Literature DB >> 26830841

Apolipoprotein E polymorphism and the risk of intracranial aneurysms in a Chinese population.

Hao Liu1, Ping Mao1, Changhou Xie1, Wanfu Xie1, Maode Wang1, Haitao Jiang2.   

Abstract

BACKGROUND: The relationship between the apolipoprotein E (APOE) polymorphism and intracranial aneurysms has previously only been studied in Russia and Japan but not in Chinese populations. The purpose of this study was to investigate the association between APOE polymorphism and the risk of intracranial aneurysms in a Chinese population.
METHODS: The study population consisted of 150 intracranial aneurysms patients and 150 matched control subjects. The APOE gene polymorphism was analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).
RESULTS: Patients with intracranial aneurysms had a significantly higher frequency of APOE E2/E2 genotype [odds ratio (OR) = 9.51, 95% confidence interval (CI) = 1.19, 76.04; P = 0.03] and APOE E2/E3 genotype (OR = 1.87, 95% CI = 1.03, 3.40; P = 0.04) than healthy controls. The APOE E4/E4 genotype frequencies (OR = 0.09, 95% CI = 0.01, 0.74; P = 0.03) in the intracranial aneurysms group were significantly lower than those in the controls group. When stratified by the site, shape, size and the Fisher Grade of intracranial aneurysms, no statistically significant result was observed.
CONCLUSION: Our study suggested that APOE polymorphism might be associated with intracranial aneurysms in Chinese population. Additional studies are needed to confirm this finding.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26830841      PMCID: PMC4734867          DOI: 10.1186/s12883-016-0537-z

Source DB:  PubMed          Journal:  BMC Neurol        ISSN: 1471-2377            Impact factor:   2.474


Background

Intracranial aneurysm is a fairly common condition that is often asymptomatic until the time of rupture. A systematic review of studies involving more than 56,000 patients found that unruptured intracranial aneurysms occur in 3.6 to 6 % of the general population [1]. Rupture of intracranial aneurysms accounts for more than 90 % of subarachnoid hemorrhage cases [2]. Intracranial aneurysms may result from diseases acquired during life, or from genetic conditions. Lifestyle diseases including hypertension, smoking, excess alcohol consumption, and obesity are associated with the development of aneurysms [3-5]. Genome-wide association studies (GWAS) of intracranial aneurysm in European and Japanese case-control cohorts have identified several new risk loci [6-9]. Apolipoprotein E (apoE), a 299-amino acid, arginine-rich glycoprotein, is an integral surface component of chylomicrons, very-low-density lipoproteins, and some subclasses of high-density lipoproteins [10, 11]. The APOE gene is polymorphic, consisting of 3 common alleles (E2, E3, and E4) and 6 different genotypes (E2/E2, E2/E3, E2/E4, E3/E3, E3/E4 and E4/E4) [11]. APOE gene polymorphisms seem to have some impact among patients with cardiovascular disease [12]. The relationship between the APOE polymorphism and intracranial aneurysms has previously only been studied in Russia and Japan but not in Chinese populations [13, 14]. The purpose of this study was to investigate the association between APOE polymorphisms and the risk of intracranial aneurysms in a Chinese population.

Methods

Study population

A hospital-based case-control study was conducted in 150 patients with intracranial aneurysms and 150 age- and gender-matched healthy controls during the years 2009 to 2014 in the Department of Neurosurgery, The First Affiliated Hospital of Xi’an Jiao Tong University, China. Peripheral blood specimens and demographic, medical, and family histories were obtained from sequentially ascertained, unrelated patients. Intracranial aneurysms in the cases were confirmed by magnetic resonance imaging (MRI) or computed tomography angiography (CTA) or cerebral angiography. Most intracranial aneurysms cases have no symptoms and may only be discovered during tests for another, usually unrelated, condition. The healthy control subjects were collected from the same geographic region and were attending a clinic for routine examination in the Department of Neurosurgery, The First Affiliated Hospital of Xi’an Jiao Tong University. The control subjects met the following criteria: (1) confirmation of the absence of intracranial aneurysms by digital subtraction angiography, magnetic resonance angiography, or 3-dimensional computed tomography angiography; (2) a similar age and sex distribution; (3) no medical history of any vascular disease, including intracranial aneurysms or subarachnoid hemorrhage; (4) no family history of intracranial aneurysms or subarachnoid hemorrhage in first-degree relatives; and (5) the same population as the cases. The Ethical Committee of the First Affiliated Hospital of Xi’an Jiao Tong University approved the study protocols, and all participants gave written informed consent according to the Declaration of Helsinki.

