Literature DB >> 26814648

The mitogenome of Onchocerca volvulus from the Brazilian Amazonia focus.

James L Crainey1, Túllio R R da Silva1, Fernando Encinas2, Michel A Marín2, Ana Carolina P Vicente2, Sérgio L B Luz1.   

Abstract

We report here the first complete mitochondria genome of Onchocerca volvulus from a focus outside of Africa. An O. volvulus mitogenome from the Brazilian Amazonia focus was obtained using a combination of high-throughput and Sanger sequencing technologies. Comparisons made between this mitochondrial genome and publicly available mitochondrial sequences identified 46 variant nucleotide positions and suggested that our Brazilian mitogenome is more closely related to Cameroon-origin mitochondria than West African-origin mitochondria. As well as providing insights into the origins of Latin American onchocerciasis, the Brazilian Amazonia focus mitogenome may also have value as an epidemiological resource.

Entities:  

Mesh:

Year:  2016        PMID: 26814648      PMCID: PMC4727440          DOI: 10.1590/0074-02760150350

Source DB:  PubMed          Journal:  Mem Inst Oswaldo Cruz        ISSN: 0074-0276            Impact factor:   2.743


Onchocerca volvulus is the sole cause of onchocerciasis in humans, and humans are the parasites’ only known reservoir (Crainey et al. 2016, unpublished observations). The Amazonia onchocerciasis focus is the last of the Latin American foci where O. volvulus transmission is still considered to be on-going and as such poses the principal source of risk for new infections (Luz et al. 2014, Crainey et al. 2016, unpublished observations). As mitochondria usually occur in very high copy number within animal cells, they have become a popular target for both parasite and vector molecular diagnostics, taxonomy, and population studies (Post et al. 2009, Conceição et al. 2013, Crainey et al. 2014). The availability of a complete O. volvulus mitogenome from South America provides a unique opportunity to characterise single nucleotide variant (SNV) loci as well as glean new insights into the parasites’ epidemiological and evolutionary history. The O. volvulus DNA used in this study derived from a skin biopsy taken from a resident of the Brazilian Amazonia focus; parasite DNA was isolated fromO. volvulus following procedures described previously (Morales-Hojas & Post 2000, Ta Tang et al. 2010). Whole-genome sequencing was performed on an Illumina HiSeq 2500 system (Oswaldo Cruz Foundation, high-throughput sequencing platform) using 2 x 100 bp paired-end reads generated with Nextera Truseq libraries. Reads corresponding to human-host DNA were filtered out by mapping them against a human reference genome (accession GCA_000001405.19). An indexed database ofO. volvulus genomic sequences (RefSeq; National Center for Biotechnology Information) was constructed to align reads that did not map to the human reference sequences. An O. volvulus mitochondria complete genome (accession AF015193) originating from West Africa was used as reference to extract mitochondrial reads corresponding to the Brazilian O. volvulusmitogenome (mtOvBz). The assembly of the mtOvBz genome was achieved with the A5-miseq pipeline (arxiv.org/abs/1401.5130). Mapping and short read post-processing were performed using Bowtie2 software (bowtie-bio.sourceforge.net/bowtie2) and Samtools utilities (htslib.org/), respectively. Protein-coding genes, rRNAs, and tRNAs prediction were performed using the MITOS server (mitos.bioinf.uni-leipzig.de/index.py) and Arwen software (mbio-serv2.mbioekol.lu.se/ARWEN/) followed by manual validation comparing homolog regions with the mitochondria reference in Artemis (Rutherford et al. 2000). A mitogenome map was generated using the BRIG software package (brig.sourceforge.net). Polymerase chain reaction and direct Sanger sequencing was used to confirm mtOvBz alleles at 45 of the 46 identified SNVloci (Table). Primer3 software (bioinfo.ut.ee/primer3-0.4.0) was used to design 14 primers sets for this purpose.
TABLE

Polymerase chain reaction primers used to verify Brazilian Amazonia focus alleles at 45 variable loci

