Literature DB >> 26865023

Effects of three permeases on arginine utilization in Saccharomyces cerevisiae.

Peng Zhang1,2, Guocheng Du1,2, Huijun Zou3, Jian Chen1,2, Guangfa Xie3, Zhongping Shi1,2, Jingwen Zhou1,2.   

Abstract

Arginine plays an important role in cellular function and metabolism. Arginine uptake mainly occurs through three amino acid permeases, Alp1p, Gap1p and Can1p, which act as both transporters and receptors for amino acid utilization. In this study, seven mutants were constructed with different combinations of permease deficiencies that inhibit arginine utilization. Their effects on arginine metabolism were measured. The three amino acid permeases were also individually overexpressed in wild-type (WT), Δalp1Δgap1Δcan1 and Δnpr1 strains. The growth and arginine utilization of Δcan1, Δgap1Δcan1 and Δalp1Δgap1Δcan1 mutants were suppressed in YNB medium when arginine was the sole nitrogen source. Meanwhile, overexpression of Alp1p and Can1p enhanced growth and arginine utilization in WT, Δalp1Δgap1Δcan1 and Δnpr1. Besides, overexpression of Can1p caused a 26.7% increase in OD600 and 29.3% increase in arginine utilization compared to that of Alp1p in Δalp1Δgap1Δcan1. Transcription analysis showed that the effects of three amino acid permeases on the arginine utilization and the regulation of related genes, were tightly related to their individual characteristics. However, their overall effects were different for different combinations of mutants. The results presented here suggest some possible synergistic effects of different amino acid permeases on regulation of amino acid utilization and metabolism.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26865023      PMCID: PMC4750040          DOI: 10.1038/srep20910

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Arginine plays an important role in cellular function and metabolism1. Arginine metabolism is modulated by the activities of various transporters that move arginine and its metabolites across the plasma and mitochondrial membranes2. In Saccharomyces cerevisiae, arginine is transported mainly by three amino acid permeases, i.e., Can1p, Gap1p and Alp1p3. The specific arginine permease Can1p was the first one to be cloned and characterized4. Overexpression of Can1p can increase the efficiency of arginine uptake5. Gap1p is a general amino acid permease that can transport all naturally occurring L-amino acids, some D-amino acids, γ-aminobutyric acid6 and polyamines (putrescine and spermidine)7. Alp1p is considered to be a putative arginine permease8. Overexpression of Alp1p could also increase the efficiency of arginine uptake9. In S. cerevisiae, arginine is first transported into the cell, then transported to the vacuole by vacuolar basic amino acid transporter 2 (Vba2p)10. Arginine biosynthesis genes, such as ARG1, ARG3, ARG4, ARG5,6 and ARG8, are negatively regulated by arginine uptake, while arginine utilization genes such as CAR1, CAR2 are positively regulated11. In addition to the direct induction of arginine metabolic gene expression caused by an influx of arginine, arginine uptake is also regulated by the general control of amino acid biosynthesis (GAAC)12. In a nitrogen-poor environment, arginine permease genes are activated by nitrogen catabolic repression (NCR) regulators Gln3p and Gat1p13. However, the mechanisms enabling cells to properly coordinate cellular arginine pools are not well understood3. Some of the previous works showed that GATA regulators were regulated by both NCR and target of rapamycin complex 1 (TORC1) dependent pathways14. In response to different nutrient conditions, the TORC1 complex plays a key role in regulating cell growth and nutrient uptake15. It is a general regulator involved in cellular transcription, translation and induction of cell autophagy in yeast16. The regulation of nitrogen utilization in yeast by TORC1 complex occurs mainly through its roles in cell endocytosis by a negative phosphate kinase Npr1p, the arrestin-related protein Art1p, and the ubiquitin ligase Rsp5p161718. In nitrogen-poor environments, the TORC1 pathway is blocked. Then some of the amino acid permeases are phosphorylated by Npr1p, activating the transporter protein function. When glutamine and other preferred nitrogen source are present, the TORC1 pathway is activated while the Npr1p phosphorylation is inhibited, arginine permeases could be polyubiquitined by ubiquitin ligase Rsp5p and its associated binding adaptor proteins. The permease is subsequently transported to the vacuole for degradation19. The mechanisms of regulation for amino acid permeases have been well analyzed319. However, for amino acid permeases with the ability to transport the same amino acid, knowledge of the precise regulation scheme is essential for further investigation. In this study, different arginine-related amino acid permease disruption mutants were constructed to investigate the roles of the three arginine permeases in arginine utilization, metabolism and transcriptional regulation. The three amino acid permeases were overexpressed in wild type (WT), Δalp1Δgap1Δcan1 and Δnpr1 S. cerevisiae strains. Under culture conditions with arginine as the sole nitrogen source, the transcription of the three arginine permeases, arginine metabolism and amino acid permease regulation genes were analyzed. The results showed the effects of three amino acid permeases on the arginine utilization and the regulation of related genes, were tightly related to their individual characteristics. The results presented here suggested that arginine permeases disruption combinations might have a role in the precise regulation of arginine utilization and metabolism by changing arginine uptake patterns.

