Literature DB >> 26873439

Why some tumours trigger neovascularisation and others don't: the story thus far.

Omanma Adighibe1, Russell D Leek2, Marta Fernandez-Mercado3,4, Jiangting Hu5, Cameron Snell6, Kevin C Gatter7, Adrian L Harris8, Francesco Pezzella9.   

Abstract

BACKGROUND: Angiogenesis is not essential for tumours to develop and expand, as cancer can also grow in a non-angiogenic fashion, but why this type of growth occurs is unknown. Surprisingly, our data from mRNA transcription profiling did not show any differences in the classical angiogenic pathways, but differences were observed in mitochondrial metabolic pathways, suggesting a key role for metabolic reprogramming. We then validated these results with mRNA profiling by investigating differential protein expression via immunohistochemistry in angiogenic and non-angiogenic non-small cell lung cancers (NSCLCs).
METHODS: Immunohistochemical staining for 35 angiogenesis- and hypoxia-related biomarkers were performed on a collection of 194 angiogenic and 73 non-angiogenic NSCLCs arranged on tissue microarrays. Sequencing of P53 was performed with frozen tissue samples of NSCLC.
RESULTS: The non-angiogenic tumours were distinguished from the angiogenic ones by having higher levels of proteins associated with ephrin pathways, mitochondria, cell biogenesis, and hypoxia-inducible factor 1 (HIF1) regulation by oxygen and transcription of HIF-controlled genes but lower levels of proteins involved in the stroma, cell-cell signaling and adhesion, integrins, and Delta-Notch and epidermal growth factor (EGF)-related signaling. However, proteins classically associated with angiogenesis were present in both types of tumours at very comparable levels. Cytoplasmic expression of P53 was strongly associated with non-angiogenic tumours. A pilot investigation showed that P53 mutations were observed in 32.0% of angiogenic cases but in 71.4% of non-angiogenic tumours.
CONCLUSIONS: Our observations thus far indicate that both angiogenic and non-angiogenic tumours experience hypoxia/HIF and vascular endothelial growth factor (VEGF) pathway protein expression in a comparable fashion. However, angiogenesis does not ensue in the non-angiogenic tumours. Surprisingly, metabolic reprogramming seems to distinguish these two types of neoplastic growth. On the basis of these results, we raise the hypothesis that in some, but not in all cases, initial tissue remodeling and/or inflammation could be one of the secondary steps necessary to trigger angiogenesis. In the non-angiogenic tumours, in which neovascularisation fails to occur, HIF pathway activation could be the driving force toward metabolic reprogramming.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26873439      PMCID: PMC4752802          DOI: 10.1186/s40880-016-0082-6

