Literature DB >> 26781306

Genotype‑phenotype analysis of CYP2C19 in the Tibetan population and its potential clinical implications in drug therapy.

Tianbo Jin1, Xiyang Zhang2, Tingting Geng3, Xugang Shi1, Li Wang1, Dongya Yuan1, Longli Kang1.   

Abstract

Cytochrome P450 2C19 (CYP2C19) is a highly polymorphic gene, it codes for a protein responsible for the metabolism of multiple clinically important therapeutic agents. However, there is currently no available data on the distribution of CYP2C19 mutant alleles in the Tibetan population. The aim of the present study was to identify different CYP2C19 mutant alleles and determine their frequencies, along with genotypic frequencies, in the Tibetan population. The whole CYP2C19 gene was amplified and sequenced in 96 unrelated, healthy Tibetans from the Tibet Autonomous Region of China, the promoter region, exons, introns and the 3'‑UTR were screened for genetic variants. Three novel genetic polymorphisms in CYP2C19 were detected among a total of 27 different mutations. The allele frequencies of CYP2C19*1A, *1B, *2A, *3A and *17 were 50, 28.13, 15.10, 5.21 and 1.56%, respectively. The most common genotype combinations were CYP2C19*1A/*1B (56.25%) and *1A/*2A (30.21%). One novel non‑synonymous mutation (Asn to Lys) in CYP2C19 was identified, and this mutation was predicted to be intolerant and benign by SIFT and PolyPhen‑2, respectively. The observations of the present study may have important clinical implications for the use of medications metabolized by CYP2C19 among Tibetans.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 26781306      PMCID: PMC4768997          DOI: 10.3892/mmr.2016.4776

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

The cytochrome P450 2C (CYP2C) subfamily of enzymes metabolizes ~20–30% of all pharmaceuticals in use today (1). CYP2C19 comprises 16% of the CYP2C subfamily (2) and is involved in the metabolism of a range of clinically important compounds, including the antiplatelet therapeutic agent clopidogrel; anticonvulsants such as phenytoin and diazepam; proton pump inhibitors such as omeprazole and lansoprazole; tricyclic antidepressants such as amitriptyline and clomipramine; and the selective serotonin reuptake inhibitor citalopram (3–7). An association has been identified between CYP2C19 genetic variation and therapeutic outcomes, adverse drug reactions and treatment failures (8). Among the various characterized polymorphic variants of CYP2C19, the most common loss of function mutations are CYP2C19*2 (681G>A, rs4244285) and CYP2C19*3 (636G>A, rs4986893) (9). By contrast, the common CYP2C19*17 allele (-806CNT, rs12248560) has been associated with increased gene expression and enzyme activity (9). CYP2C19 exhibits genetic polymorphisms among different races, as demonstrated by variations in the metabolism of therapeutic agents (10). A previous study evaluated enzymatic activity and genotypic association of CYP2C19 among Chinese, Korean, Japanese and Caucasian populations (11). Tibet is one of the oldest ethnic groups in China, with their own spoken and written language. To the best of our knowledge, no genotypic information on CYP2C19 mutants in this population is currently available. The aim of the present study was to determine CYP2C19 mutant allele and genotype frequencies in a healthy Tibetan population. The results were compared with CYP2C19 genetic polymorphisms in other populations. The results of the present study may assist in predicting adverse effects and optimization of dosage and treatment with medications metabolized by CYP2C19 in the Tibetan population.

Materials and methods

Participants

A group of 96 normal, healthy, non-related Tibetans (including 48 males and 48 females) were recruited between October and December 2009 from Xizang Minzu University in Xianyang. All participants were Tibetan Chinese living in the Tibet Autonomous Region of China, with a minimum of three generations of paternal ancestry within this ethnic group. Subjects with any type of medical illness, organ transplant, drug/alcohol addiction or those who were pregnant were excluded from the study. These exclusion criteria were used to minimize factors that may have influenced genetic variation in the genes of interest. The present study was approved by The Human Research Committee of the Xizang Minzu University for Approval of Research Involving Human Subjects; all subjects were informed, verbally and in writing, about the experimental procedures, confidentiality and the purpose of the study. All participants gave their written informed consent prior to enrollment in the study.