DNA extraction and genotyping

The commercially available Qiagen kit (QIAGEN Inc., Valencia, CA, USA) was used to extract DNA from peripheral blood leukocytes. Polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) assay was applied to assess the APOE gene polymorphisms. Based on the GenBank reference sequence, the PCR primers were as follows: sense, ACAGAATTCGCCCCGGCCTGGTACAC; antisense, TAAGCTTGGCACGGCTGTCCAAGGA. The amplified PCR products were then digested with 2U of Hha I (New England BioLabs, Missisauga, ON, Canada) at 37 °C for 3 h. The resulting DNA fragments were electrophoresed on 3.5 % agarose gel and visualized under UV light after ethidum staining.

Statistical analysis

The Statistical Analyses System (SAS) package (version 8.01; SAS Institute, Cary, NC) was used for statistical analysis. Differences between continuous variables were assessed by Student’s t test, while those between categorical variables were evaluated using Pearson x2 test. The existence of differences in genotypic frequencies between groups was assessed by means of Pearson x2 test and calculating the odds ratio (OR) with the 95 % confidence intervals (CI). A P-value was considered significant at a level of < 0.05. A chi-square test was used to confirm that the APOE genotype frequencies were in Hardy-Weinberg equilibrium.

Results

The characteristics of patients with intracranial aneurysms and controls were shown in Table 1. As to clinical characteristics, there was no statistical significant difference in gender, age or the prevalence of risk factors including hypertension, smoking and drinking between the patient with intracranial aneurysms and control groups, as shown in Table 1. The site of aneurysm was as follows: anterior cerebral artery, 67 (44.7 %); internal carotid artery, 53 (35.3 %); and middle cerebral artery, 30 (20.0 %). The shape of aneurysm was as follows: saccular, 119 (79.3 %); fusiform, 24 (16.0 %); dissecting, 7 (4.7 %). The size of aneurysm was as follows: small (<15 mm), 106 (70.7 %); larger (15–25 mm), 37 (24.7 %); giant (>25 mm), 7 (4.6 %). The Fisher Grade was as follows: Grade 1, 14 (9.4 %); Grade 2, 74 (49.3 %); Grade 3, 44 (29.3 %); Grade 4, 18 (12.0 %) (Table 1).
Table 1

Characteristics of patients with intracranial aneurysms and controls

AneurysmsControls P
Total No.150150
Gender (Male/Female)67/8365/850.82
Age (years)46.7 ± 10.947.2 ± 11.20.70
Hypertension (Yes/No)53/9749/1010.63
Smoking (Yes/No)37/11335/1150.79
Drinking (Yes/No)31/11930/1200.89
Site of aneurysm (%)
 ACA67(44.7)/
 ICA53(35.3)/
 MCA30(20.0)/
Shape of aneurysm (%)
 Saccular119(79.3)/
 Fusiform24(16.0)/
 Dissecting7(4.7)/
Size of aneurysm (%)
 Small (<15 mm)106(70.7)/
 Larger (15-25 mm)37(24.7)/
 Giant (>25 mm)7(4. 6)/
The Fisher Grade
 Grade 114(9.4)/
 Grade 274(49.3)/
 Grade 344(29.3)/
 Grade 418(12.0)/

ACA, anterior cerebral artery; ICA, internal carotid artery; MCA, middle cerebral artery. Smoking was defined as non-smoker (smoked less than 100 cigarettes in lifetime) and smoker. Drinking was defined as non-drinker and drinker (consumed more than one cup, 200 mL, per day)

