Literature DB >> 26870091

Association of vitamin D receptor gene BsmI (A>G) and FokI (C>T) polymorphism in gestational diabetes among Saudi Women.

Hesham A El-Beshbishy1, Manal A Tawfeek2, Inass M Taha3, Thoraya FadulElahi4, Amal Y Shaheen5, Fouad A Bardi5, Intessar I Sultan6.   

Abstract

OBJECTIVE: Vitamin D receptor (VDR) gene polymorphism have a role in diabetes mellitus pathogenesis. Present study was conducted to determine VDR gene variants among Saudi gestational diabetics (GDM) in Madina, KSA.
METHODS: This cross sectional study was conducted on 112 GDM patients and 218 normal healthy control. Age, body mass index and blood pressure levels were recorded. Serum triglycerides (mg/dl), total cholesterol, HDL-cholesterol, LDL-cholesterol, fasting blood glucose FBG and post-prandial blood glucose PPBG were estimated. Extracted DNA template was amplified by PCR reaction and genotyped for single nucleotide polymorphism of BsmI and FokI by restriction fragment length polymorphism-PCR (RFLP-PCR) analysis.
RESULTS: FBG and PPBG levels in GDM patients were significantly elevated by +48.6% and +50%, respectively (P=0.005). Serum triglycerides, total cholesterol and LDL-cholesterol (mg/dl) levels in GDM patients were elevated significantly by +40.5% (P=0.005), +16% (P=0.01) and +30.8% (P=0.005), respectively. Serum HDL-cholesterol (mg/dl) showed significant decline by -10.5%. FokI VDR genotypes showed association with PPBG (P=0.05) among GDM patients. The Ff, FF and ff genotype percentage among GDM patients was 48.2%, 30.4% and 21.4%, respectively. FokI (F and f) and BsmI (B and b) alleles frequency showed no significant difference between GDM patients and control. Percentage BsmI and FokI total homozygous and heterozygous variants among GDM was 45.5% and 81.4%, respectively.
CONCLUSION: VDR BsmI and FokI polymorphic marker not associated with Saudi GDM.

Entities:  

Keywords:  BsmI; FokI; Gestational diabetes; Polymorphism; Vitamin D receptor

Year:  2015        PMID: 26870091      PMCID: PMC4744276          DOI: 10.12669/pjms.316.7525

Source DB:  PubMed          Journal:  Pak J Med Sci        ISSN: 1681-715X            Impact factor:   1.088


INTRODUCTION

Vitamin D deficiency is associated with diabetes mellitus.1-3 Vitamin D receptor (VDR) gene variants may contribute to development of diabetes mellitus through calcium metabolism alteration and modulation of insulin secretion.4-6 VDR gene having 6 genes polymorphic forms. Among them; FokI restriction fragment length polymorphism (RFLP) in exon 2 and Bsm1 RFLPs which located between exons 8 and 9. Polymorphism located at 3end of VDR gene BsmI (A to G), have unknown functional effects.7 Positive association between BsmI (genotype bb) polymorphisms with reduced insulin secretory capacity was reported.8 Diabetics with BB genotype of BsmI allele in VDR gene presented higher levels of C-peptide suggesting association between VDR polymorphism and diabetes.9 Gestational diabetes (GDM) patients are known to be at greater risk of reduced vitamin D levels as vitamin D was deficient in 70.6% of GDM patients.10,11 This study was carried out in order to investigate association between VDR-BsmI(A>G) and VDR-FokI (C>T) gene polymorphism and risk of GDM among Saudi pregnant women located in Madina-Saudi Arabia.