Genotyping of CYP2C19

A blood sample (5 ml) was taken from each subject in an EDTA tube (Jiangsu Kangjie Medical Devices Co., Ltd. Jiangyan, China) and DNA was extracted using the GoldMag-Mini Whole Blood Genomic DNA Purification kit (GoldMag Co., Ltd., Hainan, China), according to the manufacturer's instructions. Primers (presented in Table I; Sangon Biotech, Shanghai, China) were designed to amplify the 5′-flanking regions, all exons, and all introns of the CYP2C19 gene. Polymerase chain reaction (PCR) was performed for all single nucleotide polymorphisms (SNPs) in 10 µl reactions with 1 µl template DNA, 5 µl HotStar Taq Master mix (Qiagen, Germantown, MD, USA), 0.5 µl each primer (5 µM) and 3 µl deionized water. The thermal cycling conditions were as follows: Denaturation step of 15 min at 95°C; followed by 35 cycles of denaturation at 95°C for 30 sec, 55–64°C for 30 sec and 72°C for 1 min; and a final extension step at 72°C for 3 min. PCR products were incubated with 0.5 µl shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 µl HotStar PCR product, and 1.5 µl deionized water (to a total volume of 10 µl), at 37°C for 30 min, followed by heat inactivation at 80°C for 15 min. Purified PCR products were sequenced directly using the ABI Prism BigDye Terminator Cycle Sequencing kit version 3.1 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA), using an ABI Prism 3100 sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc.).
Table I

Primers and amplicon sizes for cytochrome P450 2C19.

PrimerPrimer sequence (5′→3′)Polymerase chain reaction product size (bp)
PromoterF: GCCTGTTTTATGAACAGGATGA918
PromoterR: TAAGACAACCGTGAGCTTGC
Exon1F: ACAGAGTGGGCACTGGGACGA844
Exon1R: GGTCCTAAACCCACAGCTGCTTCC
Exon2_3F: TTGTCTGACCATTGCCTTGA833
Exon2_3R: TCTCAGCTTCAAACCCTGCT
Exon4F: CCCCAACTATTCTCACCCTTT916
Exon4R: AAAGTGTGAATTGAAGGACAAGC
Exon5F: TCAGGTTGTGCAAACTCTTTT908
Exon5R: CCTTCACTCACTTTTTGATGGA
Exon6F: ATGTTGGTAAGTATACAATGTGAGT386
Exon6R: TCACACCATTAAATTGGGACAGA
Exon7F: TTTTGATTGGAAATTTTAGTCCATT921
Exon7R: TCAGTTCTTTCCAAACTGACCT
Exon8F: GTCACTGGCCTTAAGCTCATGCCT718
Exon8R: CCCAGCCTAGGGGGTGAGGG
Exon9F: TGAGAGTAGGGGAGGTGAAGA907
Exon9R: GATGACGGGTCAGAAGAAGC
3′-UTRF: ACGGATTTGTGTGGGAGAGGGC674
3′-UTRR: AATGCTCAGCCAAAATAGCTTCCCT

bp, base pairs; UTR, untranslated region.

Statistical analysis

Sequencher 4.10.1 (http://www.genecodes.com/) software was used to analyze the sequences, including manual curation, fragment assembly and mutation detection. CYP2C19 variants were designed based on the nucleotide reference sequence NG_008384.2, which is searched from the National Center for Biotechnology Information database (NCBI database, http://www.ncbi.nlm.nih.gov/). The CYP allele nomenclature is quoted from the Human Cytochrome P450 Allele Nomenclature Committee tables (http://www.cypalleles.ki.se/). The χ2 test was used to compare allele and genotype frequencies, with descriptive analysis used to compare allele frequencies between the Tibetan and other populations (12). Haploview 4.1 (http://broad.mit.edu/mpg/haploview) was used to assess linkage disequilibrium (LD) and Hardy-Weinberg equilibrium for each genetic variant (13). Haplotypes were constructed from the selected tag SNPs and haplotype frequencies were derived for the Tibetan population.