Source DB:  PubMed          Journal:  Chin J Cancer        ISSN: 1944-446X


Background

In 1927, Otto Warburg described what would be called the “Warburg effect,” in which tumour cells exhibited characteristic changes in metabolism, particularly the use of glycolysis rather than oxidative phosphorylation, despite the presence of adequate amounts of oxygen [1, 2]. Warburg believed that this process was the actual cause of neoplastic transformation [3]. Tumour development is now known to be driven by genetic damage. However, mutations in some metabolic enzymes, such as succinate dehydrogenase (SDH) and fumaratehydratase (FH), both parts of the tricarboxylic acid (TCA) cycle, can drive neoplastic transformation, and intermediate products of metabolism can also promote neoplastic progression [4]. Proliferating cancer cells have a high energy requirement to maintain homeostatic cellular processes. The shift in energy production to aerobic glycolysis, while allowing for more rapid production of adenosine triphosphate (ATP), yields far less energy than oxidative phosphorylation: there are two net molecules of ATP per glucose molecule in glycolysis versus 36 molecules of ATP via oxidative phosphorylation [5]. The reasons for the glycolytic energy dependence of proliferating tumour cells are still being debated. Initially, it was believed that the mitochondria in tumours were intrinsically defective. However, it was determined that tumour mitochondria are actually functional, retaining the capacity for oxidative phosphorylation and consuming oxygen at similar rates to normal tissues [6], although it should be appreciated that a degree of variability in mitochondrial activities exists across different neoplasms. Alternatively, high rates of glycolysis might be co-selected with factors that promote the expression of hypoxia-related genes (such as those required for angiogenesis) as an oxygen-independent energy source. Finally, increased intermediate products of glycolysis can easily be shunted into the biosynthetic pathways required for serine and nucleotide synthesis [7]. According to Folkman’s original theory [8], the onset of hypoxia in tumour triggers angiogenesis, which in turn is essential for supplying neoplastic cells with nutrients and oxygen and evacuating metabolic waste and carbon dioxide. The best understood hypoxia signaling mechanism is the stabilization and post-transcription activation of the hypoxia-inducible factor (HIF) proteins, which lead to the activation of many different pathways, including the vascular endothelial growth factor (VEGF) pathway. The VEGF pathway prompts and supports neoangiogenesis and glycolysis. Hypoxia-inducible pathway activation also has other effects, which include reducing the activity of mammalian target of rapamycin (mTOR), which in turn can reignite autophagy and promote survival under stress [9]. HIF is a heterodimer of an alpha subunit that is unstable in normoxia and a constitutively present and stable beta subunit. The hypoxia activation of HIF causes the heterodimer to bind to DNA at specific locations, called hypoxic response elements (HREs), eliciting the transcriptional up-regulation of genes required to respond appropriately to hypoxia [9]. In addition to triggering the VEGF pathway, the ubiquitously expressed HIF1 isoform promotes the transcription of glucose transporter 1 (GLUT1), which activates glucose transport inside the cell, lactate dehydrogenase-A (LDH-A), which is involved in the glycolytic pathway, erythropoietin (EPO), which enhances erythropoiesis, and nitric oxide synthase (NOS), which promotes angiogenesis and vasodilatation [9]. HIF1 also prevents the entry of pyruvate into the TCA cycle by inducing the expression of pyruvate dehydrogenase kinase 1 (PDK1), thus altering the expressed isoform of cytochrome c and inhibiting mitochondrial biogenesis. This process causes reduced levels of oxygen consumption and a shift away from oxidative phosphorylation. Interestingly, HIF1 can also be activated under normoxic conditions by a variety of oncogenic pathways, such as phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA), and by mutations in von Hippel-Lindau tumour suppressor (VHL), SDH, and FH [10]. In the classic angiogenic pathway, VEGF binds to VEGF receptor 2 (VEGFR2) on endothelial cells, increasing the expression of the Notch ligand Delta-like 4 (DLL4) on the same cells. DLL4 then binds to its receptor Notch on the adjacent endothelium. Further expression of VEGFR2 and VEGFR1, as well as a smaller amount of VEGFR3, then follows, leading to triggering/amplification of the downstream phospholipase C familyγ (PLCγ)–protein kinase C (PKC)–Raf kinase–MAP kinase-ERK kinase (MEK)–mitogen-activated protein kinase (MAPK) pathway, concomitantly prompting cell proliferation and cell survival throughout the phosphoinositide 3-kinase (PI3 K)/protein kinase B (AKT) pathway [11]. The switch to glycolysis in neoplasia was, according to Warburg, irreversible [3], yet a more complex picture has emerged over the last decade. There have been observed instances in which oxidative phosphorylation predominates during neoplastic transformation [12]. This variation between OxPhos and glycolysisin cancer cells has been increasingly linked to specific disturbances in cell signaling pathways [13]. Additionally, tumours of the same genetic lineage can develop different metabolic adaptations depending on the host tissue from which they arise, suggesting that the stromal environment might play a crucial role in shaping the metabolic profile [14]. The different molecular mechanisms being postulated to explain this variability of the Warburg effect include the following: inhibition of pyruvate dehydrogenase (PDH) by PDK1, reduction of mitochondrial biogenesis and inhibition of oxidative phosphorylation, both are caused by P53 inactivation and mutations [15]. Warburg raised two important issues: first, how tumour cells are supplied with glucose; and second, how they are supplied with oxygen [1]. Folkman’s work addressed the latter question with the hypothesis that tumour growth is strictly angiogenesis-dependent [16]. The work undertaken to test this hypothesis led to the inclusion of “angiogenesis” as one of the hallmarks of cancer [8]. Although there is strong evidence that angiogenesis frequently occurs in cancer, we also now know that this event does not always occur. Indeed, some tumours, called “non-angiogenic tumours,” can grow without triggering new vessel formation by co-opting preexisting vessels [17, 18]. Non-angiogenic growth was first identified by histology in primary and metastatic lung carcinomas because neoplastic cells filled the alveolar spaces, co-opting the pre-existing capillary network and exhibiting a characteristic “chicken-wire” appearance [17]. A gene expression signature for non-angiogenic non-small cell lung cancer (NSCLC) was published in 2005 [19]. Surprisingly, rather than the classic angiogenesis-related genes, the differentially expressed genes were involved in mitochondrial metabolism, transcription, protein synthesis, and the cell cycle. Lack of differential mRNA expression between tumour phenotypes was noted for genes classically associated with hypoxia and angiogenesis. This result suggested that the response to hypoxia does not necessarily trigger neovascularisation, as would be observed in angiogenic tumours, but could actually be dependent on the genetic background of neoplastic cells, and in some instances, it could lead to metabolic reprogramming [19]. We therefore postulated that the degree to which a tumour will rely on angiogenic or non-angiogenic growth could be associated with a variety of events, including hypoxia, pseudo-hypoxia, and metabolic re-programming. In the first part of the present study, we investigated whether there were truly no differences in the expression of hypoxia-and angiogenesis-related proteins between angiogenic and non-angiogenic tumours, as suggested by mRNA profiling. We also investigated the degree of these proteins expression and the expression of some mitochondrial biogenesis proteins via immunohistochemistry. Notably high cytoplasmic P53 expression in non-angiogenic tumours, compared to angiogenic tumours, was found after completing the first part of this study. We therefore performed a second investigation, in which we examined and sequenced the p53 gene in these tumours.

Methods

Tissue specimens

Clinical specimens of NSCLCs were obtained from a series of consecutive patients who underwent surgical treatment at the John Radcliffe Hospital, Oxford, UK. This collection had ethical committee approval (study number C02.216—The pathophysiology of human neoplasia). The tissues were formalin-fixed and paraffin-embedded. Tissue microarrays were constructed using the Beecher Instrument MTA-1 manual arrayer (Beecher Instruments, Inc., Sun Prairie, WI, USA). Up to four suitable areas of appropriate tumour were chosen from a slide stained with hematoxylin and eosin (H&E), avoiding areas of necrosis.

