Literature DB >> 26791781

Detection of Bartonella tamiae, Coxiella burnetii and rickettsiae in arthropods and tissues from wild and domestic animals in northeastern Algeria.

Hamza Leulmi1,2, Atef Aouadi3,4, Idir Bitam5,6,7, Amina Bessas8, Ahmed Benakhla9, Didier Raoult10, Philippe Parola11.   

Abstract

BACKGROUND: In recent years, the scope and importance of emergent vector-borne diseases has increased dramatically. In Algeria, only limited information is currently available concerning the presence and prevalence of these zoonotic diseases. For this reason, we conducted a survey of hematophagous ectoparasites of domestic mammals and/or spleens of wild animals in El Tarf and Souk Ahras, Algeria.
METHODS: Using real-time PCR, standard PCR and sequencing, the presence of Bartonella spp., Rickettsia spp., Borrelia spp. and Coxiella burnetii was evaluated in 268/1626 ticks, 136 fleas, 11 Nycteribiidae flies and 16 spleens of domestic and/or wild animals from the El Tarf and Souk Ahras areas.
RESULTS: For the first time in Algeria, Bartonella tamiae was detected in 12/19 (63.2%) Ixodes vespertilionis ticks, 8/11 (72.7%) Nycteribiidae spp. flies and in 6/10 (60%) bat spleens (Chiroptera spp.). DNA from Coxiella burnetii, the agent of Q fever, was also identified in 3/19 (15.8%) I. vespertilionis from bats. Rickettsia slovaca, the agent of tick-borne lymphadenopathy, was detected in 1/1 (100%) Haemaphysalis punctata and 2/3 (66.7%) Dermacentor marginatus ticks collected from two boars (Sus scrofa algira) respectively. Ri. massiliae, an agent of spotted fever, was detected in 38/94 (40.4%) Rhipicephalus sanguineus sensu lato collected from cattle, sheep, dogs, boars and jackals. DNA of Ri. aeschlimannii was detected in 6/20 (30%) Hyalomma anatolicum excavatum and 6/20 (30%) Hy. scupense from cattle. Finally, Ri. felis, an emerging rickettsial pathogen, was detected in 80/110 (72.7%) Archaeopsylla erinacei and 2/2 (100%) Ctenocephalides felis of hedgehogs (Atelerix algirus).
CONCLUSION: In this study, we expanded knowledge about the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria.

Entities:  

Mesh:

Year:  2016        PMID: 26791781      PMCID: PMC4721140          DOI: 10.1186/s13071-016-1316-9

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Since the beginning of the 20th century, ticks (Acarina), fleas (Siphonaptera) and other hematophagous arthropods have been implicated as vectors, reservoirs, and/or amplifiers of agents of human zoonoses [1]. Ticks are hematophagous arthropods that are considered second vectors (after mosquitoes) of human disease and the most significant vectors of disease-causing pathogens in animals [2, 3]. Ticks can transmit a broad range of pathogens, including viruses, protozoa and bacteria [4]. Likewise, fleas are also able to transmit several agents of infectious diseases [5]. The transmission of these zoonotic agents to humans occurs mainly through their bites or inoculation of their infected feces into pruritic bite lesions [6-9]. Rickettsioses, bartonelloses and Q fever are vector-borne diseases that may be severe and that have a widespread geographical distribution. Rickettsia spp., the etiological agent of rickettsioses, are intracellular Gram-negative bacteria that represent an emergent global threat [10]. Ri. felis, an emerging pathogen, and Ri. typhi, the agent of murine typhus (MT), are the main rickettsial pathogens associated with fleas [11], belonging to the spotted fever group (SFG) [12] and typhus group of rickettsiae, respectively [13]. Most of the SFG are transmitted by ticks [14] that are widely distributed in northern Africa [15, 16]. In Algeria, 11 rickettsial pathogens have been detected in ticks, fleas, lice and humans, including Ri. conorii subspecies conorii, Ri. aeschlimannii, Ri. sibirica mongolitimonae, Ri. massiliae, Ri. slovaca, Ri. helvetica, Ri. africae, Ri. monacensis, Ri. felis, Ri. typhi and Ri. prowazekii [17]. Likewise, bartonelloses are diseases caused by fastidious, hemotropic bacteria from the genus Bartonella [18] which parasitize erythrocytes or epithelial cells across a range of mammalian hosts, including humans, rodents and chiroptera [19-21]. In Algeria, few investigations into the diversity of Bartonella spp. from animals and vectors have been conducted. Namely, B. vinsonii subsp. berkhoffii, B. clarridgeiae, and B. elizabethae were detected infecting domestic dogs [22, 23] and fleas collected from hedgehogs [24], B. henselae was isolated from stray cats [25] and B. rochalimae was detected in fleas collected from brown rats (Rattus norvegicus) [24]. In addition, Coxiella burnetii, the causative agent of Q fever, is a highly infectious zoonotic intracellular bacterium which can affect different species of wild and domestic mammals; it can also infect arthropods and birds [26]. In Algeria few human cases of Q fever have been documented, with only two human cases reported in Oran [27]. The goal of this investigation was to assess the presence of emerging zoonotic bacteria in ectoparasites and tissues sampled from wild and domestic animals present in northeastern Algeria.

