological effect in vivo, we chose a mouse model of pulmonary inflammation commonly used in pharmacological studies. Inflammation limited to the lungs is caused by intra‐tracheal instillation of lipopolysaccharide (LPS) in WT and CF mice. This methodology provides a good model to monitor pro‐inflammatory cytokine secretion and neutrophil recruitment to the lungs (Matute‐Bello et al., 2008). Under our conditions, instillation of 400 μg·kg‐1 LPS induced a rapid and transient secretion of the murine chemokines that are functional rodent homologues of human IL‐8. These chemokines are CXCL2 (MIP‐2) and keratinocyte‐derived chemokine (KC). Sulindac has a long half‐life in humans, with 7 hours for the original sulfoxide form, and 15 hours for the metabolites (Huang et al., 2014). Bioavailability and pharmacokinetic studies on animal models have shown that: (i) sulindac was present in tissues of multiple organs, including the lungs (in lesser amounts than in the liver and kidneys), (ii) its half‐life was variable and depended on the species studied, (iii) the method of administration had important effects on its pharmacokinetics and pharmacodynamics (Duggan et al., 1978; Duggan et al., 1980; Kapetanovic et al., 2006). We first assessed sulindac distribution after i.p. administration of an intermediate dose (40 mg·kg‐1) (Yip‐Schneider et al., 2007; Wentz et al., 2009) in C57BL/6 mice. Lung and serum sulindac concentrations were quantified using an LC‐MS/MS approach developed in our laboratory. Following i.p. injection in mice, sulindac appeared rapidly in both serum and lung (Fig. 8A). The highest concentration was measured at the first sampling at 30 minutes post‐injection with 24,980±1,150 ng·mL‐1 of sulindac in serum and 21±6 ng·mg‐1 in lung tissue. In mice, sulindac has a rapid bioavailability and a very short half‐life of about 1 hour. In order to study the effect of sulindac on the secretion of CXCL2 and KC in BALF, mice were injected with sulindac or vehicle 1h before intra‐tracheal LPS instillation and BALF was collected 6h after instillation (Fig. 8B). In absence of LPS stimulation, there was no CXCL2 or KC detectable in BALF but, following LPS, both chemokines were clearly present in BALF. Sulindac treatment decreased these stimulated levels of both chemokines (Fig. 8C and 8D).
Figure 8

Sulindac decreases LPS‐induced pro‐inflammatory cytokines in BALF of C57Bl/6J mice. (A) Sulindac distribution in serum and lung after i.p. injection. C57Bl/6J male mice were injected i.p. with sulindac (40 mg·kg‐1). Lung and serum were collected at different times and sulindac was quantified by mass spectrometry (n=4). Sulindac distribution in serum (left axis) and in lung (right axis) is shown as the means ± SEM. (B) In vivo experimental protocol of lung inflammation. Levels of CXCL2 (C) and KC (D) were quantified in BALF. Graphs represent box plot of raw data showing median, inter quartile range, minimum and maximum values.*P < 0.05, Veh. significantly different from Sul.

Sulindac decreases LPS‐induced pro‐inflammatory cytokines in BALF of C57Bl/6J mice. (A) Sulindac distribution in serum and lung after i.p. injection. C57Bl/6J male mice were injected i.p. with sulindac (40 mg·kg‐1). Lung and serum were collected at different times and sulindac was quantified by mass spectrometry (n=4). Sulindac distribution in serum (left axis) and in lung (right axis) is shown as the means ± SEM. (B) In vivo experimental protocol of lung inflammation. Levels of CXCL2 (C) and KC (D) were quantified in BALF. Graphs represent box plot of raw data showing median, inter quartile range, minimum and maximum values.*P < 0.05, Veh. significantly different from Sul. The effect of sulindac on the mRNA for pro‐inflammatory chemokines was confirmed in CF mice (cftrtm1Eur, F508del/ F508del) and not in their littermates (+/+) (Fig. 9). Mice were injected with sulindac or vehicle 1h before intra‐tracheal LPS instillation, BALF and lung were collected three hours after instillation. mRNA levels and cytokine secretion were monitored by RT‐qPCR and ELISA respectively (Fig. 9A). LPS increased the mRNA for CXCL2 in both strains ( +/+ and F508del/F508del). Sulindac treatment significantly reduced the induction by LPS of the mRNA for CXCL2 (Fig. 9B) or for KC (Fig. 9C) in CF mice. We then tested LPS‐induced mRNA expression of other pro‐inflammatory cytokines in the lung. After sulindac treatment we also observed a reduction of IL‐6 and TNF‐α mRNA in CF and WT (+/+) littermate mice (Figure S3).
Figure 9

Sulindac decreases LPS‐induced pro‐inflammatory cytokines in BALF of CF mice. (A) In vivo experimental protocol of lung inflammation. (B) CXCL2 and (C) KC mRNA were quantified in lung. Results were normalized to the amount of 18S mRNA. Bars represent the mean. (D) CXCL2 and (E) KC protein were quantified in BALF. Graphs represent box plot of raw data showing median, inter quartile range, minimum and maximum values. *P < 0.05, Veh. significantly different from Sul.