Immunohistochemical staining of tissue sections

The 4-μm sections were cut from paraffin blocks and mounted on glass histology slides. Non-specific protein binding was blocked by incubating with 2.5% normal horse serum (Vector Laboratories, Burlingame, CA, USA), and the primary antibody was then applied. Details of all of the antibodies used are presented in Table 1. Substitution of the primary antibody with phosphate-buffered saline (PBS) served as a negative control. The slides were then counterstained with hematoxylin for 20 s.
Table 1

Antibodies used for immunohistochemistry

AntigenCloneSource
HIF1ESEE122Abcam (Cambridge, UK)
HIF2EP109bNDCLS (University of Oxford, John Radcliffe Hospital, Oxford, UK)
CA9M75BioScience Slovakia s.r.o. (Bratislava, Slovakia)
VEGFAVG-1NDCLS
TYMPPGF44NDCLS
KDRFLK1(A3)Santa Cruz Biotechnology, Inc. (Dallas, TX, USA)
KDRp3434aNDCLS
FIHFIH162c/D6NDCLS
PHD1PHD112/GNDCLS
PHD2366G/76NDCLS
PHD3EG188cNDCLS
DLL4D4/37NDCLS
TSP18A6B-TSP-1Leica Microsystems (UK) Ltd. and Novocastra Reagents (Milton Keynes, UK)
CXCR4MAB 172R&D System (Minneapolis, MN, USA)
EPHB2AF496R&D System
EPHB3R&D AF432R&D System
EPHB4R&D AF446R&D System
SOD130F11Novocastra
BCL2124Dako (Cambridgeshire, UK)
FOSPolyclonal 27436Abcam
EGFEGF 10Abcam
EGFRF4Abcam
BNIP3Ana40Sigma-Aldrich Company Ltd. (Dorset, UK)
P53DO7Dako
PI3Ab 40755Abcam
SP1SP1 polyclonalAbcam
STAT3E121-21Abcam
LON20H1NDCLS
MEF2DMEF2D polyclonalAbcam
JMYHMY117ANDCLS
TRAP1TR-1ALabVision (TorsbySjöväg, Värmdö, Sweden)
GSTGST3/GST piAbcam
NCAMIB6Novocastra
CHGAFLEX polyclonalDako
SYP299Novocastra

HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin

Antibodies used for immunohistochemistry HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin

Scoring

The immunohistochemical staining was scored for cytoplasmic and nuclear localization and, when present, for membrane staining. Two observers scored the slides. Intensity was scored on a scale of 0–3 (0 = no staining, 1 = weak, 2 = moderate, 3 = strong staining). The percentage of positive cells was recorded on a scale from 0 to 4 (1 = 1%–10%, 2 = 11%–50%, 3 = 51%–80%, 4 = 81%–100%) or alternatively on a continuous scale from 0% to 100%. The intensity and percentage values were then multiplied to provide a score called the “intensity percentage score” (IPS), the maximum score of which ranged from 12 to 300 [20]. Disputed scores were discussed and a consensus reached. For tissue microarrays, cores that did not contain tumour tissue or that were more than 50% incomplete were excluded. The number of cases scored for each marker was between a minimum of 73 and a maximum of 194 cases for angiogenic tumours and between a minimum of 48 and a maximum of 73 cases for non-angiogenic tumours.

Statistical analysis

To evaluate the association between protein biomarker expression and angiogenic status, the Mann–Whitney two-tailed non-parametric test was performed using GraphPad Prism statistical analysis software, version 4 (GraphPad Software Inc., San Diego, CA, USA).

Pathway visualization

Three lists were made: two of proteins more highly expressed in angiogenic or non-angiogenic tumours at least in one subcellular location and the third of proteins always equally expressed in all of their subcellular localizations (Table 2). To visualize the pathways associated with these proteins, each list was imported into the Web-based Enricher facility (http://amp.pharm.mssm.edu/Enrichr/) [21]. The data were visualized from the online databases for gene ontologies (GO biological process and GO cellular component) and for pathways [Kyoto Encyclopedia of Genes and Genomes (KEGG) 2015, WikiPathways 2015, Reactome 2015, and Panther]. The results were visualized by bar graph sorted by combined score.
Table 2

Lists of proteins used for pathway visualization using the EnrichrWebd facility [21]

Expression statusProteins
Equal expression in both tumour typesHIF2, VEGFA, TYMP, KDR, KDRp34, FIH, PHD1, SOD1, EPHB4, BCL2, EGFR, FGF, SP1, LON, MEF2D, RPSAa, CHGA, SYP
Higher expression in angiogenic tumours than in non-angiogenic tumours in at least one subcellular locationHIF1, PHD2, PHD3 (cytoplasmic), CXCRN, TSP, DLL4, BNIP3, PI3, EGF, FOS, STAT3, ITGB3a, ITGAVa
Higher expression in non-angiogenic tumours than in angiogenic tumours in at least one subcellular locationCA9, PHD3 (nuclear), EPHB2, EPHB3, NCAM, P53, TRAP1, JMY, GST

FGF fibroblast growth factor; RPSA ribosomal protein SA; ITGB3 integrin, beta 3; ITGAV integrin alpha-V; HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin

aData for RPSA are from Ref. [18] and for ITGB3 and ITGAV are from Ref. [23]

Lists of proteins used for pathway visualization using the EnrichrWebd facility [21] FGF fibroblast growth factor; RPSA ribosomal protein SA; ITGB3 integrin, beta 3; ITGAV integrin alpha-V; HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin aData for RPSA are from Ref. [18] and for ITGB3 and ITGAV are from Ref. [23]