Methods

Study areas

The first part of the study was conducted in May 2012 in El Ghorra (Bougous, El Tarf) (36° 39′ 34″ N 8° 22′ 10″ E) in the far northeast of Algeria. El Ghorra is a humid bioclimatic zone. It was the highest site in the study area, where the maximum altitude is 1202 m (Jebel El Ghorra). The relief of El Ghorra is characterized by a set of wooded mountains forming the “forest of El Ghorra”. Its coverage includes 96 % vegetation and 2 % herbaceous layer, of which 500 ha are occupied by cork oak (Quercus suber) and 600 ha by canary oak, locally known as zeen oak (Quercus canariensis) [28]. The second part of this work was performed in July 2013, in Cheabat El Balout (Ouled Driss, Souk Ahras) in northeastern Algeria near El Tarf, (36° 22′ 01.30″ N 08° 07′ 27.48″ E). This study area is mountainous and is located at 1000 m above sea level, representing an extension of the Telli Atlas. It has a semi-humid climate characterized by hot summers and cold, wet winters with a rainfall averaging 800 mm per year.

Ectoparasite collection and tissue sampling

The investigation in El Ghorra (Bougous, El Tarf) was conducted on domestic animals (cattle, sheep, goats and dogs). Ectoparasites were collected with the permission of the animals’ owners. All arthropods were collected using blunted watchmakers forceps and immediately placed in tubes of 70 % ethanol labeled with the identification number and the date of collection. A portion of the collected ectoparasites was used for the present study. The field sampling in Cheabat El Balout (Ouled Driss, Souk Ahras) was conducted on wild mammals [two boars (Sus scrofa algira), two jackals (Canis aureus) one mongoose (Echinomon herpestis), ten bats (Chiroptera spp.), one porcupine (Hystrix cristata) and four hedgehogs (Atelerix algirus)]. Ectoparasites and tissues (spleens) were sampled. Hedgehogs were captured with the aid of flashlights during nightly walks through parts of the study regions near a poultry slaughterhouse. Hedgehogs were anesthetized using ketamine and released into their natural habitat after full recovery of ectoparasites. Two boars, two jackals, one mongoose and one porcupine were found recently dead following road accidents and were also inspected for ectoparasites, and their spleens were sampled using adapted scalpels and stored in tubes containing 70 % ethanol. Finally, we caught ten bats using hunting nets. The nets, identical to those used by ornithologists to capture and band birds, are very fine, and similar to a mesh-like fishing net. They are stretched between two poles, and placed at the entrance of the bat cave. Once detached from the nets, we searched for ectoparasites and took spleen samples. All biological materials were forwarded thereafter to Marseille, France for morphological identification of ectoparasites at the species level using morphological criteria within standard taxonomic keys [29, 30]. Molecular analyses of ectoparasites and tissue samples were performed to detect Rickettsia spp., Bartonella spp., Coxiella burnetii and Borrelia spp.

Ethical approval

The study on hedgehogs was authorized by the local ethics committee and by national legislation (le journal officiel n° 47 du 19 juillet 2006, http://www.iucnredlist.org/apps/redlist/details/27926/0). Oral permission to place nets to trap bats in the study area was granted by the landowner, who placed his pets inside the cave in the rainy days. At the beginning of the study, the work on bats was programmed only on bats ectoparasites and when bats were recovered the next day, they were dead, that because we proceeded bats spleen also. In addition Algeria does not have ethical committee of bats. All experiments were done under the supervision of the Ministry of Health of Algeria.