Sulindac decreases LPS‐induced pro‐inflammatory cytokines in BALF of CF mice. (A) In vivo experimental protocol of lung inflammation. (B) CXCL2 and (C) KC mRNA were quantified in lung. Results were normalized to the amount of 18S mRNA. Bars represent the mean. (D) CXCL2 and (E) KC protein were quantified in BALF. Graphs represent box plot of raw data showing median, inter quartile range, minimum and maximum values. *P < 0.05, Veh. significantly different from Sul. All groups were initially designed to contain 6 mice on the 129/FVB background but due to technical difficulties in the BALF procedure, the final sizes of the groups were different. Therefore, no statistical analysis could be performed for the levels of chemokine protein secreted into BALF (Curtis et al., 2015). In absence of LPS stimulation, CXCL2 secretion in BALF was 72± 50 pg·mL‐1 and 25±15 pg·mL‐1 for +/+ and F508del/F508del mice respectively, with no effect of sulindac (data not shown). Sulindac treatment tended to decrease secretion of CXCL2 (Fig. 9D) and of KC (Fig. 9E) in +/+ and F508del/F508del mice. Despite the apparent reduction of the KC and CXCL2 levels in BALF, the decrease was clearly greater in the WT littermates.

Discussion

The present study was designed to test if sulindac could be valuable at replacing ibuprofen to diminish lung inflammation in CF patients. The pulmonary pathology of CF is distinguished by the hyperactivity of transcription factors involved in inflammation, more particularly of NF‐κB, which is associated with an increased expression of pro‐inflammatory cytokines, such as IL‐8. Dysregulation of NF‐κB signaling in CF appears to have multiple origins and remains controversial. Whether there is constitutive activation of pro‐inflammatory signalling directly linked to CFTR dysfunction in humans is still unresolved and is a difficult issue to address experimentally. Results obtained with in vivo models of CF have concluded that infection precedes inflammation. Indeed, at birth, CF piglets lack inflammation in their airways but harbor more bacteria than the WT littermates and they fail to eradicate bacteria and develop lung disease characterized by airway inflammation, remodeling, mucus accumulation and infection within the first few months of life (Rogers et al., 2008; Stoltz et al., 2010). CF ferrets have also exhibit defective eradication of lung bacteria, but demonstrate an abnormally elevated inflammatory response at birth (Keiser et al., 2015). In addition, although infections precede inflammation, subsequent inflammatory responses and resolution of inflammation is abnormal. Interestingly, recent in vitro studies have indicated an intrinsic anti‐inflammatory activity of WT CFTR (Hunter et al., 2010; Veit et al., 2012), and have shown that its loss of function could lead to the activation of the NF‐κB pathway (Perez et al., 2007). Whatever the cause of this increased NF‐κB activation may be, it is a clear target for new anti‐inflammatory drugs in the context of CF. In order to compare our work with the current standard therapy (high‐dose ibuprofen), we have used a similar methodological approach to that established by Dauletbaev et al. in their study on the mechanism underlying the action of of ibuprofen in CF cells (Dauletbaev et al., 2010). Although we have used a heterologous model of HeLa epithelial cells stably expressing WT or F508del CFTR, the latter presenting CF characteristics such as enhanced NF‐κB activity and IL‐8 secretion, we have obtained similar results for ibuprofen, thus validating our research model (Clain et al., 2001; Jungas et al., 2002). We first showed that sulindac inhibited TNF‐α‐induced NF‐κB activity in a concentration‐dependent manner. Sulindac was more efficient than ibuprofen with an EC50 value four‐fold lower in HeLa cells. Anti‐NF‐κB activity of sulindac was confirmed in other cell lines, including bronchial epithelial cells with the same efficiency as shown by similar EC50 values in these cells. Studies on the anti‐cancer properties of sulindac highlighted its ability to inhibit NF‐κB activation by inhibiting IκB degradation, and consequently preventing nuclear translocation of NF‐κB (Yamamoto et al., 1999; Li et al., 2012). Under our experimental conditions, sulindac did not modify the TNF‐α‐induced IκB degradation and did not inhibit nuclear translocation of p65. Although IκB degradation is critical for NF‐κB activation, other processes such as phosphorylation of its subunits or binding of co‐activators may also be necessary. It can therefore be hypothesized that sulindac affects NF‐κB nuclear activity by modifying its interactions either with protein partners and/or with DNA. Sulindac may also modify NF‐κB localization within the nucleus. In SW480 cells, inhibition of NF‐κB activity followed sequestration of an inactive form of NF‐κB in the nucleolus, after 5 h of incubation with sulindac (Loveridge et al., 2008). Although we have not observed any modification of p65 localization within the nucleus after 30 minutes, we cannot exclude a similar mechanism in our cell model. We then investigated if the inhibition of NF‐κB activity led to a decrease in the production of the main inflammatory marker in CF airways, IL‐8. Previous