P53 sequencing

Genomic DNA was isolated from 33 specimens of NSCLC (25 angiogenic cases, seven non-angiogenic cases, and one undetermined case) and five specimens of peri-tumour lung tissues. The coding regions corresponding to exons 3–9 (amino acids 25–331) were sequenced. DNA was whole-genome amplified using GenomiPhi (GE Healthcare, Piscataway, NJ, USA). The primers for polymerase chain reaction (PCR) amplification and subsequent sequencing reactions are described in Table 3. PCR was performed using ThermoStart PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s protocol. PCR products were purified and bidirectionally sequenced using the BigDye Terminator cycle sequencing kit, version 1.1 (Applied Biosystems, Foster City, CA, USA), and an ABI 3100 Genetic Analyzer (Applied Biosystem, Paisley, UK). Sequence data were analyzed using Mutation Surveyor, version 3.25 (Softgenetics, State College, PA, USA). Predicted effects on protein were assessed in silico using PolyPhen2 software (http://genetics.bwh.harvard.edu/pph2/). Fisher’s two-sided exact test was performed to compare mutation frequencies in angiogenic versus non-angiogenic cases. All sequencing experiments were performed in duplicate.
Table 3

Primers for polymerase chain reaction (PCR) amplification and subsequent P53 sequencing reactions

PrimerSequenceAnnealing temperature (°C)Amplicon length (bp)
Exon 3–4Forward: GTGGGAAGCGAAAATTCCATReverse: GCCAGGCATTGAAGTCTCAT60506
Exon 5–6Forward: TGTTCACTTGTGCCCTGACTReverse: TTAACCCCTCCTCCCAGAGA60467
Exon 7Forward: GAGCTTGCAGTGAGCTGAGAReverse: GGGATGTGATGAGAGGTGGAEX7F_seq CCTGCTTGCCACAGGTCT (to be used for sequencing instead of Exon 7 forward primer)61.5390
Exon 8–9Forward: GACAAGGGTGGTTGGGAGTAReverse: GCCCCAATTGCAGGTAAAAC60500
Primers for polymerase chain reaction (PCR) amplification and subsequent P53 sequencing reactions

Results

Immunohistochemical staining

The complete results for the cytoplasmic and membranous expression are reported in Table 4, and those for nuclear expression are reported in Table 5, while a summary of these results appears in Table 6. The complete original results of ontology and pathway visualization appear in Additional file 1.
Table 4

Cytoplasmic and membranous expression of the proteins in angiogenic versus non-angiogenic non-small cell lung cancers (NSCLCs)

ProteinIntensity percentage score (IPS) of protein expression P valueTumour type with higher expression
Angiogenic tumoursNon-angiogenic tumours
HIF16.22 ± 0.336.00 ± 0.480.87
HIF20.00 ± 0.000.00 ± 0.00Not applicable
CA9 cytoplasm2.38 ± 0.163.50 ± 0.23<0.001Non-angiogenic
CA9 membrane4.00 ± 0.403.30 ± 0.880.62
VEGFA8.83 ± 0.357.38 ± 0.780.07
TYMP3.20 ± 0.542.21 ± 0.320.28
KDR94.56 ± 1.6497.80 ± 1.54>0.05
KDRp3410.40 ± 0.3010.55 ± 0.620.71
FIH9.10 ± 0.3210.00 ± 0.470.22
PHD13.74 ± 0.274.20 ± 0.480.47
PHD23.50 ± 0.302.46 ± 0.530.02Angiogenic
PHD32.70 ± 0.093.38 ± 0.17<0.001Non-angiogenic
DLL4vessels2.34 ± 0.101.53 ± 0.09<0.001Angiogenic
TSP stroma16.98 ± 2.752.00 ± 1.74<0.001Angiogenic
CXCR42.47 ± 0.202.34 ± 0.310.92
EPHB27.78 ± 0.279.06 ± 0.33<0.01Non-angiogenic
EPBH3 cytoplasm159.3 ± 8.84202.20 ± 9.95<0.01Non-angiogenic
EPBH3 membrane23.83 ± 7.2386.51 ± 12.78<0.001Non-angiogenic
EPHB47.82 ± 0.267.40 ± 0.380.57
SOD14.36 ± 0.459.39 ± 4.220.27
BCL21.05 ± 0.250.68 ± 0.350.54
FOS8.05 ± 0.375.31 ± 0.55<0.001Angiogenic
EGFR203.40 ± 10.79166.30 ± 25.740.33
EGF18.90 ± 3.0314.44 ± 4.150.72
FGF9.20 ± 0.429.72 ± 0.710.74
BNIP36.08 ± 0.365.92 ± 0.820.88
P530.28 ± 0.122.28 ± 0.56<0.001Non-angiogenic
PI34.62 ± 0.364.92 ± 0.610.51
SP13.70 ± 0.373.38 ± 0.550.86
STAT38.78 ± 0.397.11 ± 0.790.03Angiogenic
LON102.50 ± 11.20134.20 ± 17.100.18
MEF2D cytoplasm50.11 ± 4.1665.67 ± 9.660.25
MEF2Dmembrane60.00 ± 7.1267.50 ± 12.670.47
JMY1.84 ± 0.182.42 ± 0.310.05Non-angiogenic
TRAP14.22 ± 0.285.48 ± 0.31<0.01Non-angiogenic
GST cytoplasm236.20 ± 7.16249.80 ± 11.400.23
GSTmembrane28.44 ± 5.5269.38 ± 14.03<0.01Non-angiogenic
NCAM0.40 ± 0.093.92 ± 0.07<0.001Non-angiogenic
CHGA0.08 ± 0.040.27 ± 0.14>0.05
SYP0.12 ± 0.050.44 ± 0.15>0.05