Results

Arginine utilization in different arginine permease disrupted strains

Seven mutants were used to investigate the influence of different arginine permease disruptions on arginine utilization. The results showed that the growth of these mutants with CAN1 disruption was more suppressed than the WT strain. The triple disruption strain AP-AGC (Δalp1Δgap1Δcan1) could still survive in YNB (yeast nitrogen base without amino acids and ammonia) medium with 2 mM arginine as the sole nitrogen source (Fig. 1A). Besides, arginine was present in the culture broth of individual permease disrupted mutants (Fig. 1B) and double/triple permease disrupted mutants (Fig. 1C) at 80 min. The WT strain, AP-Aalp1), AP-AGalp1Δgap1) showed more than 15.2% consumption of external arginine, while AP-Ggap1), AP-ACalp1Δcan1) showed a 10.0% to 12.0% reduction. Arginine utilization by AP-C (Δcan1), AP-GC (Δgap1Δcan1) and AP-AGC were severely suppressed (only 7.2% to 8.0% consumption) at 80 min.
Figure 1

Effects of knockout of three arginine permeases on arginine utilization.

Eight strains were cultured in YNB + ammonium sulfate medium to log phase. The cells were used for the following assays: (A) Spotting assay of different arginine permeases disruption mutants. Cells were cultured on solid plates containing YNB + 2 mM arginine and cultured for 48 h. (B) Arginine remaining of the individual disruption mutants of three amino acid permeases. Cells collected and transferred to YNB + 2 mM arginine medium for arginine remaining test. (C) Arginine remaining of double or triple disruption mutants of three amino acid permeases. Cells collected and transferred to YNB + 2 mM arginine medium for arginine remaining test. The WT strain was used as a control. Error bars represent standard deviations (n = 3).

Effects of permease disruption on transcription of arginine metabolism-related genes

Arginine uptake is the first step in arginine metabolism. To address the transcriptional influence of the different arginine permeases disruption on arginine metabolism, arginine permeases and arginine metabolism related genes were assayed by qRT-PCR (Fig. 2). The expression level of the CAN1 was down-regulated in AP-A (1.9-fold), AP-G (1.4-fold) and AP-AG (6.5-fold) mutants. The expression level of GAP1 was up-regulated in the AP-A (1.5-fold), AP-C (3.5-fold) and AP-AC (1.6-fold) mutants. The expression level of ALP1 was down-regulated in the AP-G (2.7-fold), AP-AC (0.1-fold) and AP-GC (1.2-fold) mutants. The expression levels of ARG1 and VBA2 were down-regulated at least 2.6-fold in all mutants except for the ARG1 was up-regulated in AP-GC (2.36-fold). However, the CAR1 was up-regulated at least 1.5-fold in these mutants except for AP-GC (6.5-fold down-regulated).
Figure 2

Transcriptional analysis of arginine permeases and metabolic genes.

The mutants were cultured in YNB + ammonium sulfate medium to log phase. Cells were then collected and transferred to YNB + 10 mM arginine medium for 2 h. The expression levels of the three amino acid permeases, arginine metabolism and amino acid permease regulation genes were measured. The WT strain was used as a control. Data were normalized to the ACT1 gene. Error bars represent standard deviations (n = 3).