Characteristics of patients with intracranial aneurysms and controls ACA, anterior cerebral artery; ICA, internal carotid artery; MCA, middle cerebral artery. Smoking was defined as non-smoker (smoked less than 100 cigarettes in lifetime) and smoker. Drinking was defined as non-drinker and drinker (consumed more than one cup, 200 mL, per day) Patients with intracranial aneurysms had a significantly higher frequency of APOE E2/E2 genotype (OR = 9.51, 95 % CI = 1.19, 76.04; P = 0.03) and APOE E2/E3 genotype (OR = 1.87, 95 % CI = 1.03, 3.40; P = 0.04) than healthy controls (Table 2). The APOE E4/E4 genotype frequencies (OR = 0.09, 95 % CI = 0.01, 0.74; P = 0.03) in the intracranial aneurysms group were significantly lower than those in the controls group (Table 2). When stratified by the site, shape, size and the Fisher Grade of intracranial aneurysms, no statistically significant result was observed (Table 3).
Table 2

Genotype frequencies of APOE gene polymorphisms among intracranial aneurysms cases and controls

GenotypeAneurysmsControlsOR (95 % CI) P value
E2/E29(6.0)1(0.6)9.51(1.19,76.04)0.03
E2/E335(23.3)21(14.0)1.87(1.03,3.40)0.04
E2/E44(2.7)7(4.7)0.56(0.16,1.95)0.36
E3/E376(50.7)80(53.3)0.90(0.57,1.41)0.64
E3/E425(16.7)31(20.7)0.77(0.43,1.38)0.38
E4/E41(0.6)10(6.7)0.09(0.01,0.74)0.03
Table 3

Stratification analysis of APOE genotype frequency in intracranial aneurysms

VariableCasesE2/E2E2/E3E2/E4E3/E3E3/E4E4/E4
n (%) P n (%) P n (%) P n (%) P n (%) P n (%) P
Site of aneurysm (%)1509(6.0)35(23.3)4(2.7)76(50.7)25(16.7)1(0.6)
 ACA674(6.0)0.9916(23.9)0.952(3.0)0.9033(49.2)0.9111(16.4)0.971(1.5)0.57
 ICA533(5.7)0.9312(22.6)0.941(1.9)0.7628(52.8)0.889(17.0)0.970(0)0.97
 MCA302(6.7)0.907(23.3)1.001(3.3)0.8415(50.0)0.975(16.7)1.000(0)0.76
Shape of aneurysm (%)1509(6.0)35(23.3)4(2.7)76(50.7)25(16.7)1(0.6)
 Saccular1195(4.2)0.5327(22.7)0.922(1.7)0.6064(53.8)0.7820(16.8)0.981(0.8)0.87
 Fusiform243(12.5)0.306(25.0)0.891(4.1)0.7010(41.7)0.634(16.7)1.000(0)0.66
 Dissecting71(14.3)0.442(28.6)0.811(14.3)0.162(28.6)0.481(14.3)0.890(0)0.26
Size of aneurysm (%)1509(6.0)35(23.3)4(2.7)76(50.7)25(16.7)1(0.6)
 Small (<15 mm)1064(3.8)0.4526(24.5)0.863(2.8)0.9454(50.9)0.9818(17.0)0.961(1.0)0.81
 Larger (15–25 mm)374(10.8)0.357(18.9)0.641(2.7)0.9919(51.4)0.976(16.2)0.960(0)0.86
 Giant (>25 mm)71(14.3)0.442(28.6)0.810(0)0.603(42.8)0.811(14.3)0.890(0)0.26
The Fisher Grade1509(6.0)35(23.3)4(2.7)76(50.7)25(16.7)1(0.6)
 Grade 1141(7.1)0.873(21.4)0.900(0)0.938(57.2)0.802(14.3)0.530(0)0.45
 Grade 2745(6.8)0.8418(24.3)0.902(2.7)0.9935(47.3)0.7813(17.6)0.891(1.3)0.62
 Grade 3442(4.5)0.7310(22.7)0.952(4.5)0.5523(52.3)0.927(15.9)0.920(0)0.94
 Grade 4181(5.5)0.944(22.2)0.930(0)0.9510(55.6)0.833(16.7)1.000(0)0.55
Genotype frequencies of APOE gene polymorphisms among intracranial aneurysms cases and controls Stratification analysis of APOE genotype frequency in intracranial aneurysms