All data are presented as mean ± standard error

HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin

– Indicates equal expression

Table 5

Nuclear expression of the proteins in angiogenic versus non-angiogenic NSCLCs

ProteinIntensity percentage score (IPS) of protein expression P valueTumour type with higher expression
Angiogenic tumoursNon-angiogenic tumours
HIF15.49 ± 0.313.79 ± 0.390.01Angiogenic
VEGFA6.09 ± 0.525.62 ± 0.320.74
TYMP1.94 ± 0.221.16 ± 0.210.42
KDR231.20 ± 8.55229.80 ± 9.88>0.05
KDRp3411.69 ± 0.1611.45 ± 0.390.77
FIH7.50 ± 0.358.15 ± 0.720.50
PHD13.10 ± 0.342.50 ± 0.350.99
PHD22.56 ± 0.271.41 ± 0.350.02Angiogenic
PHD32.18 ± 0.130.65 ± 0.20<0.001Angiogenic
CXCR45.13 ± 0.233.72 ± 0.37<0.01Angiogenic
EPHB23.26 ± 0.264.91 ± 0.35<0.001Non-angiogenic
EPBH399.27 ± 7.41147.30 ± 9.23<0.001Non-angiogenic
EPHB45.56 ± 0.305.73 ± 0.340.81
SOD14.21 ± 0.455.00 ± 0.910.44
C-FOS7.50 ± 0.525.53 ± 0.750.05Angiogenic
EGF235.20 ± 5.60214.8 ± 8.680.01Angiogenic
FGF7.51 ± 0.388.68 ± 0.760.11
BNIP33.96 ± 0.400.00 ± 0.00<0.001Angiogenic
P532.66 ± 0.362.32 ± 0.530.91
PI30.53 ± 0.130.00 ± 0.00<0.02Angiogenic
SP15.31 ± 0.464.04 ± 0.600.24
STAT37.80 ± 0.396.31 ± 0.810.09
MEF2D251 ± 4.62243.10 ± 8.040.38
JMY2.01 ± 0.172.60 ± 0.270.07
TRAP11.57 ± 0.184.58 ± 0.32<0.001Non-angiogenic
GST243.30 ± 6.15244.10 ± 10.910.55
CHGA0.00 ± 0.000.34 ± 0.12>0.05

All data are presented as mean ± standard error

HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylasedehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin

– Indicates equal expression

Table 6

Protein biomarker expression in angiogenic and non-angiogenic NSCLCs according to their intracellular localization

Expression statusIntracellular expression localizationProteins
Equal expression in both tumour typesNuclearVEGFA, TYMP, KDR, KDRp34, FIH, EPHB4, PHD1, SOD1, FGF, P53, SP1, STAT3, MEF2D, JMY, GST, CHGA
CytoplasmHIF1, HIF2, VEGFA, TYMP, KDR, KDRp34, FIH, PHD1, SOD1, CXCR4, EPHB4, BCL2, EGF, EGFR, FGF, BNIP3, PI3, SP1, LON, MEF2D, GST, CHGA, SYP
MembraneCA9, MEF2D
Higher expression in angiogenic tumours than in non-angiogenic tumours in at least one subcellular locationNuclearHIF1, PHD2, PHD3, CXCR4, BNIP3, PI3, EGF, FOS
CytoplasmPHD2, TSP (stroma), DLL4 (endothelium), FOS, STAT3
MembraneNone
Higher expression in non-angiogenic tumours than in angiogenic tumours in at least one subcellular locationNuclearEPHB2, EPHB3,TRAP1
CytoplasmCA9, PHD3, EPHB2, EPHB3, NCAM, P53, TRAP1, JMY
MembraneEPHB3, GST

HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin

Cytoplasmic and membranous expression of the proteins in angiogenic versus non-angiogenic non-small cell lung cancers (NSCLCs) All data are presented as mean ± standard error HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin – Indicates equal expression Nuclear expression of the proteins in angiogenic versus non-angiogenic NSCLCs All data are presented as mean ± standard error HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylasedehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin – Indicates equal expression Protein biomarker expression in angiogenic and non-angiogenic NSCLCs according to their intracellular localization HIF hypoxia-inducible factor; CA9 carbonic anhydrase 9; VEGFA vascular endothelial growth factor A; TYMP thymidine phosphorylase; KDR vascular endothelial growth factor receptor 2; KDRp34 vascular endothelial growth factor p34; FIH factor-inhibiting HIF; PHD prolyl hydroxylase dehydrogenase; DLL4 Delta-like 4; TSP1 thymidine phosphorylase 1; CXCR4 chemokine (C-X-C motif) receptor 4; EPH ephrin; SOD1 superoxide dismutase 1; BCL2 B cell lymphoma 2; FOS FBJ murine osteosarcoma viral oncogene homolog; EGF epidermal growth factor; EGFR epidermal growth factor receptor; BNIP3 BCL2/adenovirus E1B 19 kDa interacting protein 3; PI3 peptidase inhibitor 3; SP1 Sp1 transcription factor; STAT3 signal transducer and activator of transcription 3; LON Lon protease; MEF2D myocyte enhancer factor 2D; JMY junction-mediating and regulatory protein, p53 cofactor; TRAP1 TNF receptor-associated protein 1; GST glutathione S-transferase; NCAM neural cell adhesion molecule; CHGA chromogranin A; SYP synaptophysin In Table 7, a selection of pathways shows that proteins expressed in both types of tumours are associated with angiogenesis-, VEGF-, and oxidative stress-related pathways. The non-angiogenic tumours are distinguished from the angiogenic tumours by having higher levels of proteins related to ephrin pathways, response to hypoxia, HIF1 regulation by oxygen, and transcription of HIF-controlled genes but lower levels of proteins involved in stromal cell–cell signaling and adhesion, integrins, and Delta-Notch- and EGF-related signaling.
Table 7