METHODS

Blood samples were collected from 112 pregnant GDM and 218 normal healthy control Saudi women from outpatient clinic of Ohud hospital, Madina, Saudi Arabia from 11-2013 till 11-2014. Local ethical committee of Medical Applied Sciences faculty, Taibah University, Saudi Arabia approved study protocol and written informed consent was obtained from participants. Age (years), body mass index-BMI (Kg/m2), systolic blood pressure (mm/Hg) and diastolic blood pressure (mm/Hg) levels were recorded. Serum triglycerides (mg/dl), total cholesterol (mg/dl), HDL-cholesterol (mg/dl) and LDL-cholesterol (mg/dl) levels were estimated using kits from Randox, UK. Fasting blood glucose FBG (mg/dl), post-prandial blood glucose PPBG (mg/dl), were determined using glucose oxidase kit from Randox, UK. Patients screeningwas carried out according to American Diabetes Association guidelines.12 Exclusion criteria included diabetic women, women with multiple pregnancies or diseases as infections, nephropathy, retinopathy,…. etc, and smoking. Five ml blood sample was collected in EDTA-tube. DNA was extracted using GelElute DNA extraction kit (QIAGEN, Germany) and was checked for purity and concentration.13 DNA samples were all quoted and stored at -20°C till analysis. DNA (2 µl) was amplified in 50 µl PCR reaction mixture containing 5 µl10x PCR buffer, 25 mM MgCl2, 4 m MdNTPs, 15.M of each primer and 0.5UTaq DNA polymerase. Primers used in this study are listed in Table-I. PCR thermal cycler (SwiftMaxi thermal cycler, ESCO Technologies Inc., USA) was programmed as follows: denaturation step at 95°C for three minutes followed by 35 cycles as follows:- 94°C for 20 sec; 60°C for 40 seconds and 72°C for one minute. Final extension cycle at 72°C for 5 minutes was done. PCR reactions were set up separately for FokI and BsmI polymorphic sites of VDR gene. PCR products were analyzed on 2% agarose gel and UV-visualized.
Table-I

Primers used for polymerase chain reaction (PCR)of VDR FokI and BsmI genes.

PolymorphismPrimer
Exon 7/Intron 8 (A/G)F 5`CAACCAAGACTACAAGTACCGCGTCAGTGA3`
Bsm1 rs1544410R 5`AACCAGCGGGAAGAGGTCAAGGG 3`
Exon 2 (T/C)F 5`AGCTGGCCCTGGCACTGACTCTGCTCT 3`
Fok1 rs2228570R 5`ATGGAAACACCTTGCTTCTTCTCCCTC 3`

VDR: Vitamin D receptor.

Primers used for polymerase chain reaction (PCR)of VDR FokI and BsmI genes. VDR: Vitamin D receptor. Restriction fragment length polymorphism (RFLP-PCR) was used to identifyVDR genotypes. Amplified PCR product (10 ml) was digested (37°C for 20h) with 4U of either BsmI or FokI restriction enzyme (NEB, UK) in 20 µl reaction volume. Digested product was electrophoresed on 2% agarose gel. For statistical analysis, capital letters represented absence and lowercase letters represented presence of BsmI or FokI restriction site; (B/b) and (F/f), respectively. Genotype was determined according to fragments length i.e. homozygote GG(BB) subjects = 650 and 172bp product; heterozygote GA (Bb) subjects = 822, 650and 172bp products and homozygote AA (bb) subjects =822bp product. SNP resulting in A-G substitution in VDR gene intron 8 leads to generation of a BsmI restriction site. Homozygous subjects with alleles containing nucleotide A at this position showed one band at 822 bp and were designated as having bb BsmI genotype. Homozygous subjects with alleles containing G at this position showed 2 bands of 650 and 172bp and were designated as BB. Subjects with heterozygote status showed 3 bands:825, 650 and 172bp and were designated Bb.14 FokI genotype was determined according to fragments length i.e. homozygote (FF) subjects = 196, 69bp product;heterozygote (Ff) subjects =265, 196 and 69bp products and homozygote (ff) subjects =265bp product. SNP resulting in T-C substitution in exon2 of VDR gene leads to the generation of a FokI restriction site. Homozygous subjects with alleles containing nucleotide T at this position showed an intact 265bp band and were designated as having ff FokI genotype. Homozygous subjects with alleles containing C at this position showed 2 bands of 196 and 69bp (FF Subjects). Heterozygote subjects showed all 3 bands: 265, 196 and 69bp and were designated Ff.15 Results were presented as means±standard error (SE) and number (percentage). Difference between two groups was determined by unpaired Student`s t-test using GraphPad Prism software version 5.0 (USA). Results were considered statistically significant at P ≤0.05.

RESULTS

Total number of 112 GDM patients and 218 healthy pregnant women were recruited in our study. Age, BMI, systolic and diastolic blood pressureshow no statistical significant difference compared to normal control (Table-II).
Table-II

Demographic and biochemical data of GDM patients and controls.