Translational prediction

Non-synonymous SNPs in the CYP2C19 coding regions were analyzed to predict the coded protein function. Two algorithms, Sorting Intolerant From Tolerant (SIFT; http://sift.bii.a-star.edu.sg/) and Polymorphism Phenotyping version 2 (PolyPhen-2; http://genetics.bwh.harvard.edu/pph2/), were used to perform the functional prediction of non-synonymous SNPs (14). Depending on the metabolic activity of CYP2C19, the subjects were divided into three phenotypic groups: Poor metabolizer (PM), extensive metabolizer and ultra-rapid metabolizer, based on CYP allele nomenclature (http://www.cypalleles.ki.se/) (15).

Results

Genetic variants

CYP2C19 was sequenced in the group of 96 Tibetan participants (48 males and 48 females) and the results successfully identified a total of 27 CYP2C19 polymorphisms in this population. Three of the polymorphisms had not previously been reported in either the National Center for Biotechnology Information database or the Human Cytochrome P450 Allele Nomenclature Committee tables (Table II), two of the novel polymorphisms were synonymous mutations within exon five and one was a non-synonymous mutation in exon eight. No duplications or deletions within the sequenced CYP genes were observed.
Table II

Positions and frequencies of cytochrome P450 2C19 genetic variants in the Tibetan study population.

No.SNPPositionRegionNucleotide changeAlleleFrequencyPercentage (%)Amino-acid effect
1rs576566073−844PromoterG>T1/961.042Not translated
2rs12248560−806PromoterC>TCYP2C19*173/963.125Not translated
3/−643PromoterC>T1/961.042Not translated
4/−597PromoterA>G1/961.042Not translated
5rs1788509899Exon 1C>T86/9689.583Pro33a
6/483Intron 1G>A1/961.042Not translated
7rs7918461527Intron 1A>T3/963.125Not translated
8rs498689317948Exon 4G>ACYP2C19*3A11/8612.644Trp212Ter
9rs708878418911Intron 4A>G22/9622.917Not translated
10rs424428519154Exon 5G>ACYP2C19*2A39/9640.625Pro227a
1119184Exon 5T>CNovel 11/961.042Leu237a
1219280Exon 5C>ANovel 21/961.042IlE269a
13rs1257142119520Intron 5A>G39/9640.625Not translated
14rs55746649458017Intron 6G>A1/961.042Not translated
15rs2839951379936Intron 6T>A37/9439.362Not translated
16rs37436625379980Intron 6T>C1/941.064Not translated
17rs375858080160Exon 7C>TCYP2C19*2A37/9439.362Val330a
18rs375858180161Exon 7A>G93/9498.936Ile331Valb
19rs491762387106Intron 7T>C79/9682.292Not translated
20rs1788652287313Exon 8A>CCYP2C19*3A12/9612.500Gly417a
2187331Exon 8C>ANovel 32/962.083Asn423Lysb
22rs1788257287594Intron 8G>T13/9612.500Not translated
23rs1788505287620Intron 8A>T22/9622.917Not translated
24rs1226802089909Intron 8C>T3/963.125Not translated
25/903023′-UTRC>T1/961.042Not translated
26/903253′-UTRC>T2/962.083Not translated
27rs185030154905813′-UTRT>C3/963.125Not translated

Synonymous mutations.

Non-synonymous mutations. UTR, untranslated region; SNP, single nucleotide polymorphism.

Allele and genotype frequency

A total of five CYP2C19 alleles were detected in the Tibetan study population (Table III). The CYP2C19*1A allele had the highest frequency (50%), followed by the CYP2C19*1B allele (28.13%) and the CYP2C19*2A allele (15.10%). The other two identified alleles, CYP2C19*3A and *17, were relatively rare with frequencies of 5.21% and 1.56%, respectively. These results indicate that alleles that do not affect the function of CYP2C19 (CYP2C19*1A and *1B), are the most prevalent with a combined frequency of 68.13%, followed by alleles that inactivate enzyme function (CYP2C19*2A and *3A) with a combined frequency of 20.31%. The CYP2C19*17 allele, which may increase the activity of CYP2C19, had the lowest frequency of 1.56%.
Table III

Allele and genotype frequencies of CYP2C19 in the Tibetan study population.