Selection of visualized pathways

Proteins equally expressed in angiogenic and non-angiogenictumoursProteins up-regulated in angiogenic tumoursProteins up-regulated in non-angiogenic tumours
PathwayDatabasesPathwayDatabasesPathwayDatabases
Focal adhesionKEGG, WikiPathwaysFocal adhesionKEGG, WikiPathways
VEGF-relatedKEGG, Panther, Reactome
AngiogenesisPanther, WikiPathwaysAngiogenesisPantherAngiogenesisPanther
Itegrin signallingPanther
Oxidative stressPanther, WikiPathways
Cell response to stressReactome
Delta-NotchWikiPathways
Collagen-related pathwaysReactome
Cell–cell communicationReactome
Integrin signalingPanther
EGF-related pathwaysWikiPathways, Panther
Response to HypoxiaReactome
Ephrins signalingReactomeEphrins-related pathwaysReactome
Regulation of HIF by oxygenReactome
Regulation of genes by HIFReactome
Nitrogen metabolismKEGG
Selection of visualized pathways Gene ontology analysis confirmed that proteins usually associated with angiogensis were present in both types of tumours, whereas higher levels of proteins associated with Notch, extracellular matrix, and cell adhesion were present in the truly angiogenesis-producing tumours. However, in the tumours that grow in a non-angiogenic fashion, proteins associated with mitochondria, cell biogenesis, carbonic dehydratase, ephrins, and axon guidance-related functions were more commonly detected (Table 8).
Table 8

Selection of visualized ontologies

Proteins equally expressed in angiogenic and non-angiogenic tumoursProteins up-regulated in angiogenic tumoursProteins up-regulated in non-angiogenic tumours
OntologyGO-ontology databaseOntologyGO-ontology databaseOntologyGO-ontology database
Cell migration/sprouting angiogenesisGO.0002042Biological processImmune response-activating signalsGO.0002757Biological processRegulation of synapsesGO.0051965Biological process
Endothelial cell migrationGO.0043534Biological processImmune response-regulating cell signalingGO.0002768Biological processAxon guidance and neuronal regulationGO.0031290GO.0007413GO.0021952GO.0021955GO.0008038Biological process
VEGF signaling pathwaysGO.0038084Biological processMesodermal cell differentiationGO.0048333Biological process
Activation of immune responseGO.0002253Biological process
Positive regulation cell biogenesisGO.0044089Biological process
Basement membraneGO.0005604Cell component
Extracellular matrix partGO.0044420Cell componentMitochondrial intermembrane space and matrixGO.0005758GO.0005759Cell component
Complex involve in cell adhesionGO.0098636Cell component
PDGF receptor-bindingGO.0005161Molecular functionFibronectin- and extracellular matrix-bindingGO.0001968GO.0050840Molecular functionEphrin receptor activityGO.0005003Molecular function
Extracellular matrix-bindingGO.0050840Molecular functionNotch-bindingGO.0005112Molecular functionCarbonate dehydratase activityGO.0004089Molecular function
Axon guidanceGO.0008046Molecular function
Selection of visualized ontologies

Sequencing

The higher level of p53 expression in the cytoplasm of the non-angiogenic tumours, as compared with the angiogenic tumours, was one of the most striking results (Table 9) and raised the question of whether non-angiogenic cells had wild-type p53 or a different set of mutations from the angiogenic tumours. Our results showed that p53mutations were observed in eight of 25 angiogenic cases (32.0%) but in five of seven non-angiogenic cases (71.4%) (P = 0.091 by Fisher’s two-tailed exact test) (Table 9).
Table 9

Summary of p53 mutations detected in non-angiogenic and angiogenic NSCLC cases

Sample IDSample typeMutation locationMutation typeDomainPredicted effect on protein activity
104Non-angiogenicc.761T>TA; p.I254SMissenseHCD IVDamaging
105Non-angiogenicc.734G>GA; p.G245DMissenseHCD IVDamaging
121Non-angiogenicc.488A>AG; p.Y163CMissenseDNA bindingDamaging
152Non-angiogenicc.634T>TG; p.F212 VMissenseDNA bindingBenign
249Non-angiogenicc.314G>GA; p.G105DMissenseDNA bindingDamaging
133Angiogenicc.511G>GT; p.E171XNonsense (truncated protein)HCD IIITruncating
138Angiogenicc.824G>GA; p.C275YMissenseHCD IVDamaging
139Angiogenicc.het_del216C; p.V73 Wfs48XFrameshift (truncated protein)ProlinerichTruncating
141Angiogenicc.407A>AC; p.Q136PMissenseHCD IIDamaging
98Angiogenicc.524G>GA; p.R175HMissenseHCD IIIPotentially damaging
147Angiogenicc.524G>GA; p.R175HMissense
274Angiogenicc.471_472TC>GA; p.V157GMissenseDNA bindingDamaging

Affected domains are listed. The software used to predict the functional effect of the detected sequence changes was PolyPhen_2 (http://genetics.bwh.harvard.edu/ggi/pph2/c2ea64efde6f039a5ca76a2a264ae4f3cf922360/1121012.html )