Effects of arginine metabolism gene disruption on the transcription of permeases

In order to analyze interactions between arginine metabolism genes and arginine permeases genes, the expression level of the three arginine permeases were measured in AP-ARG1arg1), AP-CAR1car1) and AP-VBA2vba2) (Fig. 3). Compared to the WT strain, the expression level of ALP1 was up-regulated in AP-VBA2 (2.3-fold), while down-regulated in AP-ARG1 (1.9-fold) and AP-CAR1 (2.1-fold). The expression level of GAP1 was up-regulated in AP-VBA2 (1.1-fold) and AP-CAR1 (2.1-fold), whereas it was down-regulated by 5.6-fold in AP-ARG1. The expression level of CAN1 was up-regulated in AP-VBA2 (2.8-fold), while down-regulated in AP-ARG1 (1.8-fold) and AP-CAR1 (1.0-fold).
Figure 3

Transcriptional analysis of permeases in arginine metabolism-related genes disruption mutants.

The mutants were cultured in YNB + ammonium sulfate medium to log phase. Cells were then collected and transferred to YNB + 10 mM arginine medium for 2 h. The expression levels of three amino acid permease genes were measured in AP-VBA2, AP-ARG1 and AP-CAR1. The WT strain was used as a control. Data were normalized to the ACT1 gene. Error bars represent standard deviations (n = 3).

Effects of permease overexpression on arginine utilization and cell growth

To further determine the effects of the three amino acid permeases on arginine utilization and cell growth, they were overexpressed in WT, AP-AGC and AP-NPR1. The cell growth, concentrations of arginine and galactose, were measured after 48 h (Fig. 4). Compared to the control strain, overexpression of Alp1p and Can1p caused an increase in OD600 in WT, AP-AGC and AP-NPR1. Overexpression of Can1p alone caused a 26.7% increase in OD600 compared to Alp1p in AP-AGC at 48 h. Arginine utilization was more efficient by overexpression of Alp1p in WT and AP-AGC. However, overexpression of Can1p increase the arginine utilization by 29.3% compared to that of Alp1p in AP-AGC at 48 h.
Figure 4

The effects on arginine utilization of overexpressing three arginine permeases.

The overexpression strains were cultured in YNB + ammonium sulfate medium to log phase. Cells were then diluted to OD600 = 0.3~0.5, and cultured in YNB + 10 mM arginine with 30 g/L galactose as the carbon source for 48 h. WT + Y, AP-AGC + Y and AP-NPR1 + Y were used as controls, respectively. Error bars represent standard deviations (n = 3). (A–C) The OD600 values while overexpressing three arginine permeases in WT, AP-AGC and AP-NPR1, respectively. (D–F) Extracellular arginine utilization while overexpressing three arginine permeases in WT, AP-AGC and AP-NPR1, respectively. (G–I) Galactose consumption while overexpressing three arginine permeases in WT, AP-AGC and AP-NPR1, respectively.

Effects of permease overexpression on the transcription of arginine metabolism-related genes

In order to find out the reasons for the influence of overexpression of the three amino acid permeases on arginine utilization and cell growth, the expression levels of the three amino acid permeases, arginine metabolism and arginine permease regulation genes were measured in WT, AP-AGC and AP-NPR1 (Fig. 5). Compared to the control strains, overexpression of one arginine permease gene showed different influence on the other two arginine permeases. The expression level of ALP1 gene was down-regulated in WT + G (1.9-fold). The expression level of GAP1 gene was up-regulated in AP-NPR1 + A (2.4-fold). The expression level of CAN1 gene was down-regulated in WT + A (1.8-fold), while up-regulated in AP-NPR1 + A (2.6-fold) and AP-NPR1 + G (4.2-fold). Furthermore, the rest of arginine permease genes showed no significant expression level changes (all up-/down-regulations were below 1.5-fold).
Figure 5

Effects of overexpressing three arginine permeases on the transcriptional levels of arginine permeases and metabolism-related genes.