A, Allele frequencies
CYP2C19Total (n=96)PhenotypeFrequency (%)
*1A96Normal50
*1B54Normal28.13
*2A29None15.10
*3A10None5.21
*173Increased1.56

CYP2C19, cytochrome P450 2C19.

Four CYP2C19 genotypes were identified, with frequencies ranging from 3.13 to 56.25% in the Tibetan population under study (Table III). Of the identified genotypes, one exhibits normal enzymatic activity, two exhibit reduced enzymatic activity and one exhibits increased enzymatic activity. The CYP2C19 allele frequencies were further compared with previously published data from different countries and ethnic groups in Eastern Asia (16–19), Southern Asia (20), Europe (21–25) and Africa (26–28) (Table IV). The results of the present study demonstrated that the frequency of the wild-type allele, CYP2C19*1, in the Tibetan group was significantly lower than in Caucasian populations (P<0.05), however was highest in Asian populations. Furthermore, the frequencies of CYP2C19*2 and CYP2C19*3 were significantly higher (P<0.05) among those of Tibetan descent compared with Caucasian and African populations.
Table IV

CYP2C19 allele frequencies in different populations.

PopulationnAllele frequency (%)
Ref.
CYP2C19*1CYP2C19*2CYP2C19*3CYP2C19*4CYP2C19*17
Asian subjects
 Tibetan9678.1315.105.21/1.56Present
 Chinese Han10067.5025.502.000.503.00(16)
 Chinese Dai19366.30a30.30b3.40//(17)
 Japanese14053.90b35.00b11.10//(18)
 Korean10367.0021.0012.00//(19)
 Vietnamese9062.00a24.0014.00a//(20)
 Thai12159.90b35.10b5.00//(20)
Caucasian subjects
 Swedish17576.6023.100.30b//(21)
 Russian29088.30a11.400.30b//(22)
 Italian36088.90b11.100.00b//(23)
 Bolivian77892.10b7.80a0.10b//(24)
 Faroese31297.10b2.90b0.00b//(25)
African subjects
 Tanzanian25181.5017.900.60b//(26)
 Ethiopian11484.0014.002.00//(27)
 Zimbabwean8486.9013.100.00a//(28)

P<0.01, compared with the data of the present study;

P<0.05, compared with the data of the present study. / indicates synonymous SNP mutations that have no effects on protein sequences. CYP2C19, cytochrome P450 2C19.

LD analysis

LD analysis was performed using Haploview with confidence intervals to define LD blocks (Fig. 1). The LD was determined for CYP2C19 using those SNPs whose minor allele frequencies were >0.05, as SNPs with low frequency have little power to detect LD. The deviation from the expected (D') was calculated, in addition to the correlation of alleles at two loci (r2) and the LD statistic for all possible pairs of SNPs. Two LD blocks across CYP2C19 were identified. Block 1, the larger of the two blocks, spans a 61 kb region from nucleotide 19154 (rs4244285) in the promoter region to nucleotide 80160 (rs3758580). Block 2 includes five tightly clustered SNPs (rs4917623, rs17886522, 2C19_87331, rs17882572 and rs17885052), each with a D' value equal to 1 (indicating complete LD).
Figure 1

LD analysis of cytochrome P450, family 2, subfamily C, polypeptide 19. LD is presented with standard color schemes, bright red for very strong LD (LOD>2, D'=1), pink-red and blue for intermediate LD (LOD>2, D'<1 and LOD<2, D'=1, respectively) and white for no LD (LOD<2, D<1). Block 1 spans a 61 kb region from the nucleotide 19154 (rs4244285) in the promoter region to nucleotide 80160 (rs3758580). Block 2 includes five tightly clustered SNPs (rs4917623, rs17886522, 2C19_87331, rs17882572 and rs17885052), each with a D' value equal to 1 (indicating complete LD). LD, linkage disequilibrium, LOD, logarithm (base 10) of odds.