studies of the IL‐8 promoter have shown that its ‐1 to ‐133 region was essential and sufficient for the regulation of gene transcription, and that this region contains an NF‐κB binding site that is necessary for the induction of IL‐8 expression (Edwards et al., 2005). Interestingly, we found that, in contrast to ibuprofen, sulindac reduced the activity of this IL‐8 promoter as assessed by a reporter system. This difference between ibuprofen and sulindac suggests that these two NSAIDs have different mechanisms of inhibition of the NF‐κB pathway and/or on pathways regulating IL‐8 expression. In fact, the IL‐8 promoter contains at least two other binding sites for NF‐IL6 and AP‐1 transcription factors. The functionality of these binding sites depends on cell type and pro‐inflammatory signals, probably due to the formation of transcriptional enhanceosome containing various transcription factors and co‐activators (Hoffmann et al., 2002). At the protein level, and in contrast to ibuprofen, sulindac was able to inhibit IL‐8 secretion. This effect was confirmed in several human epithelial cell line models: HeLa‐WT and ‐F508del cells heterologously expressing CFTR, Calu‐3 bronchial secretory cells (Figure S4), CFBE‐ WT bronchial cells with or without inh172 treatment, CFBE‐F508del cells and primary human bronchial cells polarized at air‐liquid interface. Overall, these results suggest a greater therapeutic capacity of sulindac compared to ibuprofen. In order to test if the anti‐NF‐κB and anti‐IL‐8 activities of sulindac were dependent on its effects on the COX pathway, we used another COX inhibitor NS‐398 or the sulindac sulfone metabolite that is inactive on COX. Our results showed that effects of sulindac, NS‐398 and sulindac sulfone on both activities were very similar, demonstrating a COX‐independent mechanism for sulindac. From a pharmacological standpoint, these are key results, as most side effects associated with NSAID treatment, notably those on the GI tract, are due to COX inhibition. Importantly, in the context of therapeutic applications, we have tested the anti‐IL‐8 effect of sulindac on an in vivo model of pulmonary inflammation. There are two functional homologues of IL‐8 that have been identified in mice: CXCL2 and KC. Pulmonary inflammation is characterized by a strong increase in the level of these chemokines in murine BALF 3 hours after LPS instillation. Treatment by sulindac induced a significant decrease in CXCL2 and KC secretion in C57BL/6 mice, validating its in vivo anti‐IL‐8 effect. In CF mice, treatment by sulindac induced a non‐significant decrease in CXCL2 and KC concentrations, whereas we observed a marked and significant inhibition of CXCL2 and KC mRNA induced by LPS in the lung of CF mice. These results indicate a different response time in CF mice and that a longer exposure time will be necessary to see an effect not only at the transcriptional level but also at the protein level. We then explored the anti‐inflammatory effect of sulindac on CF cells treated with the CFTR corrector VX‐809. Treatment with VX‐809 alone inhibited the NF‐κB and IL‐8 promoter activity but there was no additive effect in combination with sulindac. We also observed that sulindac was able to fully correcting the pro‐inflammatory effect induced by inhibition of CFTR with inh172 in the CFBE‐Wt cells treated with the CytoMix. This may suggest an overlap between the signaling pathways involved in CFTR anti‐inflammatory activity and the MOA of sulindac. Ibuprofen has been shown to either inhibit or activate CFTR channel activity (Devor and Schultz, 1998; Tondelier et al., 1999; Li et al., 2008) and more recently to rescue F508delCFTR trafficking (Carlile et al., 2015). It thus would be interesting to investigate the effect of sulindac on CFTR processing and activity. Altogether, our data demonstrate a COX‐independent, anti‐inflammatory effect of sulindac. Taken together, these features demonstrate that sulindac is a good therapeutic candidate for CF therapy. Furthermore, recent studies have made it possible to consider a real improvement of drugs through a lead optimization phase. The objective of this phase is to synthesize lead compounds, new analogues with improved potency, physiochemical/metabolic properties and reduced off‐target activities. As already performed in cancer research studies (Zhou et al., 2010), a screen of sulindac analogues could permit the identification of molecules that are safer and more potent in their effect on the NF‐κB pathway and/or IL‐8, in the context of CF therapeutic applications. In addition, the lung bioavailability of sulindac could be improved via an optimized mode of administration such as inhalation, an approach that has recently been validated for other NSAIDs (Stigliani et al., 2013). In conclusion, our results have shown that sulindac inhibited NF‐κB and IL‐8 by a COX‐independent mechanism and that this drug could be beneficially employed in CF. Sulindac may be chemically improved for this new application. If further clinical studies support our conclusions, and because the molecule has already been approved by the Food and Drug Administration, we should expect its use to be more readily applicable to the treatment of patients.