Overexpression strains were cultured in YNB + ammonium sulfate medium to log phase. Cells were then collected and transferred to YNB + 10 mM arginine medium with 30 g/L galactose as the carbon source for 2 h. WT + Y, AP-AGC + Y and AP-NPR1 + Y were used as controls, respectively. Data were normalized to the ACT1 gene. Error bars represent standard deviations (n = 3). (A) Gene expression while overexpressing three amino acid permeases in WT strain. (B) Gene expression while overexpressing three amino acid permeases in AP-AGC. (C) Gene expression while overexpressing three amino acid permeases in AP-NPR1.

Overexpression of three arginine permeases also showed different influence on arginine metabolism related genes. The expression level of ARG1 gene was up-regulated at least 1.6-fold while ALP1 and CAN1 genes were individually overexpressed in WT and AP-NPR1. However, the ARG1 gene was down-regulated at least 2.8-fold while three arginine permease genes were overexpressed in AP-AGC. The expression level of VBA2 gene was down-regulated while CAN1 was overexpressed in WT (1.7-fold) and AP-NPR1 (2.2-fold), and down-regulated at least 1.6-fold while three arginine permeases genes were overexpressed in AP-AGC. The expression level of CAR1 was up-regulated at least 1.6-fold and 30.4-fold while three arginine permeases were overexpressed in AP-NPR1 and AP-AGC, respectively. The rest of arginine metabolism genes showed no significant expression level changes (up/down-regulated by less than 1.5-fold).

Discussion

Amino acids are transported via different amino acid permeases3. However, permeases that transport the same amino acid may display different specific roles in amino acid transport20. The results present here demonstrated that different combinatorial disruption and/or overexpression of three arginine-related permeases showed different roles in promoting cell growth, arginine utilization and the transcription of arginine permeases and arginine metabolic genes. The results revealed that the characteristics and combined effects of three amino acid permeases on the regulation of arginine metabolism. It also provided useful clues for the regulation of amino acids metabolism through rational combinational engineering of different amino acid permeases. In S. cerevisiae, arginine is transported into cells mainly through three different amino acid permeases3. However, how those permeases contribute synergistically to arginine uptake and their combinatorial effects remained unclear. Previous works on NH4+ and L-phenylalanine permeases with different combinations of permease disruptions provided a comprehensive knowledge of the combined and individual roles of these permeases2021. It was also reported that genotype Δgap1Δcan1 could substantially eliminate arginine uptake9. Here, a systematic investigation on the three arginine permeases revealed combinatorial effects in both arginine utilization and its transcriptional regulation (Figs 1,2). The combinatorial effects of three arginine permeases could be dependent on the individual characteristics of three amino acid permeases and their corresponding upstream regulation processes. These three amino acid permeases are not only used as transporters for amino acids, but also as receptors. Gap1p is reported to be an amino acid transport receptor22. Can1p is known as a GAAC- and NCR-regulated permease323. Since Alp1p and Can1p are considered to be transporters of cationic amino acids24, the fact that the expression level of GAP1 was up-regulated in the AP-AC mutant and down-regulated in the WT + A and WT + C strains may indicate an antagonistic effect while ALP1 and CAN1 were disrupted or overexpressed. It also showed that disruption of ALP1 or CAN1 accompanied with GAP1 disruption showed a synergetic effect on each other. Furthermore, overexpression of Alp1p supported adequate arginine uptake ability as Can1p (Fig. 4D–F), suggested the limited effect of ALP1 disruption on arginine utilization might be the result of lower promoter activity9. TORC1 regulates ubiquitin-mediated endocytosis via Npr1p-mediated phosphoinhibition of a ubiquitin ligase adaptor16. Since Gap1p and Can1p are two of the most important Npr1-regulated amino acid permeases1625. Disruption of NPR1 affects the expression level of arginine metabolic genes, while the expression level of these three arginine metabolism related genes were consistent in AP-AGC. This means that Npr1p influences the arginine transport function and regulation via arginine permeases. Previous reports showed that Alp1p was an effective transporter for arginine uptake9. Here, we further demonstrated that Alp1p are highly efficient for arginine utilization. However, Can1p showed higher capacity for arginine transport. Although the Alp1p was highly homologous to Can1p26, their characteristics and regulation mechanisms might be different, thus lead to different regulation patterns of arginine transport and metabolism. In summary, this study demonstrated the combinatorial disruption and overexpression effects of the three arginine-related amino acid permeases on arginine utilization and metabolism. Although the amounts of amino acid permeases have been identified and characterized3, clearer differences between amino acid permeases that can transport the same amino acid still need to be characterized. This study provided systematic insight on fine regulation of arginine metabolism by the characteristics, combinatorial effects and upstream regulation processes of three arginine permeases. The results also showed that all of these amino acids permeases were well orchestrated and tightly linked between each other in the precise regulation of arginine uptake and metabolism process.