DNA extraction

Prior to DNA extraction, a convenient sample was selected according to a good representation of species and hosts in El Ghorra (samples < 20 were all processed while for samples > 20 only 20 samples were processed). All collected ectoparasites and biological materials from Cheabat El Balout were used to extract their DNA. Arthropods and spleens were rinsed twice in distilled water for 10 min and dried on sterile filter paper; handling was performed in a laminar flow biosafety cabinet. Ectoparasites and a portion of the spleen samples were individually crushed in sterile Eppendorf tubes. Total DNA was extracted in a final volume of 200 μl from one half of each ectoparasite and a portion of the spleen using the QIAamp Tissue Kit (Qiagen, Hilden, Germany) by Qiagen-BioRobot EZ1, according to the manufacturer’s instructions. Genomic DNA was stored at −22 °C under sterile conditions.

Detection of bacteria

Once DNA had been extracted, it was used in qPCR template assays to detect Bartonella spp., Rickettsia spp., Coxiella burnetii and Borrelia spp. The final qPCR reaction mixture consisted of 5 μl of DNA and 15 μl of mix from the Takyon PCR Kit (Qiagen, Hilden, Germany) as described [31]. Negative controls were used in each qPCR and consisted of DNA extracted from uninfected ticks from our laboratory colony. Positive controls included DNA extracted from a dilution of cultured strains of B. elizabethae (detection of Bartonella spp.), Ri. montanensis (for the detection of Rickettsia spp.), Coxiella burnetii (for the detection of Coxiella burnetii) and Borrelia crocidurae (for the detection of Borrelia spp.). Results were deemed positive if the Cycle threshold (Ct) value obtained by CFX96 was lower than 36. All positive results were confirmed with a second qPCR system and/or sequence reaction.

Detection of Bartonella spp.

DNA samples were screened by qPCR targeting the ITS for the detection of Bartonella spp. [32]. The positive samples with ITS primers were then confirmed by standard PCR performed with Bartonella-specific primers of the intergenic spacer region between the 16S and 23S rRNA genes [33]. PCR amplification success was verified by migration in 2 % Agarose gel, followed by purification using the NucleoFast 96 PCR plate (Machery-Nagel EURL, France), as recommended by the manufacturer. The purified PCR products were sequenced using Urb1 and Urb2 primers and using BigDye version 1.1 Cycle Sequencing Ready Reaction Mix (Applied Biosystems, Foster City, CA). Data were collected with an ABI Prism 3130xl Genetic Analyzer capillary sequencer (ABI PRISM, PE Applied Biosystems, USA). Sequences were edited and assembled using Chromas Pro 1.34 (Technelysium Pty. Ltd., Tewantin, Australia). BLAST searches were performed to identify the obtained sequences.

Detection of Rickettsia spp.

Rickettsial DNA was detected using a Rickettsia genus-specific qPCR with a 25-bp probe targeting the partial sequence of the citrate synthase gene (gltA) [34]. All tick samples identified as positive by qPCR were confirmed by a different standard PCR and sequencing for the fragments of OmpA gene [34]. DNA sequencing reactions were performed on highly positive samples (Ct <28). Tick samples with Ct > 28 were screened by qPCR specific to the species according to the sequencing result using Ri. slovaca, Ri. massiliae or Ri. aeschlimannii qPCRs systems (Table 1), while flea samples testing positive with the RKND03 qPCR were directly tested with two qPCRs systems targeting the biotin synthase (bioB) and membrane phosphatase genes of Ri. felis [35]. Table 1 summarizes the probes and primers used to confirm and identify rickettsiae in samples.
Table 1

Target sequences, primers and probes used to confirm the detection of rickettsiae by qPCR

Quantitative real-time PCR designation and specificityqPCR Sytem usedForward primerReverse primerProbe
Rickettsia felis Biotin synthaseATG-TTC-GGG-CTTCCG-GTA-TGCCG-ATT-CAG-CAGGTT-CTT-CAA6-FAM- GCT-GCG-GCGGTA-TTT-TAG-GAA -TGGG-TAMRA
Rickettsia aeschlimannii ScalAAGCGGCACTTTAGGTAAAGAAACATGCTCTGCAAATGAACCA6FAM-TGGGGAAATATGCCGTATACGCAAGC -TAMRA
Rickettsia massiliae R.mass_9666CCAACCTTTTGTTGTTGCACTTGGATCAGTGTGACGGACT6FAM-CACGTGCTGCTTATACCAGCAAACA -TAMRA
Rickettsia slovaca R.slovGCAACGGTTTTTGGTATCGTAATCGAATGCACCACCACTT6FAM- TCCCGTCCCAGCCATTCGTC -TAMRA
Target sequences, primers and probes used to confirm the detection of rickettsiae by qPCR

Detection of Borrelia spp.

qPCR targeting the 16S rRNA gene was used, as described elsewhere [34], to screen DNA samples for all Borrelia spp.