Author contributions

J.R., A.T. conceived and designed the experiments; J.R., A.H., S.M., W.V‐M., A.T. performed the experiments; A.H., S.M., A.T., VPE provided new techniques; A.A., J.R., A.T., analysed the data; J.R., A.T., P.F. drafted the manuscript; A.W‐H, R.E., A.A., A.T. revised the paper; A.T. and P.F. supervised the project.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organizations engaged with supporting research. Figure S1 Sulindac and ibuprofen did not inhibit NF‐κB transcriptional activity in HeLa‐WT and HeLaF508del cells under basal conditions. Figure S2 Sulindac reduces NF‐κB activity after IκB degradation. Figure S3 Sulindac decreases LPS‐induced pro‐inflammatory cytokine mRNA into the lung of CF mice. Figure S4 Sulindac inhibits IL‐8 expression. Supporting info item Click here for additional data file.
TARGETS
Ion channels a
CFTR
Enzymes b
COX, cyclooxygenase

These Tables list key protein targets and ligands in this article which are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Pawson et al., 2014) and are permanently archived in the Concise Guide to PHARMACOLOGY 2015/16 (Alexander et al., 2015a, 2015b).

  59 in total

1.  Experimental design and analysis and their reporting: new guidance for publication in BJP.

Authors:  Michael J Curtis; Richard A Bond; Domenico Spina; Amrita Ahluwalia; Stephen P A Alexander; Mark A Giembycz; Annette Gilchrist; Daniel Hoyer; Paul A Insel; Angelo A Izzo; Andrew J Lawrence; David J MacEwan; Lawrence D F Moon; Sue Wonnacott; Arthur H Weston; John C McGrath
Journal:  Br J Pharmacol       Date:  2015-07       Impact factor: 8.739

2.  Sulindac inhibits activation of the NF-kappaB pathway.

Authors:  Y Yamamoto; M J Yin; K M Lin; R B Gaynor
Journal:  J Biol Chem       Date:  1999-09-17       Impact factor: 5.157

3.  Clinical use of Ibuprofen is associated with slower FEV1 decline in children with cystic fibrosis.

Authors:  Michael W Konstan; Mark D Schluchter; Wei Xue; Pamela B Davis
Journal:  Am J Respir Crit Care Med       Date:  2007-09-13       Impact factor: 21.405

4.  An immortalized cystic fibrosis tracheal epithelial cell line homozygous for the delta F508 CFTR mutation.

Authors:  K Kunzelmann; E M Schwiebert; P L Zeitlin; W L Kuo; B A Stanton; D C Gruenert
Journal:  Am J Respir Cell Mol Biol       Date:  1993-05       Impact factor: 6.914

5.  Non-steroidal anti-inflammatory drug for pulmonary administration: design and investigation of ketoprofen lysinate fine dry powders.