Forward primerReverse primerAmplicon size (bp)Coordinates of verified single nucleotide variations
TGTTTCGTGTGGGAGCTTTTTGCAACTTCCAACCATCAAA812226, 13411, 13639, 13665, 13741
TGGGCTCTGCTGAATCTTTTAACAAACAACCAAACCAGGAA582698, 937, 1052
TGTTTTGTTTGATGTTTTGTTTGACCACCTAAACCAGCCCAATA4102182
GGGTGGTCCTGGTAGGAGTTATCCAAACTAGCAGCCCTCA7333066, 3306, 3343
TTGCTGGTTTACAGGGTATCTTTTCAACGGATCCCAAT5173648, 3837
TTGTTGTAGATTTTGATTTTTCTTTGAAAACTCCCCCAAATCCATC7514481, 4735
TGTGGATTAAGGATGTTATTTTAGAGGAGTTGAACAACTTAACACGAAAAA5076079, 6094, 6101, 6155, 6193
TTTCTTTGTTGTGGAGGGATAAAAAACAAAAATTCAATACCCAAC7096748, 6749, 7002, 7032
TTTTAAGTTTGATTTTGGTTTAGGTTGATGTGCCAACAAAATTCACC4017586, 7596
GTGAGCTGGTAAGGGGGTTTAACAACTCCACCGGAACAAC8568860, 9488
TTTTGACTTTGGTTTGTATGTTTTTAATAAATCCCGCCACTAACCA3119643, 9644
TCGGTGTGTTTTGCCTGTAGCACGCTAAGGCTGCCATTTA78910303, 10449, 10624, 10688, 10693, 10731, 10756, 10787, 10885
TTTTCTTGGGGATGGATTTTAATCCAAACGCCCCTAACAT83711246, 11324, 11947
GTTGTCTGCAAATAGGATTTGATTGCAAACCCCTACCAATAGC91312157, 12697

coordinates are all in reference to the first publishedOnchocerca volvulus mitogenome (AF015193). Nucleotide insertions occur immediately after their coordinates.

coordinates are all in reference to the first publishedOnchocerca volvulus mitogenome (AF015193). Nucleotide insertions occur immediately after their coordinates. A total of 71,936 reads were used in the assembly of a single mitochondria genome contig of 13,769 bp, with ~500x sequencing coverage. The mtOvBz genome is the first from Latin America, the first from outside of Africa, and only the second O. volvulus mitochondria genome to be completed. This genome is available from GenBank under accession KT599912. Its total GC content is 26.7%, with base composition of 19.3% A, 54% T, 19.9% G, and 6.8% C. It has 36 genes (12 protein-coding, 22 tRNA and 2 rRNA genes) and a 294 bp noncoding AT-rich region. The mtOvBz is identical in gene content and structure to the West African mitogenome and differs from it at just 37 nucleotide positions (Figure). Interestingly, L-rRNA is the gene with most SNV loci; the ND5 gene has the next most, followed by the COX1 and COX3 genes. Comparing the Brazilian and West African origin mitogenomes with a mitochondria draft genome from Cameroon (accession HG738213.2) and other publicly available sequences we have been able to identify a further nine variantloci, bringing the total number of known/putative variantloci to 46. Considering the available sequence from Cameroon, our analysis showed that this mitogenome is missing ~185 nucleotides corresponding to the tail end of the ND4 gene, immediately before the COX1 gene (nucleotide positions 2,076-2,259 within the AF015193 reference genome).

Complete mitogenome of Onchocerca volvulus from the Brazilian Amazonia focus (mtOvBz). The 13,769 bp mitogenome structure and content is visualised in a circular map. Protein-coding genes, tRNA, and rRNA genes are depicted in blue, maroon, and olive, respectively. AT-rich region and single nucleotide variations are shown in grey and magenta.

Comparative mitogenomic analysis also revealed that although all O. volvulus (West African, Cameroon, and Brazilian Amazonia focus) mitochondria share ~99% of sequence identity, the mtOvBz genome is more closely related to the Cameroon-origin mitogenome than it is to the West-Africa mitogenome. Comparing alleles at the 43 SNV loci for which data is available for all three mitogenomes, the mtOvBz genome and the Cameroon-origin mitogenome can be seen to differ at just 20 loci whereas the mtOvBz and West African-origin mitogenomes at 36 loci. Consistent with the notion that Latin American O. volvulus parasites diverged from African parasites after the species radiated in Africa, West African-origin and Cameroon-origin mitogenomes vary at 30 of these 43 nucleotide positions and thus appear more diverged (from one another) than the mtOvBz and Cameroon-origin mitogenomes are (Morales-Hojas et al. 2006, 2007, Morales-Hojas 2009). The low-levels of genetic variation detected in this study are consistent with previous studies of the parasite’s evolutionary history that have concluded that onchocerciasis is a relatively new form of human parasitism (Keddie et al. 1998, 1999, Morales-Hojas et al. 2006, 2007, Morales-Hojas 2009). The SNVs identified in the present study may represent useful new markers for O. volvuluspopulation studies and could therefore provide an important resource to obtain a clearer picture of O. volvulus epidemiology to aid with onchocerciasis elimination from the Amazonia focus.
  12 in total