Detection of Coxiella burnetii

Coxiella burnetii bacterial DNA was initially detected by qPCR with C. burnetii–specific primers and a probe designed to amplify the IS1111 gene [36]. qPCR with primers and a probe designed for the amplification of IS30a spacers were used to confirm C. burnetii–positive results [27].

Results

Sample collection and ectoparasites identification

In El Ghorra, a total of 1549 ticks (Table 2) were collected, including eight species; 565 ticks were sampled from 123 cattle, 529 ticks from 250 sheep, 130 ticks were collected from 125 goats and 325 ticks were sampled from 50 dogs.
Table 2

Detection of Rickettsiae, Bartonella spp., and Coxiella burnetii in arthropods

Ectoparasite speciesLocalizationAnimal (N)No. of ectoparasites collected (m = male, f = female)No. of ectoparasites tested by qPCR (m = male, f = female) Rickettsia spp Bartonella spp Coxiella burnetii
Rhipicephalus sanguineus El Ghorra, El Tarf.Cattle (123)316 (104 m, 212f)20 (10 m, 10f)3/20 (1 m, 2f) Ri. massiliae --
Sheep (250)454 (217 m, 237f)20 (10 m, 10f)11/20 (9 m, 2f) Ri. massiliae --
Goats (128)104 (55 m, 49f)20 (10 m, 10f)---
Dogs (50)323 (222 m, 101f)20 (10 m, 10f)1/20 (1 m) Ri. massiliae --
Cheabat El Balout, Souk AhrasBoars (2)9 (5 m, 4f)9 (5 m, 4f)8/9 (5 m, 3f) Ri. massiliae --
Mangoose (1)2 (1 m, 1f)2 (1 m, 1f)2/2 (1 m, 1f) Ri. massiliae --
Jackals (2)23 (15 m, 8f)23(15 m, 8f)13/23(8 m, 5f) Ri. massiliae --
Hedgehogs (4)10 (2 m, 8f)10(2 m, 8f)---
Rhipicephalus bursa El Ghorra, El Tarf.Cattle (123)50 (39 m, 11f)20 (10 m, 10f)2/20 (2f) Ri. massiliae --
Sheep (250)72 (37 m, 35f)20 (10 m, 10f)---
Goats (128)19 (19 m)19 (19 m)---
Hyalomma lusitanicum El Ghorra, El Tarf.Sheep (250)1 (1 m)1 (1 m)---
Goats (128)3 (2 m, 1f)3 (2 m, 1f)---
Hyalomma scupense El Ghorra, El Tarf.Cattle (123)94 (41 m, 53f)20 (10 m, 10f)6/20 (2 m, 4f) Ri. aeschlimannii --
Sheep (250)1 (1f)1 (1f)---
Hyalomma anatolicum excavatum El Ghorra, El Tarf.Cattle (123)105 (54 m, 51f)20 (10 m, 10f)6/20 (4 m, 2f) Ri. aeschlimannii --
Hyalomma marginatum El Ghorra, El Tarf.Goats (128)4 (4f)4 (4f)---
Ixodes ricinus El Ghorra, El Tarf.Sheep (250)1 (1 m)1 (1 m)---
Cheabat El Balout, Souk AhrasMongoose (1)1 (1 m)1 (1 m)---
Ixodes hexagonus El Ghorra, El Tarf.Dogs (50)2 (2f)2 (2f)---
Cheabat El Balout, Souk AhrasHedgehogs (4)9 (1 m, 8f)9 (1 m, 8f)---
Dermacentor marginatus Cheabat El Balout, Souk AhrasBoars (2)3 (3f)3 (3f)2/3 (2f) Ri. slovaca --
Haemaphysalis punctata Cheabat El Balout, Souk AhrasBoars (2)1 (1f)1 (1f)1/1 (1f) Ri. slovaca --
Ixodes vespertilionis Cheabat El Balout, Souk AhrasBats (10)19 (2f, 17 nymphs)19 (2f, 17 nymphs)-12/19 (1f, 11 nymphs) B. tamiae 3/19 (2f, 1 nymph)
Ischnopsyllus intermedius Cheabat El Balout, Souk AhrasBats (10)3 (3f)3 (3f)---
Ctencephalides felis Cheabat El Balout, Souk AhrasHedgehogs (4)2 (2f)2 (2f)2/2 (2f) Ri. felis --
Pariodontis riggenbachi Cheabat El Balout, Souk AhrasPorcupine (1)21 (3 m, 18f)21 (3 m, 18f)---
Nycteribiidae Cheabat El Balout, Souk AhrasBats (10)11(5 m, 6f)11(5 m, 6f)-8/11 B. tamiae -