ParameterGDM patients (n= 112)Controls (n=218)P value
Age (years) % change from control41±4.1+2.4%40±3.10.9
BMI (Kg/m2) % change from control24.8±1.4 +8.5%22.7±1.30.5
B.P. systolic (mm/Hg) % change from control131±3.6 +7.6%121±4.10.2
B.P. diastolic (mm/Hg) % change from control82±3.6 +4.8%78±3.60.6
FBG (mg/dl) % change from control175±6.1 +48.6%90±4.20.005
PPBG (mg/dl) % change from control260±7.1 +50%130±5.20.005
Triglycerides (mg/dl) % change from control185±5.1 +40.5%110±4.20.005
Total cholesterol (mg/dl) % change from control176±4.8 +16%148±5.60.01
HDL-cholesterol (mg/dl) % change from control38±1.7 -10.5%42±1.40.2
LDL-cholesterol (mg/dl) % change from control146±5.2 +30.8%101±4.30.005

Data were expressed as mean+SE.

BMI: body mass index; HDL-C: high density lipoprotein-cholesterol; LDL-C: low density lipoprotein-cholesterol; B.P.: blood pressure; FBG: fasting blood glucose; PPBG: post-prandial blood glucose.

Demographic and biochemical data of GDM patients and controls. Data were expressed as mean+SE. BMI: body mass index; HDL-C: high density lipoprotein-cholesterol; LDL-C: low density lipoprotein-cholesterol; B.P.: blood pressure; FBG: fasting blood glucose; PPBG: post-prandial blood glucose. FBG and PPBG levels in GDM patients were significantly elevated by +94.4% and +50%, respectively, compared to normal control (P=0.005). Serum triglycerides, total cholesterol and LDL-cholesterol levels in GDM patients were elevated significantly by +68.2% (P=0.005), +18.2% (P=0.01) and +44.55% (P=0.005), respectively, compared with normal control. Whereas serum HDL-cholesterol showed non-significant decline by -9.1%, compared to normal control (P=0.2) (Table-II). Fig.1, shows PCR product of 822 bp for VDR BsmI gene and 265 bp for VDR FokI gene. We compared FokI and BsmI VDR genotypes with demographic and biochemical parameters of GDM patients but we could not achieve significant association of any of the parameters except PPBG (P=0.05) with VDR FokI genotypes (Table-III).
Fig.1

2% agarose gel electrophoresis of VDR PCR for [A] VDR SNPs BsmI enzyme showing a wild type bb 822bp product [B] VDR SNPs FokI enzyme showing a wild type ff 265bp product. Lane 1: 100bp DNA ladder, Lanes 2-10: PCR product DNA. PCR: polymerase chain reaction; SNPs: single nucleotide polymorphism; VDR: vitamin D receptor.

Table-III

Association of various biochemical and clinical parameters with different VDR (BsmI and FokI) genotypes in GDM.

ParameterBsmIP valueFokIP value
bbBB + BbffFF+ Ff
Age (years)42±3.140±4.10.841±3.141±2.10.9
BMI (Kg/m2)23.8±1.422.9±1.40.824.8±1.424.8±1.40.95
B.P. systolic(mm/Hg)134±4.5136±3.60.9131.5±3.5131.7±3.30.988
B.P. diastolic(mm/Hg)81±3.486±3.20.581.3±3.681.5±3.60.98
FBG (mg/dl)165±7.1175±5.90.5161.4±6.1171.5±6.10.4
PPBG (mg/dl)249±8.1265±7.80.4239±7.1268±7.10.5
Triglycerides (mg/dl)191±4.0175±4.80.1176±4.1185±6.10.4
Cholesterol (mg/dl)177±3.7166±3.90.2172±3.3169±5.20.8
HDL-C (mg/dl)37.4±1.637.15±1.90.9537.6±1.736.9±1.60.9
LDL-C (mg/dl)155±8.2161±7.20.7155.6±4.2156±3.90.98

Data were expressed as mean+SE. BMI: body mass index; HDL-C: high density lipoprotein-cholesterol;

LDL-C: low density lipoprotein-cholesterol; B.P.: blood pressure; FBG: fasting blood glucose;

PPBG: post-prandial blood glucose. bb, ff: wild genotypes; BB, FF: homozygous variants;

Bb, Ff: heterozygous variants.