Protein function prediction

Three novel CYP2C19 variants were identified with only one of these being a non-synonymous mutation. SIFT was used to predict the effect of mutations on CYPC219 function, with the Ala423Lys substitution predicted to affect protein function with a score of 0.01 (results are divided into four levels: Intolerant, 0.00–0.05; potentially intolerant, 0.051–0.10; borderline, 0.101–0.2; tolerant, 0.201–1.00). By contrast, PolyPhen-2 analysis predicted that this mutation is benign with a score of 0.005 (Fig. 2, the results here were divided into five levels: Benign, 0.000–0.999; borderline, 1.000–1.249; potentially damaging, 1.250–1.499; possibly damaging, 1.500–1.999; probably damaging, >2.000; and when the closer the score is to zero, the less damage is predicted).
Figure 2

PolyPhen-2 prediction of functional alterations resulting from an amino acid mutation at position 423.

Discussion

The polymorphic isoenzyme CYP2C19 is responsible for the metabolism of various important therapeutic agents and CYP2C19 polymorphisms result in inter-individual and inter-ethnic variation in the break-down of multiple therapeutic agents (29). To the best of our knowledge, the present study is the first to systematically screen a group of Tibetan individuals for CYP2C19 variants by direct sequencing and compare these results with ethnic populations from different continents. The present study observed 27 genetic variants, including three novel polymorphisms, five alleles and four genotypes. Only one of the novel genetic variants, within exon eight, was a non-synonymous mutation. The frequency of the wild-type CYP2C19 allele (CYP2C19*1) in the Tibetan study population was notably lower than in Caucasian populations, which was consistent with findings in a previous study on the Chinese Han population (30). A previous study has demonstrated that CYP2C19*2 and CYP2C19*3 are null alleles, which result in the total absence of enzyme activity and these two alleles account for >99% of oriental PMs and ~87% of Caucasian PMs (31). The occurrence of CYP2C19*3 in the Tibetan subjects in the present study was significantly higher (P<0.01) than the frequency reported for Caucasian and African populations. These results suggest that the toxicological or pharmacological properties of medications that are metabolized by CYP2C19 are likely to differ among Tibetans, other Asians, Caucasian and African populations. CYP2C19*17 is within the promoter region of CYP2C19 and this mutation is frequently reported in oriental races (16,30,32). Amongst the Tibetan study population CYP2C19*17 had a frequency of 1.56%, which is not significantly different compared with a previous study on the Chinese Han population (30). Various clinically important therapeutic agents are substrates for CYP2C19, as outlined earlier. As different mutant alleles are associated with different phenotypes and enzyme activities, CYP2C19 genotypic and phenotypic analysis may be used to optimize dosages, improve treatment efficacy and optimize the cost effectiveness of certain treatments (33). Clopidogrel is an inactive prodrug that requires hepatic bioactivation via CYP2C19 to exert its effects (34). This process is impaired in PMs, such as individuals with the CYP2C19*2 allele and, consequently, the production of the active metabolite in these individuals is reduced (35). The frequency value of CYP2C19*2 in the present Tibetan study population was between that of the other Asian groups and Caucasians, thus, it may be recommended that the dosage of clopidogrel should also lie between those used for the two populations. An analysis of novel genetic variants in the coding region demonstrated only one non-synonymous mutation, which results in an amino acid change from asparagine to lysine. The results of the protein function analysis were determined to be intolerant and benign by SIFT and PolyPhen-2, respectively. The prediction accuracy of SIFT and PolyPhen-2 is 63 and 75%, while the false positive rate is 19 and 9%, respectively (14,36). The novel genetic variants identified in the present study should be further elucidated by other means in future studies. In conclusion, results from the present study provide a basic profile of CYP2C19 in the Tibetan population, and may be used to determine optimal dosage recommendations, leading to individualized medicine.
  34 in total

Review 1.  Pharmacogenetics and adverse drug reactions.