Archaeopsylla erinacei Cheabat El Balout, Souk AhrasHedgehogs (4)110 (39 m, 71f)110 (39 m, 71f)80/110 (19 m, 61f) Ri. felis --
Detection of Rickettsiae, Bartonella spp., and Coxiella burnetii in arthropods For the investigation on wild animals and their ectoparasites in Cheabat El Balout, 77 ticks, 136 fleas, 11 Nycteribiidae (Table 2) and 16 spleens were sampled (two spleens from boars, one from a mongoose, two from jackals, one from a porcupine and 10 from bats). All the selected 191 ticks of El Ghorra (Table 2) tested negative for Bartonella spp. However, out of all ticks, fleas, Nycteribiidae and spleen portions, 26 samples collected from bats were positive, including 12/19 (63.2 %) of I. vespertilionis ticks, 8/11 (72.7 %) Nycteribiidae flies and 6/10 (60 %) spleens. The results showed that all sequences of Bartonella spp. detected in ectoparasites and bat spleens were similar to the sequence of B. tamiae (100 % similarity with the Bartonella tamiae strain Th339 16S-23S ribosomal RNA intergenic spacer, partial sequence, GenBank no EF605284.1, 451/451 bp). In El Ghorra, 29/191 (15.2 %) of ticks tested positive for Rickettsia spp. by qPCR. These included 15/29 (51.7 %) R. sanguineus sensu lato, 2/29 (6.9 %) R. bursa, 6/29 (20.7 %) Hy. scupense and 6/29 (20.7 %) Hy. a. excavatum. Concerning the 15 R. sanguineus sensu lato that were Rickettsia spp.-positive, 3 were collected from cattle, 11 from sheep and 1 from dogs. The two R. bursa were sampled from cattleas well as all six Hy. scupense. Finally, the 6 Hy. a. excavatum were sampled from goats. DNA sequence analyses of the PCR products targeting OmpA on the R. sanguineus sensu lato and R. bursa ticks showed 100 % similarity with Rickettsia massiliae (GenBank accession no. U43793.1), regardless of the host’s tick type. In addition, the sequencing of the OmpA gene fragment from the positive Hy. scupense and Hy. a. excavatum showed 100 % similarity with Rickettsia aeschlimannii strain EgyRickHimp-El-Arish-17 outer membrane protein A (OmpA) gene, partial cds (GenBank accession no. HQ335158.1, 633/633 bp). In Cheabat el Balout, the RKND03 qPCR system was used to test the 77 ticks, 136 fleas, 11 Nycteribiidae flies and 16 spleens sampled from wild animals. Overall, we detected DNA from Rickettsia spp. in three ticks from boars (two D. marginatus and one Hae. punctata), in 80 A. erinacei and two C. felis fleas from hedgehogs. The DNA sequence of the two rickettsia-positive D. marginatus and Hae. punctata showed 100 % similarity with Rickettsia slovaca strain WB2/Dm Pavullo outer membrane protein A (OmpA) gene, partial cds GenBank accession no. HM161787.1, 633/633 bp). Concerning the 80 A. erinacei and 2 C. felis of hedgehogs positive for Rickettsia spp, all 82 fleas were positive for Ri. felis (Table 2). In El Ghorra, all the 191 screened ticks were negative, however in Cheabat el Balout, we detected DNA from C. burnetii in three I. vespertilionis of bats. We confirmed the result using the second qPCR system (Table 2). All tested samples were negative for Borrelia spp. using the 16S qPCR system from the Borrelia genus.