2% agarose gel electrophoresis of VDR PCR for [A] VDR SNPs BsmI enzyme showing a wild type bb 822bp product [B] VDR SNPs FokI enzyme showing a wild type ff 265bp product. Lane 1: 100bp DNA ladder, Lanes 2-10: PCR product DNA. PCR: polymerase chain reaction; SNPs: single nucleotide polymorphism; VDR: vitamin D receptor. Association of various biochemical and clinical parameters with different VDR (BsmI and FokI) genotypes in GDM. Data were expressed as mean+SE. BMI: body mass index; HDL-C: high density lipoprotein-cholesterol; LDL-C: low density lipoprotein-cholesterol; B.P.: blood pressure; FBG: fasting blood glucose; PPBG: post-prandial blood glucose. bb, ff: wild genotypes; BB, FF: homozygous variants; Bb, Ff: heterozygous variants. Genotype and allele frequency of VDR FokI and BsmI gene polymorphism in GDM patients and controls showed insignificant differences (Table-IV). Table-V, shows that BsmI total percentage of homozygous and heterozygous variants among GDM patients and control was 45.5% and 81.4%, respectively. FokI total percentage of homozygous and heterozygous variants among GDM patients and control was 78.6% and 84.8%, respectively.
Table-IV

Genotypes and allele frequenciesof VDR BsmI and FokI gene polymorphism.

Genotype/Allele frequencyRFLP-PCR products (bp)GDM, no (%) n= 112Control, no (%) n= 218P value
BsmI Genotype frequency
WildAA bb82261 (54.5)40 (18.3)0.820
Homozygous variantGG BB650, 17211 (9.8)66 (30)
Heterozygous variantGA Bb822, 650,17240 (35.7)112 (51.4)
BsmI Allele frequency0.236
Allele B45 (40.2)101 (46.3)
Allele b67 (59.8)117 (53.7)
FokI Genotype frequency
WildCC ff26524 (21.4)33 (15.1)0.341
Homozygous variantTT Ff196, 6934 (30.4)65 (29.8)
Heterozygous variantTC Ff265,196, 6954 (48.2)120 (55)
FokI Allele frequency
Allele F40 (35.7)123 (56.4)0.100
Allele f72 (64.3)95 (43.6)

RFLP-PCR: restriction fragment length polymorphism; VDR: vitamin D receptor.

Table-V

VDR gene BsmI and FokI gene polymorphism (homozygous + heterozygous) variants of the study groups.

GenotypeGDM, no (%) n= 112Control, no (%) n= 218
BsmI
Wild type61 (54.5)40 (18.3)
Variant (homo and heterozygous)51 (45.5)178 (81.4)
FokI
Wild type24 (21.4)33 (15.1)
Variant (homo and heterozygous)88 (78.6)185 (84.8)

VDR: vitamin D receptor.

Genotypes and allele frequenciesof VDR BsmI and FokI gene polymorphism. RFLP-PCR: restriction fragment length polymorphism; VDR: vitamin D receptor. VDR gene BsmI and FokI gene polymorphism (homozygous + heterozygous) variants of the study groups. VDR: vitamin D receptor.