Materials and Methods

Strains, media and culture conditions

S. cerevisiae strains used in this study are listed in Table 1. S. cerevisiae BY4741 was used as the initial strain27. Strains were first cultured in YNB + ammonium sulfate medium (1.6 g/L yeast nitrogen base without amino acids or ammonium, 20 g/L glucose and 5 g/L ammonium sulfate); appropriate supplements (25 mg/L leucine, 25 mg/L histidine, 25 mg/L methionine and 25 mg/L uracil) were added when required. For analysis of arginine utilization, cells were cultured in YNB + arginine media in which arginine was the sole nitrogen source. YPD + G418 plates (10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose, 20 g/L agar, 200 mg/L G418 sulfate) were used for selection of G418 resistance transformants.
Table 1

Strains of Saccharomyces cerevisiae used in this work.

NameParentGenotype
WTBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3
AP-ABY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 ALP1::LEU2
AP-GBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: kanMX
AP-CBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 CAN1:: kanMX
AP-AGBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: HIS5 ALP1::LEU2
AP-ACBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 ALP1::LEU2 CAN1:: kanMX
AP-GCBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: kanMX CAN1::HIS5
AP-AGCBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: HIS5 ALP1::LEU2 CAN1:: kanMX
AP-VBA2BY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 VBA2::URA3
AP-ARG1BY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 ARG1:: kanMX
AP-CAR1BY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 CAR1:: kanMX
AP-NPR1BY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 NPR1:: kanMX
WT + YBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 pYES2
WT + ABY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 pYES2-ALP1
WT + GBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 pYES2-GAP1
WT + CBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 pYES2-CAN1
AP-AGC + YBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: HIS5 ALP1::LEU2 CAN1:: kanMX pYES2
AP-AGC + ABY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: HIS5 ALP1::LEU2 CAN1:: kanMX pYES2-ALP1
AP-AGC + GBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: HIS5 ALP1::LEU2 CAN1:: kanMX pYES2-GAP1
AP-AGC + CBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 GAP1:: HIS5 ALP1::LEU2 CAN1:: kanMX pYES2-CAN1
AP-NPR1 + YBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 NPR1:: kanMX pYES2
AP-NPR1 + ABY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 NPR1:: kanMX pYES2-ALP1
AP-NPR1 + GBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 NPR1:: kanMX pYES2-GAP1
AP-NPR1 + CBY4741MATa Δhis3-1 Δleu2 Δmet15 Δura3 NPR1:: kanMX pYES2-CAN1
For arginine utilization analysis, strains were cultured in YNB + ammonium sulfate medium at 30 °C until OD600 = 0.6 ~ 1.0. Cells were then harvested, washed twice with YNB medium without ammonium or amino acids, and the solutions were adjusted to OD600 = 1.0 and transferred to a YNB + 2 mM arginine medium19. Arginine was monitored for 80 min. For overexpression of the three amino acid permeases, cells were first cultured in YNB + ammonium sulfate medium to the log phase, then they were diluted to OD600 = 0.3~0.5 (to reduce the lag phase) in YNB + 10 mM arginine with 30 g/L galactose as the sole carbon source, The concentration of arginine and OD600 were monitored for 48 h.