HCD highly conserved domain

Summary of p53 mutations detected in non-angiogenic and angiogenic NSCLC cases Affected domains are listed. The software used to predict the functional effect of the detected sequence changes was PolyPhen_2 (http://genetics.bwh.harvard.edu/ggi/pph2/c2ea64efde6f039a5ca76a2a264ae4f3cf922360/1121012.html ) HCD highly conserved domain All of the detected mutations were heterozygous, and almost all of them corresponded to hot spots previously reported in different tumour types (http://genetics.bwh.harvard.edu/ggi/pph2/c2ea64efde6f039a5ca76a2a264ae4f3cf922360/1121012.html). The locations of the mutations were randomly distributed across the sequenced region. No specific pattern of mutation location seemed to be related to tumour subtype, angiogenic or non-angiogenic (Fig. 1 and Table 9).
Fig. 1

Localization of the mutations detected on the p53 gene. The sequenced region is indicated with an orange line in the figure above. Mutation locations are indicated with arrowheads (purple mutations found in angiogenic samples; gray: mutations found in non-angiogenic samples). Human P53 protein (HP53) can be divided into five domains, each corresponding to specific functions: yellow is the highly conserved domain I (HCD I)/transactivation domain; red is the second transactivation domain, which is proline-rich; blue is the DNA-binding domain essential for p53-DNA interactions that also contains HCD II-V and is the target of 90% of the p53 mutations found in human cancers; green is the nuclear export signal (NES) localized in the oligomerization domain of p53

Localization of the mutations detected on the p53 gene. The sequenced region is indicated with an orange line in the figure above. Mutation locations are indicated with arrowheads (purple mutations found in angiogenic samples; gray: mutations found in non-angiogenic samples). Human P53 protein (HP53) can be divided into five domains, each corresponding to specific functions: yellow is the highly conserved domain I (HCD I)/transactivation domain; red is the second transactivation domain, which is proline-rich; blue is the DNA-binding domain essential for p53-DNA interactions that also contains HCD II-V and is the target of 90% of the p53 mutations found in human cancers; green is the nuclear export signal (NES) localized in the oligomerization domain of p53

Discussion

As initially suggested by our mRNA profiling work [19] and also confirmed by the immunohistochemical data presented here, we failed to reveal significant differences between angiogenic and non-angiogenic NSCLCs as far as the expression of proteins associated with the classic hypoxia/angiogenesis pathway is concerned. Because neovascularisation is found in some tumours but not in others, we suggest that activation of the classical angiogenic pathways is necessary, but not sufficient, to induce the sprouting of new vessels in cancer. The higher levels of expression of proteins associated with extracellular matrix, cell adhesion, and inflammation were in agreement with the observed presence of tumour-associated stroma and chronic inflammation in many angiogenic tumours [18, 22]. mRNA profiling of these tumours has equally shown that stromal remodeling, cell adhesion, and inflammation are enhanced in angiogenesis [19]. Both mRNA and immunohistochemical data suggest a crucial role in angiogenic cancers for FBJ murine osteosarcoma viral oncogene homolog (FOS), a protein involved in cell proliferation, remodeling, and inflammation. The question remains of whether tissue remodeling is a consequence or a cause of the triggering of angiogenesis. Because non-angiogenic tumours usually preserve the pre-existing architecture, we hypothesize that the triggering of tissue destruction could be a secondary step necessary for the activation of angiogenesis. Nonetheless, this process would be far from a general rule because we have observed, in a subset of NSCLC, that angiogenesis can occur in the absence of tissue destruction [23]. Clearly, other mechanisms must exist. If classical angiogenesis pathways are similarly active in both angiogenic and non-angiogenic tumours, how does their biology differ? Our previous transcriptional profiling work demonstrated higher levels of mRNA coding for molecules associated with oxidative phosphorylation and mitochondrial biogenesis in non-angiogenic tumours [19]. In the present study, we did not examine components of the oxidative phosphorylation pathway, although we did investigate the expression of some proteins involved in mitochondrial functions. Our results showed that proteins related to mitochondria and to cell biogenesis-promoting processes were more highly expressed in non-angiogenic tumours than in angiogenic tumours. This feature was consistent with higher mitochondrial regulatory activity and a possible metabolic switch in non-angiogenic tumours. Again, whether this switch is a cause or an effect of HIF activation remains unclear. Interestingly, our data suggested increased involvement of response to hypoxia and to HIF regulation by oxygen in non-angiogenic tumours. We hence speculate that, in these tumours, although the HIF pathway failed to induce new vessel formation, it could well be involved in metabolic reprogramming. Finally, we noted markedly higher levels of cytoplasmic P53 expression in non-angiogenic tumours than in angiogenic tumours via immunohistochemistry. In a pilot study, we sequenced p53 in a limited number of angiogenic and non-angiogenic NSCLCs. Non-angiogenic tumours had a higher incidence of mutations, which were all missense mutations, whereas angiogenic tumours had an amalgam of frame shifts and missense and nonsense mutations. Because p53 also affects mitochondrial respiration [24], it will be necessary to investigate further how the observed p53 mutations could functionally affect its ability to regulate respiration and/or angiogenesis.

Conclusions

On the basis of our observations collected so far, from the mRNA profiling, immunohistochemical and histopathologic data, we conclude that all tumours, angiogenic and non-angiogenic, experience hypoxia/HIF and VEGF pathway activation. However, angiogenesis does not always ensue. Based on these findings, we suggest that in non-angiogenic tumours, HIF pathway activation could be the driving force toward metabolic reprogramming.
  23 in total

1.  On the origin of cancer cells.

Authors:  O WARBURG
Journal:  Science       Date:  1956-02-24       Impact factor: 47.728

Review 2.  Mitochondria in cancer: not just innocent bystanders.