DISCUSSION

Diabetes mellitus has become major health concern worldwide. About 90-95% of the total diabetics are of type 2.16 Diabetes mellitus affect about 30% of Saudi population. Females <50 years old (gestational age) had greater prevalence than males.17 VDR polymorphism influences susceptibility to type 1 diabetes mellitus, but association with GDM is not yet clear.18 Vitamin D has suggested to be strongly related to pancreatic β-cell function and insulin sensitivity.8,19 It was reported that, no association was noticed between VDR BsmI polymorphism and GDM in Saudi population.20 We analyzed VDR gene BsmI (A>G) and FokI (C>T) polymorphic markers in GDM pregnant Saudi women. It was revealed that, VDR gene polymorphic markers were not found to be associated with VDR gene polymorphic markers with type 1 diabetes mellitus.21 Genotypes frequencies for wild, heterozygous and homozygous variant of BsmI polymorphic allele among control groups were 0.183, 0.300 and 0.514, respectively, and among GDM patients were 0.545, 0.0980 and 0.357, respectively, with insignificant association (P=0.820). Total homozygous and heterozygous was 0.455 and 0.814 among GDM patients and control, respectively (Table IV & V). It was reported that, BsmI genotype frequencies in GDM Saudi subjects were 0.300, 0.100 and 0.600, respectively; with no significance.20 Genotypes frequencies for wild, heterozygous and homozygous variant of FokI polymorphic allele in control were 0.151, 0.298 and 0.551, respectively, and in GDM patients were 0.214, 0.304 and 0.482, respectively, withno significance (P=0.341). Total homozygous and heterozygous was 0.786 and 0.848 among GDM patients and control, respectively (Table IV & V). This is the first time that, VDR gene Fok1 polymorphic allele was analyzed in Saudi GDM subjects. Other studies have revealed that Fok1 genotype frequencies among Indians were 0.437,0.491 and 0.07221.22 Both FBG and PPBG did not show significant different between those with wild type and variant allele of both BsmI and FokI gene polymorphism among control and GDM subjects (Table-VI). These findings, are in contrast with results of other studies that showed direct association between BsmI and elevated FBG.15 An Indian study suggested that, VDR gene polymorphism is associated with type 2 DM.23 We reported no evidence of allelic or genotypic association of the BsmI and FokI of VDR gene with GDM in our studied GDM population. Results obtained by different investigators who studied BsmI polymorphism varied among diabetics. BsmI polymorphism has been linked to susceptibility to diabetes in several countries.5,24 However, studies in other countries could not establish association between BsmI and existence of diabetes.25,26 In type 2 DM, a link between BsmI and the onset of the disease has been found in several countries.27,28 but not amongother populations.29,30 These variations may due to ethnic differences in VDR polymorphisms distribution that may have role in diabetes mellitus pathogenesis.

CONCLUSION

Both BsmI (A>G) and FokI (C>T) VDR gene polymorphism showed non-significant association with GDM subjects except for PPBG in case of FokI genotype. Polymorphic marker alleles did not have effect on glycemic of Saudi GDM patients. Further merit investigation will be required to elucidate these findings using larger sample size.
  26 in total

1.  Vitamin D and estrogen receptor gene polymorphisms in type 2 diabetes mellitus and in android type obesity.

Authors:  G Speer; K Cseh; G Winkler; P Vargha; E Braun; I Takács; P Lakatos
Journal:  Eur J Endocrinol       Date:  2001-04       Impact factor: 6.664

2.  Screening for type 2 diabetes.

Authors: 
Journal:  Diabetes Care       Date:  2004-01       Impact factor: 19.112

3.  Influence of the vitamin D receptor gene alleles on bone mineral density in postmenopausal and osteoporotic women.

Authors:  C Vandevyver; T Wylin; J J Cassiman; J Raus; P Geusens
Journal:  J Bone Miner Res       Date:  1997-02       Impact factor: 6.741

4.  Vitamin D receptor polymorphism and susceptibility to type 1 diabetes in the Dalmatian population.

Authors:  Veselin Skrabić; Tatijana Zemunik; Marjan Situm; Janos Terzić
Journal:  Diabetes Res Clin Pract       Date:  2003-01       Impact factor: 5.602

5.  Cloning and expression of full-length cDNA encoding human vitamin D receptor.

Authors:  A R Baker; D P McDonnell; M Hughes; T M Crisp; D J Mangelsdorf; M R Haussler; J W Pike; J Shine; B W O'Malley
Journal:  Proc Natl Acad Sci U S A       Date:  1988-05       Impact factor: 11.205

6.  Vitamin D receptor gene polymorphisms are associated with obesity in type 2 diabetic subjects with early age of onset.

Authors:  W Z Ye; A F Reis; D Dubois-Laforgue; C Bellanné-Chantelot; J Timsit; G Velho
Journal:  Eur J Endocrinol       Date:  2001-08       Impact factor: 6.664

Review 7.  The role of vitamin D and calcium in type 2 diabetes. A systematic review and meta-analysis.

Authors:  Anastassios G Pittas; Joseph Lau; Frank B Hu; Bess Dawson-Hughes
Journal:  J Clin Endocrinol Metab       Date:  2007-03-27       Impact factor: 5.958

8.  Vitamin D receptor polymorphism and susceptibility to type 1 diabetes in Chilean subjects: a case-parent study.

Authors:  Barbara Angel; José Luis Santos; Elena Carrasco; Cecilia Albala; Francisco Pérez-Bravo
Journal:  Eur J Epidemiol       Date:  2004       Impact factor: 8.082

Review 9.  Role of vitamin D in the pathogenesis of type 2 diabetes mellitus.