Plasmid construction and gene disruptions

The pYES2 plasmid was purchased from Invitrogen (Carlsbad, CA). Three arginine permease genes ALP1, GAP1 and CAN1 were amplified by PCR and cloned into pYES2 using the primer pairs ALP1-EX-F/ALP1-EX-R, GAP1-EX-F/GAP1-EX-R and CAN1-EX-F/CAN1-EX-R, respectively. The upstream and downstream homologous regions of the three amino acid permease genes, ALP1, GAP1, CAN1 and VBA2 were PCR-amplified using primer pairs ALP1-P1/ALP1-P2 and ALP1-P3/ALP1-P4, GAP1-P1/GAP1-P2 and GAP1-P3/GAP1-P4, CAN1-P1/CAN1-P2 and CAN1-P3/CAN1-P4, VBA2-P1/VBA2-P2 and VBA2-P3/VBA2-P4, ARG1-P1/ARG1-P2 and ARG1-P3/ARG1-P4, CAR1-P1/CAR1-P2 and CAR1-P3/CAR1-P4 and NPR1-P1/NPR1-P2 and NPR1-P3/NPR1-P4, respectively. Then these PCR products and four loxP marker cassette plasmids, pUG6 (kan), pUG27 (his5 + ) and pUG73 (LEU2), pUG72 (URA3), were used to construct the disruption cassette using a fusion PCR method2829. The disruption cassettes were confirmed by Sanger sequencing and then transformed into cells using the LiAc method30. Disruption strains were confirmed by amplification using flanking primer pairs ALP1-VF/ALP1-VR, GAP1-VF/GAP1-VR, CAN1-VF/CAN1-VR, VBA2-VF/VBA2-VR, ARG1-VF/ARG1-VR, CAR1-VF/CAR1-VR and NPR1-VF/NPR1-VR, respectively. All of the primers are listed in Table 2.
Table 2

Oligonucleotides used for quantitative RT-PCR and gene disruption.