1.  Artemis: sequence visualization and annotation.

Authors:  K Rutherford; J Parkhill; J Crook; T Horsnell; P Rice; M A Rajandream; B Barrell
Journal:  Bioinformatics       Date:  2000-10       Impact factor: 6.937

2.  Regional genetic variation in the major sperm protein genes of Onchocerca volvulus and Mansonella ozzardi (Nematoda: Filarioidea).

Authors:  R M Hojas; R J Post
Journal:  Int J Parasitol       Date:  2000-12       Impact factor: 3.981

3.  New tools and insights to assist with the molecular identification of Simulium guianense s.l., main Onchocerca volvulus vector within the highland areas of the Amazonia onchocerciasis focus.

Authors:  James L Crainey; Aline Mattos-Glória; Neusa Hamada; Sérgio L B Luz
Journal:  Acta Trop       Date:  2013-11-04       Impact factor: 3.112

4.  Laser-assisted microdissection for the study of the ecology of parasites in their hosts.

Authors:  R J Post; J L Crainey; A Bivand; A Renz
Journal:  Mol Ecol Resour       Date:  2009-01-31       Impact factor: 7.090

5.  Molecular systematics of five Onchocerca species (Nematoda: Filarioidea) including the human parasite, O. volvulus, suggest sympatric speciation.

Authors:  R Morales-Hojas; R A Cheke; R J Post
Journal:  J Helminthol       Date:  2006-09       Impact factor: 2.170

6.  Onchocerca volvulus: limited heterogeneity in the nuclear and mitochondrial genomes.

Authors:  E M Keddie; T Higazi; D Boakye; A Merriweather; M C Wooten; T R Unnasch
Journal:  Exp Parasitol       Date:  1999-12       Impact factor: 2.011

7.  Nested PCR to detect and distinguish the sympatric filarial species Onchocerca volvulus, Mansonella ozzardi and Mansonella perstans in the Amazon Region.

Authors:  Thuy-Huong Ta Tang; Rogelio López-Vélez; Marta Lanza; Anthony John Shelley; Jose Miguel Rubio; Sérgio Luiz Bessa Luz
Journal:  Mem Inst Oswaldo Cruz       Date:  2010-09       Impact factor: 2.743

Review 8.  Molecular systematics of filarial parasites, with an emphasis on groups of medical and veterinary importance, and its relevance for epidemiology.

Authors:  Ramiro Morales-Hojas
Journal:  Infect Genet Evol       Date:  2009-06-17       Impact factor: 3.342

9.  The mitochondrial genome of Onchocerca volvulus: sequence, structure and phylogenetic analysis.

Authors:  E M Keddie; T Higazi; T R Unnasch
Journal:  Mol Biochem Parasitol       Date:  1998-09-01       Impact factor: 1.759

10.  Outstanding insecurities concerning the use of an Ov16-based ELISA in the Amazonia onchocerciasis focus.

Authors:  Sérgio Luiz Bessa Luz; James Lee Crainey; Anthony John Shelley; Miguel Rubio
Journal:  Mem Inst Oswaldo Cruz       Date:  2014-07       Impact factor: 2.743

View more
  2 in total

1.  Molecular Verification of New World Mansonella perstans Parasitemias.

Authors:  Lucyane Bastos Tavares da Silva; James Lee Crainey; Túllio Romão Ribeiro da Silva; Uziel Ferreira Suwa; Ana Carolina Paulo Vicente; Jansen Fernandes de Medeiros; Felipe Arley Costa Pessoa; Sérgio Luiz Bessa Luz
Journal:  Emerg Infect Dis       Date:  2017-03       Impact factor: 6.883

2.  Mansonella ozzardi mitogenome and pseudogene characterisation provides new perspectives on filarial parasite systematics and CO-1 barcoding.

Authors:  James Lee Crainey; Michel Abanto Marín; Túllio Romão Ribeiro da Silva; Jansen Fernandes de Medeiros; Felipe Arley Costa Pessoa; Yago Vinícius Santos; Ana Carolina Paulo Vicente; Sérgio Luiz Bessa Luz
Journal:  Sci Rep       Date:  2018-04-18       Impact factor: 4.379

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.