Discussion

Although lot of studies have been conducted to examine the association of genetic polymorphism and intracranial aneurysms, the relationship between the APOE polymorphism and intracranial aneurysms has previously only been studied in Russia and Japan but not in Chinese populations [13, 14]. Evidence from a case-control study suggested that the collagen type I alpha2 gene polymorphism was associated with intracranial aneurysms in a subset of the German population [15]. Authors of a case-control study suggested that the IL-12A and IL-12B independently and jointly was involved in the susceptibility to intracranial aneurysms in a Chinese population [16]. Evidence from a meta-analysis included six case-control studies, which included 1188 intracranial aneurysms cases and 4099 controls, suggested that IL-6 promoter polymorphisms (-174G/C and -572G/C) were associated with intracranial aneurysms [17]. Authors of a case-control study in a Chinese population suggested that the miR-34b/c rs4938723CC and TP53 Arg72-Pro polymorphisms may be involved in the susceptibility to intracranial aneurysms [18]. Evidence from a case-control study indicated that the elastin gene polymorphism might be associated with the formation and the rupture of intracranial aneurysms [19]. Evidence from a genetic meta-analysis of 8 genes and 13 polymorphisms in approximately 20,000 individuals showed that there was a likely genetic basis to sporadic intracranial aneurysms. However, the evidence base was small when compared against other complex disorders [20]. Authors of a case-control study suggested that the NFKB1 -94ins/del ATTG polymorphism might contribute to the risk of intracranial aneurysms [21]. Polymorphisms within the kallikrein gene cluster are associated with intracranial aneurysms suggesting that the kallikreins are important candidate genes for intracranial aneurysms [22]. Evidence from a case-control study suggested that the angiotensin-converting enzyme DD genotype might be a protective factor for intracranial aneurysms in a Chinese population [23]. Evidence from a meta-analysis of case-control studies also suggested that there was a close relationship between angiotensin-converting enzyme I/D polymorphism and intracranial aneurysms risk [24]. The study by Pannu et al. and Peters et al. supported a role for MMP-9 in the pathogenesis of intracranial aneurysms [25, 26]. Genome-wide association study for intracranial aneurysm in the Japanese population identified three candidate susceptible loci and a functional genetic variant at EDNRA [8]. The APOE gene polymorphisms were also associated with many other diseases. Authors of a case-control study showed that the APOE epsilon polymorphism has the expected impact on the plasma lipid profile and the rs4420638 G allele may counterbalance the deleterious effect of the E4 allele on low-density lipoproteins (LDL)-cholesterol levels in an Algerian population [11]. Evidence from a meta-analysis of 29 studies suggested that APOE gene polymorphisms was associated with the risk of vascular dementia [27]. Evidence from a meta-analysis of 28 case-control studies provided evidence for an association between the APOE E4 allele and frontotemporal lobar degeneration [28]. Authors of a case-control study found that APOE gene polymorphism was associated with maximal oxygen uptake levels after exercise training in Chinese young adult [29]. Evidence from a meta-analysis of experimental and human studies suggested an association between APOE gene expression and its gene polymorphism with nephrotic syndrome susceptibility [30]. Evidence from a meta-analysis of 45 studies found that APOE gene polymorphisms were associated with essential hypertension [31]. Authors of a hospital-based case-control study suggested that APOE E3/E4 genotype was associated with a higher lower extremity deep venous thrombosis risk [32]. Evidence from a meta-analysis of seven studies suggested that the APOE polymorphisms were associated with the risk of psoriasis, especially E2 and E3 alleles [33]. A meta-analysis of seven studies suggested an association between APOE E4 mutation and increased risk of recurrent pregnancy loss [34]. Evidence from a meta-analysis of 6977 subjects provides evidence that APOE E2 mutation is associated with multiple sclerosis risk [35]. Evidence from a meta-analysis included 29 studies suggested that APOE E4 allele was associated with an increased risk of developing cerebral infarction in Chinese population [36]. The exact molecular mechanism of the association between APOE polymorphism and the risk of intracranial aneurysms remains relatively unclear. APOE plays a critical role in redistributing lipids among central nervous system cells for normal lipid homeostasis [37, 38], repairing injured neurons [39], maintaining synaptodendritic connections [40], neurite outgrowth [41], synaptic plasticity [42], mitochondrial resistance to oxidative stress [43], and glucose use by neurons and glial cells [44, 45]. A case-control study in Russia found that intracranial aneurysms with hypertension were associated with the e2 allele and the e2/e3 APOE genotype [13]. This was consistent with our study. There are some limitations to the present study that should be mentioned. First of all, although this study suggested that APOE polymorphism was associated with intracranial aneurysms, more biological background data are needed to explain our results. The current finding might involve gene-to-environment interactions, which were not explored in the present study. Second, the sample size of this study is relatively small, which may not have enough statistical power to explore the real association. Third, this is a hospital based case control study and selection bias cannot be avoided and therefore the subjects may not be representative of the general population within China. Finally, these results should be interpreted with caution because the population was only from China, which reduces the possibility of confounding from ethnicity, however does not permit extrapolation of the results to other ethnic groups.