Discussion

This investigation reports the first direct evidence of DNA from B. tamiae in I. vespertilionis, Nycteribiidae and bat spleens in Algeria. The association between the DNA from Ri. slovaca and Hae. punctata from boars and also between Ri. massiliae and R. bursa from cattle are reported for the first time in Algeria. Other rickettsiae were detected in this field as previously detected in Algeria, namely Ri. massiliae in R. sanguineus sensu lato, Ri. aeschlimannii in Hyalomma spp. ticks and Ri. felis in A. erinacei and in C. felis fleas. Using molecular tools C. burnetii, the agent of Q fever, was also detected in I. vespertilionis ticks of bat. Since ticks were removed from animals that in some cases could have been bacteremic, the ticks can be vectors for some pathogens but also only carriers in other cases. As a consequence, we cannot consider the presence of bacteria in the ectoparasite as proof of vector competence. Bartonella-associated illnesses occur worldwide, and they encompass a broad clinical spectrum, including fever, skin lesions, endocarditis, lymphadenopathy, and abnormalities of the central nervous system, eye, liver and bone tissues [37]. Bartonella tamiae is a newly described bacterial species, initially isolated from the blood of three hospitalized patients in Thailand [33]. These patients presented with headache, myalgia, anemia, and mild liver function abnormalities [38]. This novel Bartonella species has been newly recognized as a pathogen [33, 39]. Throughout our investigation, B. tamiae was detected for the first time in Algeria, and in ticks, Nycteribiidae and bat spleens. Bats are the second species group of mammals after rodents confirmed to carry Bartonella spp. [40]. Renewed interest in Bartonella research in mammals has confirmed the presence of Bartonella spp. in bats in Guatemala, Kenya [41] and the United Kingdom [42]. C. burnetii was also detected in this study; this pathogenic agent of Q fever is associated with many manifestations [26, 43]. Q fever is typically an acute febrile illness with nonspecific clinical signs in humans, but isolated fever, hepatitis and/or atypical pneumonia are the most commonly described manifestations. A small proportion of infected people develop life-threatening valvular endocarditis [26, 43]. Q fever has been described worldwide in outbreaks involving sheep, goats, cats, dogs and wild animals, while reservoirs are extensive but only partially known and include mammals, birds, and arthropods, mainly ticks [44]. In Algeria, few human cases have been reported, including one in 2005, where two patients were found to be seropositive for C. burnetii (one was confirmed positive by nested PCR) [45]. In 2012, through 268 qPCR-tested samples from Oran, Western Algeria, only one patient was positive for C. burnetii [27]. B. tamiae and C. burnetii were detected in I. vespertilionis. This tick species parasitizes bats specifically [46, 47]. Humans can also act as accidental hosts [48]. I. vespertilionis represents little interest for human health because it is restricted to the darkest part of bat caves [49]. In literature, no evidence was found to prove that this species can transmit pathogens to humans or other animals [49]. We detected Ri. slovaca in ticks from boars, namely in Hae. punctata and D. marginatus. Our detection of Ri. slovaca in Hae. punctata ticks may be due to co-feeding with infected D. marginatus, which is a recognized vector and reservoir of the bacteria. Literature reported also the possibility of transmission to other tick species by feeding on bacteremic animals, as is the case of Ri. slovaca [50]. Ri. slovaca is associated with a syndrome characterized by scalp eschar and neck lymphadenopathy following tick bites [51]. In Algeria, Ri. slovaca was previously detected in D. marginatus ticks collected from vegetation in the Blida region, in 2012 [52]. In Algeria, Ri. massiliae was detected in R. turanicus, in 2006 [53]. Our results confirm the presence of Ri. massiliae in Algerian ticks, where we detected it in R. sanguineus sensu lato from cattle, sheep, dogs and boars. Using qPCR, it was also detected in R. bursa from cattle. These SFG rickettsiae were described in 1992, and then subsequently detected in other Rhipicephalus spp., including R. bursa in European countries [51]. Our results indicate the presence of Ri. aeschlimannii in Hy. a. excavatum and Hy. scupense ticks from cattle in the far northeast of Algeria. Ri. aeschlimannii is an emerging pathogen that causes symptoms similar to those of Mediterranean spotted fever [51]. It has been associated with ticks, particularly with Hy. marginatum and Hy. rufipes ticks, in southern Europe and Africa [51]. In Algeria, Ri. aeschlimannii was previously detected in Hy. dromedarii and Hy. rufipes from camels from southern Algeria [54] and Hy. aegyptium ticks from tortoises trapped near Algiers [55]. Our results confirm the presence of Ri. aeschlimannii in Algeria but also complete the geographical distribution of this pathogen from the south and center to the far northeast. Finally, we detected DNA from Ri. felis in hedgehog fleas (Ct. felis and A. erinacei). Ri. felis is an emergent agent of infectious diseases in humans, and this SFG agent is known to be maintained in cat fleas (Ct. felis) [56, 57]. To date, 12 flea species, eight tick species and three mite species have been found to be infected with Ri. felis [57]. These rickettsiae have also recently been detected in several mosquito species in sub-Saharan Africa [31, 58, 59]. Clinical features may include fever, fatigue, headache, generalized maculopapular rash and inoculation eschar(s) [57]. It is known to be a frequent agent of fever of unknown origin [60]. In Algeria Ri. felis was previously detected in A. erinacei fleas of hedgehogs of M’sila and Bordj-Bou-Arreridj, Algeria [61, 62]. It was also detected in Ct. canis [60]. Here, we report for the first time the presence of Ri. felis in Ct. felis fleas from Algeria.