Authors:  X Palomer; J M González-Clemente; F Blanco-Vaca; D Mauricio
Journal:  Diabetes Obes Metab       Date:  2008-03       Impact factor: 6.577

10.  Vitamin D receptor initiation codon polymorphism influences genetic susceptibility to type 1 diabetes mellitus in the Japanese population.

Authors:  Y Ban; M Taniyama; T Yanagawa; S Yamada; T Maruyama; A Kasuga; Y Ban
Journal:  BMC Med Genet       Date:  2001-06-25       Impact factor: 2.103

View more
  9 in total

1.  Association of Vitamin D Deficiency and Vitamin D Receptor Genetic Variants With Coronary Artery Disease in Type 2 Diabetic Saudi Patients.

Authors:  Alaa Shafie; Ahmad El Askary; Mazen Almehmadi; Hatem H Allam; Lamiaa K Elsayyad; Asmaa F Hassan; Bader B Althobaiti; Amin Nadheef; Aisha H Alharthi; Amal F Gharib
Journal:  In Vivo       Date:  2022 May-Jun       Impact factor: 2.406

2.  Maternal genetic contribution to pre-pregnancy obesity, gestational weight gain, and gestational diabetes mellitus.

Authors:  Selvihan Beysel; Nilnur Eyerci; Mustafa Ulubay; Mustafa Caliskan; Muhammed Kizilgul; Merve Hafızoğlu; Erman Cakal
Journal:  Diabetol Metab Syndr       Date:  2019-05-14       Impact factor: 3.320

3.  The VDR gene FokI polymorphism is associated with gestational diabetes mellitus in Turkish women.

Authors:  Mahmut Apaydın; Selvihan Beysel; Nilnur Eyerci; Ferda Alparslan Pinarli; Mustafa Ulubay; Muhammed Kizilgul; Ozhan Ozdemir; Mustafa Caliskan; Erman Cakal
Journal:  BMC Med Genet       Date:  2019-05-16       Impact factor: 2.103

4.  Association of vitamin D receptor gene polymorphisms with gestational diabetes mellitus-a case control study in Wuhan, China.

Authors:  Jianqiong Liu; Qiong Dai; Wei Li; Yan Guo; Anna Dai; Yanqing Wang; Mengyao Deng; Zhao Tang; Lu She; Xiaohong Chen; Mei Yang
Journal:  BMC Pregnancy Childbirth       Date:  2021-02-17       Impact factor: 3.007

5.  Association between Gene Polymorphisms of Vitamin D Receptor and Gestational Diabetes Mellitus: A Systematic Review and Meta-Analysis.

Authors:  Qian Zhou; Shiwu Wen; Miao Liu; Sulei Zhang; Xin Jin; Aizhong Liu
Journal:  Int J Environ Res Public Health       Date:  2020-12-29       Impact factor: 3.390

6.  The role of vitamin D receptor gene polymorphisms in gestational diabetes mellitus susceptibility: a meta-analysis.

Authors:  Sai Liu
Journal:  Diabetol Metab Syndr       Date:  2021-12-13       Impact factor: 3.320

7.  Association between functional genetic variants in retinoid X receptor-α/γ and the risk of gestational diabetes mellitus in a southern Chinese population.

Authors:  Xiang-Yuan Yu; Li-Ping Song; Hui-Ting Zheng; Shu-Dan Wei; Xiao-Lan Wen; Bo Huang; Da-Bin Liu
Journal:  Biosci Rep       Date:  2021-10-29       Impact factor: 3.840

8.  The Association Between FokI Vitamin D Receptor Polymorphisms With Metabolic Syndrome Among Pregnant Arab Women.

Authors:  Maysa Alzaim; Nasser M Al-Daghri; Shaun Sabico; Mona A Fouda; Sara Al-Musharaf; Malak N K Khattak; Abdul Khader Mohammed; Abdulrahman Al-Ajlan; Dalal N Binjawhar; Richard Wood
Journal:  Front Endocrinol (Lausanne)       Date:  2022-02-24       Impact factor: 5.555

Review 9.  Role of Placental VDR Expression and Function in Common Late Pregnancy Disorders.

Authors:  Julia Knabl; Aurelia Vattai; Yao Ye; Julia Jueckstock; Stefan Hutter; Franz Kainer; Sven Mahner; Udo Jeschke
Journal:  Int J Mol Sci       Date:  2017-11-06       Impact factor: 5.923

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.