Conclusions

In conclusion, our study suggested that APOE polymorphism might be associated with intracranial aneurysms in Chinese population. Additional studies are needed to confirm this finding.
  45 in total

1.  Trends in incidence and case fatality rates of aneurysmal subarachnoid hemorrhage in Izumo City, Japan, between 1980-1989 and 1990-1998.

Authors:  T Inagawa
Journal:  Stroke       Date:  2001-07       Impact factor: 7.914

Review 2.  Apolipoprotein E polymorphism and cardiovascular disease: a HuGE review.

Authors:  June E Eichner; S Terence Dunn; Ghazala Perveen; David M Thompson; Kenneth E Stewart; Berrit C Stroehla
Journal:  Am J Epidemiol       Date:  2002-03-15       Impact factor: 4.897

3.  Functional polymorphism in the matrix metalloproteinase-9 promoter as a potential risk factor for intracranial aneurysm.

Authors:  D G Peters; A Kassam; P L St Jean; H Yonas; R E Ferrell
Journal:  Stroke       Date:  1999-12       Impact factor: 7.914

4.  Mitochondrial damage in Alzheimer's disease varies with apolipoprotein E genotype.

Authors:  G E Gibson; V Haroutunian; H Zhang; L C Park; Q Shi; M Lesser; R C Mohs; R K Sheu; J P Blass
Journal:  Ann Neurol       Date:  2000-09       Impact factor: 10.422

5.  Prevalence and risk of rupture of intracranial aneurysms: a systematic review.

Authors:  G J Rinkel; M Djibuti; A Algra; J van Gijn
Journal:  Stroke       Date:  1998-01       Impact factor: 7.914

6.  Apolipoprotein E (ApoE) isoform-dependent lipid release from astrocytes prepared from human ApoE3 and ApoE4 knock-in mice.

Authors:  Jian-Sheng Gong; Mariko Kobayashi; Hideki Hayashi; Kun Zou; Naoya Sawamura; Shinobu C Fujita; Katsuhiko Yanagisawa; Makoto Michikawa
Journal:  J Biol Chem       Date:  2002-05-31       Impact factor: 5.157

7.  Functional brain abnormalities in young adults at genetic risk for late-onset Alzheimer's dementia.

Authors:  Eric M Reiman; Kewei Chen; Gene E Alexander; Richard J Caselli; Daniel Bandy; David Osborne; Ann M Saunders; John Hardy
Journal:  Proc Natl Acad Sci U S A       Date:  2003-12-19       Impact factor: 11.205

8.  Stable expression and secretion of apolipoproteins E3 and E4 in mouse neuroblastoma cells produces differential effects on neurite outgrowth.