Conclusion

For the first time in Algeria, we detected B. tamiae, Coxiella burnetii and rickettsiae (Ri. slovaca, Ri. massiliae, Ri. aeschlimannii and Ri. felis) in two regions of the far northeast of Algeria. We expanded knowledge of the repertoire of ticks and flea-borne bacteria present in ectoparasites and/or tissues of domestic and wild animals in Algeria. Our findings will help human and veterinary clinicians to enlarge the spectrum of pathogens to consider in differential diagnosis. Future studies on rickettsioses, bartonelloses and other vector-borne diseases should be performed to assess their epidemiological and clinical relevance in Algeria, to estimate the actual prevalence and to allow the establishment of anti-vector control plans.
  60 in total

1.  Whole genome-based phylogenetic analysis of Rickettsiae.

Authors:  V Merhej; K El Karkouri; D Raoult
Journal:  Clin Microbiol Infect       Date:  2009-05-18       Impact factor: 8.067

2.  First detection of Rickettsia felis and Bartonella clarridgeiae in fleas from Laos.

Authors:  M Varagnol; P Parola; R Jouan; J-C Beaucournu; J-M Rolain; D Raoult
Journal:  Clin Microbiol Infect       Date:  2009-05-02       Impact factor: 8.067

Review 3.  Bartonella: emerging pathogen or emerging awareness?

Authors:  Elin Mogollon-Pasapera; Laszlo Otvos; Antonio Giordano; Marco Cassone
Journal:  Int J Infect Dis       Date:  2008-07-14       Impact factor: 3.623

4.  Mediterranean spotted fever in Algeria--new trends.

Authors:  Nadjet Mouffok; Philippe Parola; Hubert Lepidi; Didier Raoult
Journal:  Int J Infect Dis       Date:  2008-10-19       Impact factor: 3.623

5.  Molecular detection of Rickettsia typhi and Rickettsia felis in fleas from Algeria.

Authors:  I Bitam; B Baziz; T Kernif; Z Harrat; P Parola; D Raoult
Journal:  Clin Microbiol Infect       Date:  2009-06-22       Impact factor: 8.067

6.  First detection of Rickettsia aeschlimannii in Hyalomma aegyptium from Algeria.

Authors:  I Bitam; T Kernif; Z Harrat; P Parola; D Raoult
Journal:  Clin Microbiol Infect       Date:  2009-06-22       Impact factor: 8.067

7.  Detection of Bartonella tamiae DNA in ectoparasites from rodents in Thailand and their sequence similarity with bacterial cultures from Thai patients.

Authors:  Hidenori Kabeya; James M Colborn; Ying Bai; Kriangkrai Lerdthusnee; Jason H Richardson; Soichi Maruyama; Michael Y Kosoy
Journal:  Vector Borne Zoonotic Dis       Date:  2010-06       Impact factor: 2.133

8.  Coxiella burnetii in humans and ticks in rural Senegal.

Authors:  Oleg Mediannikov; Florence Fenollar; Cristina Socolovschi; Georges Diatta; Hubert Bassene; Jean-François Molez; Cheikh Sokhna; Jean-François Trape; Didier Raoult
Journal:  PLoS Negl Trop Dis       Date:  2010-04-06

Review 9.  Q Fever.

Authors:  Emmanouil Angelakis; Didier Raoult
Journal:  Vet Microbiol       Date:  2009-08-08       Impact factor: 3.293

Review 10.  Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors.