Authors:  Christian Frezza; Eyal Gottlieb
Journal:  Semin Cancer Biol       Date:  2008-12-03       Impact factor: 15.707

Review 3.  Tumor angiogenesis: therapeutic implications.

Authors:  J Folkman
Journal:  N Engl J Med       Date:  1971-11-18       Impact factor: 91.245

4.  Non-small-cell lung carcinoma tumor growth without morphological evidence of neo-angiogenesis.

Authors:  F Pezzella; U Pastorino; E Tagliabue; S Andreola; G Sozzi; G Gasparini; S Menard; K C Gatter; A L Harris; S Fox; M Buyse; S Pilotti; M Pierotti; F Rilke
Journal:  Am J Pathol       Date:  1997-11       Impact factor: 4.307

Review 5.  Choosing between glycolysis and oxidative phosphorylation: a tumor's dilemma?

Authors:  Caroline Jose; Nadège Bellance; Rodrigue Rossignol
Journal:  Biochim Biophys Acta       Date:  2010-10-16

Review 6.  Why do cancers have high aerobic glycolysis?

Authors:  Robert A Gatenby; Robert J Gillies
Journal:  Nat Rev Cancer       Date:  2004-11       Impact factor: 60.716

7.  The metabolic profile of tumors depends on both the responsible genetic lesion and tissue type.

Authors:  Mariia O Yuneva; Teresa W M Fan; Thaddeus D Allen; Richard M Higashi; Dana V Ferraris; Takashi Tsukamoto; José M Matés; Francisco J Alonso; Chunmei Wang; Youngho Seo; Xin Chen; J Michael Bishop
Journal:  Cell Metab       Date:  2012-02-08       Impact factor: 27.287

Review 8.  How cancer metabolism is tuned for proliferation and vulnerable to disruption.

Authors:  Almut Schulze; Adrian L Harris
Journal:  Nature       Date:  2012-11-15       Impact factor: 49.962

Review 9.  The TCA cycle and tumorigenesis: the examples of fumarate hydratase and succinate dehydrogenase.

Authors:  Patrick J Pollard; Noel C Wortham; Ian P M Tomlinson
Journal:  Ann Med       Date:  2003       Impact factor: 4.709

Review 10.  Hallmarks of cancer: the next generation.

Authors:  Douglas Hanahan; Robert A Weinberg
Journal:  Cell       Date:  2011-03-04       Impact factor: 41.582

View more
  7 in total

Review 1.  Non-angiogenic tumours and their influence on cancer biology.

Authors:  Tom Donnem; Andrew R Reynolds; Elizabeth A Kuczynski; Kevin Gatter; Peter B Vermeulen; Robert S Kerbel; Adrian L Harris; Francesco Pezzella
Journal:  Nat Rev Cancer       Date:  2018-03-09       Impact factor: 60.716

Review 2.  Vessel co-option in cancer.

Authors:  Elizabeth A Kuczynski; Peter B Vermeulen; Francesco Pezzella; Robert S Kerbel; Andrew R Reynolds
Journal:  Nat Rev Clin Oncol       Date:  2019-08       Impact factor: 66.675

3.  Twenty years after: the beautiful hypothesis and the ugly facts.

Authors:  Francesco Pezzella; Kevin Gatter; Chao-Nan Qian
Journal:  Chin J Cancer       Date:  2016-02-24

4.  Perivascular cell coverage of intratumoral vasculature is a predictor for bevacizumab efficacy in metastatic colorectal cancer.

Authors:  Chang Jiang; Yu-Hua Huang; Jia-Bin Lu; Yuan-Zhong Yang; Hui-Lan Rao; Bei Zhang; Wen-Zhuo He; Liang-Ping Xia
Journal:  Cancer Manag Res       Date:  2018-09-17       Impact factor: 3.989

5.  Expression profiles of VEGF-A, VEGF-D and VEGFR1 are higher in distant metastases than in matched primary high grade epithelial ovarian cancer.

Authors:  Minna Sopo; Maarit Anttila; Kirsi Hämäläinen; Annukka Kivelä; Seppo Ylä-Herttuala; Veli-Matti Kosma; Leea Keski-Nisula; Hanna Sallinen
Journal:  BMC Cancer       Date:  2019-06-14       Impact factor: 4.430

Review 6.  Propensity for Early Metastatic Spread in Breast Cancer: Role of Tumor Vascularization Features and Tumor Immune Infiltrate.

Authors:  Mario Rosario D'Andrea; Vittore Cereda; Luigi Coppola; Guido Giordano; Andrea Remo; Elena De Santis
Journal:  Cancers (Basel)       Date:  2021-11-25       Impact factor: 6.639

7.  Aerobic Exercise Training-Induced Changes on DNA Methylation in Mild Cognitively Impaired Elderly African Americans: Gene, Exercise, and Memory Study - GEMS-I.

Authors:  Julius S Ngwa; Evaristus Nwulia; Oyonumo Ntekim; Fikru B Bedada; Bernard Kwabi-Addo; Sheeba Nadarajah; Steven Johnson; William M Southerland; John Kwagyan; Thomas O Obisesan
Journal:  Front Mol Neurosci       Date:  2022-01-17       Impact factor: 5.639

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.