Authors:  S Bellosta; B P Nathan; M Orth; L M Dong; R W Mahley; R E Pitas
Journal:  J Biol Chem       Date:  1995-11-10       Impact factor: 5.157

9.  Differential effects of apolipoproteins E3 and E4 on neuronal growth in vitro.

Authors:  B P Nathan; S Bellosta; D A Sanan; K H Weisgraber; R W Mahley; R E Pitas
Journal:  Science       Date:  1994-05-06       Impact factor: 47.728

10.  Major risk factors for aneurysmal subarachnoid hemorrhage in the young are modifiable.

Authors:  Joseph P Broderick; Catherine M Viscoli; Thomas Brott; Walter N Kernan; Lawrence M Brass; Edward Feldmann; Lewis B Morgenstern; Janet Lee Wilterdink; Ralph I Horwitz
Journal:  Stroke       Date:  2003-05-22       Impact factor: 7.914

View more
  9 in total

1.  Association of Apolipoprotein E Gene Polymorphism with Ischemic Stroke in Coronary Heart Disease Patients Treated with Medium-intensity Statins.

Authors:  Ping Lv; Yaofu Zheng; Jun Huang; Junsong Ke; Hongyu Zhang
Journal:  Neuropsychiatr Dis Treat       Date:  2020-10-23       Impact factor: 2.570

2.  Genetic susceptibility to cerebrovascular disease: A systematic review.

Authors:  Christoph J Griessenauer; Sean Farrell; Atom Sarkar; Ramin Zand; Vida Abedi; Neil Holland; Andrew Michael; Christopher L Cummings; Raghu Metpally; David J Carey; Oded Goren; Neil Martin; Philipp Hendrix; Clemens M Schirmer
Journal:  J Cereb Blood Flow Metab       Date:  2018-09-05       Impact factor: 6.200

Review 3.  Polymorphisms of apolipoprotein E and aneurysmal subarachnoid haemorrhage: A meta-analysis.

Authors:  S Arati; M K Sibin; Dhananjaya I Bhat; K V L Narasingarao; G K Chetan
Journal:  Meta Gene       Date:  2016-06-17

4.  Prognostic significance of factor XIIIA promoter methylation status in aneurysmal subarachnoid haemorrhage (aSAH).

Authors:  S Arati; G K Chetan; M K Sibin; Dhananjaya I Bhat; Vikas Vazhayil; K V L Narasingarao
Journal:  BMC Cardiovasc Disord       Date:  2019-07-17       Impact factor: 2.298

5.  Association of Apolipoprotein E Polymorphisms with White Matter Lesions and Brain Atrophy.

Authors:  ZhiLi Niu; PingAn Zhang; Dong Li; ChengLiang Zhu; LiNa Feng; Ge Xiong; NaNa Song; Pei Tang; Feng Liu
Journal:  Psychiatry Investig       Date:  2020-02-03       Impact factor: 2.505

6.  Apolipoprotein E polymorphism and the risk of aneurysmal subarachnoid hemorrhage in a South Indian population.

Authors:  Arati Suvatha; Sibin Madathan Kandi; Dhananjaya Ishwara Bhat; Narasinga Rao; Vikas Vazhayil; Chetan Ghati Kasturirangan
Journal:  Cell Mol Biol Lett       Date:  2017-11-29       Impact factor: 5.787

7.  Association of APOE Gene Polymorphisms with Cerebral Infarction in the Chinese Population.

Authors:  Zhixiong Zhong; Heming Wu; Min Ye; Yuxian Yang; Weixiong Luo; Yanli Wu; Hesen Wu; Miaocai Zhong; Pingsen Zhao
Journal:  Med Sci Monit       Date:  2018-02-26

8.  Polymorphism and plasma levels of apolipoprotein E and the risk of aneurysmal subarachnoid hemorrhage in a Chinese population: a case-control study.

Authors:  Xiaofeng Liu; Weiwu Zhan; Qiumei Wu; Fengqing Wang; Bin Yang; Qishui Ou
Journal:  Lipids Health Dis       Date:  2018-05-16       Impact factor: 3.876

9.  Polymorphisms of Inflammatory Cytokine Genes and Risk for Intracranial Aneurysm: A Systematic Review and Meta-Analysis.

Authors:  Liming Hu; Bingyang Li; Xin Liao; Junxia Yan
Journal:  Yonsei Med J       Date:  2020-05       Impact factor: 2.759

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.