Authors:  Mariateresa Stigliani; Rita P Aquino; Pasquale Del Gaudio; Teresa Mencherini; Francesca Sansone; Paola Russo
Journal:  Int J Pharm       Date:  2013-03-23       Impact factor: 5.875

6.  Expression of wild-type CFTR suppresses NF-kappaB-driven inflammatory signalling.

Authors:  Mairi J Hunter; Kate J Treharne; Alexandra K Winter; Diane M Cassidy; Stephen Land; Anil Mehta
Journal:  PLoS One       Date:  2010-07-14       Impact factor: 3.240

7.  Cyclooxygenase-independent induction of apoptosis by sulindac sulfone is mediated by polyamines in colon cancer.

Authors:  Naveen Babbar; Natalia A Ignatenko; Robert A Casero; Eugene W Gerner
Journal:  J Biol Chem       Date:  2003-09-23       Impact factor: 5.157

Review 8.  Established cell lines used in cystic fibrosis research.

Authors:  D C Gruenert; M Willems; J J Cassiman; R A Frizzell
Journal:  J Cyst Fibros       Date:  2004-08       Impact factor: 5.482

9.  Disruption of the CFTR gene produces a model of cystic fibrosis in newborn pigs.

Authors:  Christopher S Rogers; David A Stoltz; David K Meyerholz; Lynda S Ostedgaard; Tatiana Rokhlina; Peter J Taft; Mark P Rogan; Alejandro A Pezzulo; Philip H Karp; Omar A Itani; Amanda C Kabel; Christine L Wohlford-Lenane; Greg J Davis; Robert A Hanfland; Tony L Smith; Melissa Samuel; David Wax; Clifton N Murphy; August Rieke; Kristin Whitworth; Aliye Uc; Timothy D Starner; Kim A Brogden; Joel Shilyansky; Paul B McCray; Joseph Zabner; Randall S Prather; Michael J Welsh
Journal:  Science       Date:  2008-09-26       Impact factor: 47.728

10.  A mouse model for the cystic fibrosis delta F508 mutation.

Authors:  J H van Doorninck; P J French; E Verbeek; R H Peters; H Morreau; J Bijman; B J Scholte
Journal:  EMBO J       Date:  1995-09-15       Impact factor: 11.598

View more
  6 in total

1.  New use for an old drug: COX-independent anti-inflammatory effects of sulindac in models of cystic fibrosis.

Authors:  Jérémy Rocca; Sylvie Manin; Anne Hulin; Abdel Aissat; Wilfried Verbecq-Morlot; Virginie Prulière-Escabasse; Adeline Wohlhuter-Haddad; Ralph Epaud; Pascale Fanen; Agathe Tarze
Journal:  Br J Pharmacol       Date:  2016-04-21       Impact factor: 8.739

2.  NSAIDs in patients with viral infections, including Covid-19: Victims or perpetrators?

Authors:  Annalisa Capuano; Cristina Scavone; Giorgio Racagni; Francesco Scaglione
Journal:  Pharmacol Res       Date:  2020-04-29       Impact factor: 7.658

3.  The NSAID glafenine rescues class 2 CFTR mutants via cyclooxygenase 2 inhibition of the arachidonic acid pathway.

Authors:  Graeme W Carlile; Qi Yang; Elizabeth Matthes; Jie Liao; Véronique Birault; Helen F Sneddon; Darren L Poole; Callum J Hall; John W Hanrahan; David Y Thomas
Journal:  Sci Rep       Date:  2022-03-17       Impact factor: 4.379

4.  Sulindac, a Nonselective NSAID, Reduces Breast Density in Postmenopausal Women with Breast Cancer Treated with Aromatase Inhibitors.

Authors:  Patricia A Thompson; Chuan Huang; Jie Yang; Betsy C Wertheim; Denise Roe; Xiaoyue Zhang; Jie Ding; Pavani Chalasani; Christina Preece; Jessica Martinez; H-H Sherry Chow; Alison T Stopeck
Journal:  Clin Cancer Res       Date:  2021-06-10       Impact factor: 12.531

5.  Phosphorylation of the Chaperone-Like HspB5 Rescues Trafficking and Function of F508del-CFTR.

Authors:  Fanny Degrugillier; Abdel Aissat; Virginie Prulière-Escabasse; Lucie Bizard; Benjamin Simonneau; Xavier Decrouy; Chong Jiang; Daniela Rotin; Pascale Fanen; Stéphanie Simon
Journal:  Int J Mol Sci       Date:  2020-07-08       Impact factor: 5.923

6.  Antiviral drug screening by assessing epithelial functions and innate immune responses in human 3D airway epithelium model.

Authors:  Bernadett Boda; Sacha Benaoudia; Song Huang; Rosy Bonfante; Ludovic Wiszniewski; Eirini D Tseligka; Caroline Tapparel; Samuel Constant
Journal:  Antiviral Res       Date:  2018-06-08       Impact factor: 5.970

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.