GeneNameSequence (5′-3′)
Oligonucleotides for qRT-PCR
ALP1ALP1-FCGAGGATGATGCTGCTAAGG
 ALP1-RCAAGTCCAAGTCTGTCAAGTC
GAP1GAP1-FGAAGCACCACTTGAAGAATAG
 GAP1-RCCAGAGCCATAACCATAGC
CAN1CAN1-FGTGATGAAGATGAAGGAGAAG
 CAN1-RTGCGTGACAGAATATGCC
ARG1ARG1-FTTCTTACGAGGCAGGTATCTTG
 ARG1-RAAGTCTTGTTGTCGGTGTAGG
CAR1CAR1-FACGGAATTAGAGCCCTCAATG
 CAR1-RGGAATCTGTTCGCCTGGAC
VBA2VBA2-FCGGTAGGCAGTCTCATAACAG
 VBA2-RTAGACCAATCAACCAGTTCGG
ACT1ACT1-FTTATTGATAACGGTTCTGGTATG
 ACT1-RCCTTGGTGTCTTGGTCTAC
Oligonucleotides for genes disruption
ALP1ALP1-P1TGTACCAAAAGTTGCACAAAAAT
 ALP1-P2GCGTACGAAGCTTCAGCTGGGCAATAATCGCAACACTACAAT
 ALP1-P3CAGATCCACTAGTGGCCTATGCCCAAATCCTTGCTCAACTCT
 ALP1-P4CCTCGCCTCAGTAGATGTAG
GAP1GAP1-P1GCCTCACTAATCTACCCATTG
 GAP1-P2GCGTACGAAGCTTCAGCTGGCTGTCCTTGGTCTGTTCTT
 GAP1-P3CAGATCCACTAGTGGCCTATGCCGAACAACGACAAAAAAAGAC
 GAP1-P4GAATCCCAACAATTATCTCAACAT
CAN1CAN1-P1TCTTGTCCCTTATTAGCCTTGAT
 CAN1-P2GCGTACGAAGCTTCAGCTGTTGTTTTTACAGGAGTTAAGAAGT
 CAN1-P3CAGATCCACTAGTGGCCTATGCCCCTCATAAGTCATACACCGAA
 CAN1-P4TCAACTATAAATCCGAGGGCTAC
VBA2VBA2-P1GGGGTTTCACATATTGTTCTAT
 VBA2-P2GCGTACGAAGCTTCAGCTGTGATTAAATTCGTTACCAATCGTT
 VBA2-P3CAGATCCACTAGTGGCCTATGCTATATACCTATGCCCTTGACC
 VBA2-P4GATTCCCTATATGTGCGGTA
CAR1CAR1-P1GGTAAAGCTACGCATACTGTCT
 CAR1-P2GCGTACGAAGCTTCAGCTGCTTGATAGTAGTTATTGTTATTGATAT
 CAR1-P3CAGATCCACTAGTGGCCTATGCCCTTTTATCAAAATAAGCATTCTCT
 CAR1-P4GGTTATTCCGATCTTGTTCCT
ARG1ARG1-P1ACTAACACAATTAAATAATCGCCAT
 ARG1-P2GCGTACGAAGCTTCAGCTGTATTTTATGCAATTATGTGTATTTC
 ARG1-P3CAGATCCACTAGTGGCCTATGCGTCCGCTAGTTCATCGCCTC
 ARG1-P4GGTACTTGCCGTTTAGCTTT
NPR1NPR1-P1TTTTCGTTATCAATGACGCATC
 NPR1-P2GCGTACGAAGCTTCAGCTGAATGTTTCGTAGAGCTTTCCT
 NPR1-P3CAGATCCACTAGTGGCCTATGCATAAGCGTCCCCACTTTTATT
 NPR1-P4TTTTGCTGCCTGTGACATTATGGA
Oligonucleotides for genes disruption verification
ALP1ALP1-VFCTATGTTGTTGCCCACCGAT
 ALP1-VRGGATACGGGAACATCTCCACTT
GAP1GAP1-VFCTGCTCACTAGAATCGTAATC
 GAP1-VRTGTTGGCTGTTCAATCTCC
CAN1CAN1-VFCTATTCGGAGATACAGGCAAC
 CAN1-VRACCCGTTTGTAAATAGAATCAGC
VBA2VBA2-VFTCCGACCAGTAACCTTGTG
 VBA2-VRTTCTGCTTACTACTATTAACCTT
CAR1CAR1-VFACCAAACCGTGTAGGCAA
 CAR1-VRTTGGGATTTACACGACAACGAC
ARG1ARG1-VFCCATTATACACGCTATTATCGTT
 ARG1-VRTGCTTCTGCGTAATATCGTCCT
NPR1NPR1-VFTAAACGGAATAGTCGCGCATT
 NPR1-VRAGTCAATGGCTTTTATACCCTT
Oligonucleotides for overexpression of three arginine permeases
GAP1GAP1-EX-FGCGAGCTCTAAAAAATGAGTAATACTTCTTCGT
 GAP1-EX-RCGGGATCCCATTAACACCAGAAATTCCAG
CAN1CAN1-EX-FGGGGTACCGGCATAGCAATGACAAATTC
 CAN1-EX-RGCTCTAGACTATGCTACAACATTCCAAAAT
ALP1ALP1-EX-FGGGGTACCATGGATGAAACTGTGAACATAC
 ALP1-EX-RCGGGATCCATTATGAAAGGACATCCCAAACT

*Underlined letters represent the overlap of loxP plasmids and primers.

Spotting assay

Yeast cells were cultured in the YNB + ammonium sulfate medium at 30 °C to log phase, then serially diluted and spotted on YNB + 2 mM arginine. The plates cultured at 30 °C for 48 h. Individual spotting assays were performed in triplicates (at once). Each set of triplicates were repeated for twice31.

Amino acid analysis

Analyses of arginine were performed using the Agilent HPLC system 1260 (Palo Alto, CA) equipped with an ODS-2 Hypersil column (4.6 × 150 mm × 5 μm) (Thermo Scientific, CA) as previously described32.

RNA preparation and DNA synthesis

Yeast cells were cultured in the YNB + ammonium sulfate medium at 30 °C to log phase, transferred to YNB medium with 10 mM arginine and 30 g/L galactose or 20 g/L glucose as the sole carbon source for 2 h. Cells were washed twice with double-distilled water and stored at −80°C until RNA preparation. The procedures for RNA extraction and cDNA synthesis have been described previously33.