Authors:  Bruno B Chomel; Henri-Jean Boulouis; Edward B Breitschwerdt; Rickie W Kasten; Muriel Vayssier-Taussat; Richard J Birtles; Jane E Koehler; Christoph Dehio
Journal:  Vet Res       Date:  2009-03-14       Impact factor: 3.683

View more
  23 in total

1.  Tache Noire in a Patient with Acute Q Fever.

Authors:  Vito Fiore; Fabiola Mancini; Alessandra Ciervo; Paola Bagella; Francesca Peruzzu; Giuseppe Nunnari; Giovanni Andrea Deiana; Giovanni Rezza; Sergio Babudieri; Giordano Madeddu
Journal:  Med Princ Pract       Date:  2018-01-03       Impact factor: 1.927

2.  Bartonella Infection in Hematophagous, Insectivorous, and Phytophagous Bat Populations of Central Mexico and the Yucatan Peninsula.

Authors:  Matthew J Stuckey; Bruno B Chomel; Guillermo Galvez-Romero; José Ignacio Olave-Leyva; Cirani Obregón-Morales; Hayde Moreno-Sandoval; Nidia Aréchiga-Ceballos; Mónica Salas-Rojas; Alvaro Aguilar-Setién
Journal:  Am J Trop Med Hyg       Date:  2017-07-19       Impact factor: 2.345

3.  Molecular survey of ITS1 spacer and Rickettsia infection in human flea, Pulex irritans.

Authors:  Mohammad Bagher Ghavami; Habibeh Mirzadeh; Jamshid Mohammadi; Asghar Fazaeli
Journal:  Parasitol Res       Date:  2018-03-14       Impact factor: 2.289

4.  Molecular evidence of Chlamydiales in ticks from wild and domestic hosts in Sardinia, Italy.

Authors:  Valentina Chisu; Cipriano Foxi; Antonio Tanda; Giovanna Masala
Journal:  Parasitol Res       Date:  2018-02-07       Impact factor: 2.289

5.  Evidence and molecular characterization of Bartonella spp. and hemoplasmas in neotropical bats in Brazil.

Authors:  P Ikeda; M C Seki; A O T Carrasco; L V Rudiak; J M D Miranda; S M M Gonçalves; E G L Hoppe; A C A Albuquerque; M M G Teixeira; C E Passos; K Werther; R Z Machado; M R André
Journal:  Epidemiol Infect       Date:  2017-05-15       Impact factor: 4.434

6.  Morphological and molecular identification of the brown dog tick Rhipicephalus sanguineus and the camel tick Hyalomma dromedarii (Acari: Ixodidae) vectors of Rickettsioses in Egypt.

Authors:  Hend H A M Abdullah; Amal El-Molla; Fayez A Salib; Nesreen A T Allam; Alaa A Ghazy; Sobhy Abdel-Shafy
Journal:  Vet World       Date:  2016-10-18

7.  Genomic changes associated with the evolutionary transition of an insect gut symbiont into a blood-borne pathogen.

Authors:  Francisca Hid Segers; Lucie Kešnerová; Michael Kosoy; Philipp Engel
Journal:  ISME J       Date:  2017-02-24       Impact factor: 10.302

8.  Molecular detection of Bartonella spp. and Rickettsia spp. in bat ectoparasites in Brazil.

Authors:  Renan Bressianini do Amaral; Elizabete Captivo Lourenço; Kátia Maria Famadas; Amanda Barbosa Garcia; Rosangela Zacarias Machado; Marcos Rogério André
Journal:  PLoS One       Date:  2018-06-05       Impact factor: 3.240

9.  Diversity and phylogenetic relationships among Bartonella strains from Thai bats.

Authors:  Clifton D McKee; Michael Y Kosoy; Ying Bai; Lynn M Osikowicz; Richard Franka; Amy T Gilbert; Sumalee Boonmar; Charles E Rupprecht; Leonard F Peruski
Journal:  PLoS One       Date:  2017-07-20       Impact factor: 3.240

10.  Serological and molecular detection of spotted fever group Rickettsia in a group of pet dogs from Luanda, Angola.

Authors:  Patrícia F Barradas; Hugo Vilhena; Ana Cristina Oliveira; Sara Granada; Irina Amorim; Paula Ferreira; Luís Cardoso; Fátima Gärtner; Rita de Sousa
Journal:  Parasit Vectors       Date:  2017-05-31       Impact factor: 3.876

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.