Real-time quantitative PCR (qRT-PCR) assay

Primers used for qRT-PCR were designed by Beacon Designer 7.0 (Table 2). qRT-PCR experiments were performed using SYBR® Premix Ex TaqTM kit (Takara, Dalian, China). Parameters for PCR were: pre-incubation at 95 °C for 30 s; 40 cycles of amplification at 95 °C for 5 s, 55 °C for 20 s; finally, cooling at 50 °C for 30 s. Reactions were conducted using a LightCycler 480 II Real-time PCR instrument (Roche Applied Science, Mannheim, Germany) and were run in triplicate. Mean values were used for further calculations. The fold change was determined by the 2−ΔΔCT method normalized to the ACT1 gene34.

Additional Information

How to cite this article: Zhang, P. et al. Effects of three permeases on arginine utilization in Saccharomyces cerevisiae. Sci. Rep. 6, 20910; doi: 10.1038/srep20910 (2016).
  33 in total

1.  Substrate specificity and gene expression of the amino-acid permeases in Saccharomyces cerevisiae.

Authors:  B Regenberg; L Düring-Olsen; M C Kielland-Brandt; S Holmberg
Journal:  Curr Genet       Date:  1999-12       Impact factor: 3.886

2.  Nitrogen regulation involved in the accumulation of urea in Saccharomyces cerevisiae.

Authors:  Xinrui Zhao; Huijun Zou; Jianwei Fu; Jian Chen; Jingwen Zhou; Guocheng Du
Journal:  Yeast       Date:  2013-09-10       Impact factor: 3.239

3.  Improved method for high efficiency transformation of intact yeast cells.

Authors:  D Gietz; A St Jean; R A Woods; R H Schiestl
Journal:  Nucleic Acids Res       Date:  1992-03-25       Impact factor: 16.971

4.  Finding the right partner: science or ART?

Authors:  Simona Polo; Pier Paolo Di Fiore
Journal:  Cell       Date:  2008-11-14       Impact factor: 41.582

5.  Identification of direct and indirect targets of the Gln3 and Gat1 activators by transcriptional profiling in response to nitrogen availability in the short and long term.

Authors:  Bart Scherens; André Feller; Fabienne Vierendeels; Francine Messenguy; Evelyne Dubois
Journal:  FEMS Yeast Res       Date:  2006-08       Impact factor: 2.796

6.  PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae.

Authors:  A Wach
Journal:  Yeast       Date:  1996-03-15       Impact factor: 3.239

7.  The Npr1 kinase controls biosynthetic and endocytic sorting of the yeast Gap1 permease.

Authors:  J O De Craene; O Soetens; B Andre
Journal:  J Biol Chem       Date:  2001-08-10       Impact factor: 5.157

8.  Regulation of amino acid, nucleotide, and phosphate metabolism in Saccharomyces cerevisiae.

Authors:  Per O Ljungdahl; Bertrand Daignan-Fornier
Journal:  Genetics       Date:  2012-03       Impact factor: 4.562

9.  Uptake of putrescine and spermidine by Gap1p on the plasma membrane in Saccharomyces cerevisiae.

Authors:  Takeshi Uemura; Keiko Kashiwagi; Kazuei Igarashi
Journal:  Biochem Biophys Res Commun       Date:  2005-03-25       Impact factor: 3.575

Review 10.  Arginine metabolism: boundaries of our knowledge.

Authors:  Sidney M Morris
Journal:  J Nutr       Date:  2007-06       Impact factor: 4.798

View more
  3 in total

1.  Metabolic engineering of arginine permeases to reduce the formation of urea in Saccharomyces cerevisiae.

Authors:  Peng Zhang; Xing Hu
Journal:  World J Microbiol Biotechnol       Date:  2018-03-13       Impact factor: 3.312

2.  Metabolites comparison in post-fermentation stage of manual (mechanized) Chinese Huangjiu (yellow rice wine) based on GC-MS metabolomics.

Authors:  Qi Peng; Kai Meng; Huajun Zheng; Hefeng Yu; Yuhao Zhang; Xinyi Yang; Zichen Lin; Guangfa Xie
Journal:  Food Chem X       Date:  2022-05-06

3.  Characterization of canavanine-resistance of cat1 and vhc1 deletions and a dominant any1 mutation in fission yeast.

Authors:  Anissia Ait Saada; Alex B Costa; Kirill S Lobachev
Journal:  PLoS One       Date:  2022-05-31       Impact factor: 3.752

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.