Authors:  U A Meyer
Journal:  Lancet       Date:  2000-11-11       Impact factor: 79.321

Review 2.  The influence of CYP2C19 genetic polymorphism on the pharmacokinetics/- pharmacodynamics of proton pump inhibitor-containing Helicobacter pylori treatments.

Authors:  Dolores Serrano; Susana Torrado; Santiago Torrado-Santiago; Javier P Gisbert
Journal:  Curr Drug Metab       Date:  2012-11       Impact factor: 3.731

Review 3.  Impact of cytochrome P450 2C19 polymorphisms on citalopram/escitalopram exposure: a systematic review and meta-analysis.

Authors:  Ming Chang; Gunnel Tybring; Marja-Liisa Dahl; Jonatan D Lindh
Journal:  Clin Pharmacokinet       Date:  2014-09       Impact factor: 6.447

4.  Reduced-function CYP2C19 genotype and risk of adverse clinical outcomes among patients treated with clopidogrel predominantly for PCI: a meta-analysis.

Authors:  Jessica L Mega; Tabassome Simon; Jean-Philippe Collet; Jeffrey L Anderson; Elliott M Antman; Kevin Bliden; Christopher P Cannon; Nicolas Danchin; Betti Giusti; Paul Gurbel; Benjamin D Horne; Jean-Sebastian Hulot; Adnan Kastrati; Gilles Montalescot; Franz-Josef Neumann; Lei Shen; Dirk Sibbing; P Gabriel Steg; Dietmar Trenk; Stephen D Wiviott; Marc S Sabatine
Journal:  JAMA       Date:  2010-10-27       Impact factor: 56.272

5.  Genetic polymorphism analysis of CYP2C19 in Chinese Han populations from different geographic areas of mainland China.

Authors:  Lingling Chen; Shengying Qin; Jing Xie; Jimin Tang; Lun Yang; Wen Shen; Xinzhi Zhao; Jing Du; Guang He; Guoyin Feng; Lin He; Qinghe Xing
Journal:  Pharmacogenomics       Date:  2008-06       Impact factor: 2.533

6.  Distribution of CYP2C19*17 allele and genotypes in an Indian population.

Authors:  D Anichavezhi; U S Chakradhara Rao; D G Shewade; R Krishnamoorthy; C Adithan
Journal:  J Clin Pharm Ther       Date:  2011-09-15       Impact factor: 2.512

7.  The relation between CYP2C19 genotype and phenotype in stented patients on maintenance dual antiplatelet therapy.

Authors:  Paul A Gurbel; Alan R Shuldiner; Kevin P Bliden; Kathaleen Ryan; Ruth E Pakyz; Udaya S Tantry
Journal:  Am Heart J       Date:  2011-03       Impact factor: 4.749

8.  Drug-induced liver graft toxicity caused by cytochrome P450 poor metabolism.

Authors:  László Kóbori; Krisztina Kõhalmy; Pálma Porrogi; Enikõ Sárváry; Zsuzsa Gerlei; János Fazakas; Péter Nagy; Jenõ Járay; Katalin Monostory
Journal:  Br J Clin Pharmacol       Date:  2007-12-07       Impact factor: 4.335

9.  Genetic polymorphism, linkage disequilibrium, haplotype structure and novel allele analysis of CYP2C19 and CYP2D6 in Han Chinese.

Authors:  Q Zhou; X M Yu; H B Lin; L Wang; Q Z Yun; S N Hu; D-M Wang
Journal:  Pharmacogenomics J       Date:  2009-07-28       Impact factor: 3.550

10.  Cytochrome P450 2C19 polymorphism in young patients treated with clopidogrel after myocardial infarction: a cohort study.

Authors:  Jean-Philippe Collet; Jean-Sébastien Hulot; Anna Pena; Eric Villard; Jean-Baptiste Esteve; Johanne Silvain; Laurent Payot; Delphine Brugier; Guillaume Cayla; Farzin Beygui; Gilbert Bensimon; Christian Funck-Brentano; Gilles Montalescot
Journal:  Lancet       Date:  2008-12-26       Impact factor: 79.321

View more
  6 in total

1.  Effects of CYP2C19 variants on the metabolism of tapentadol in vitro.

Authors:  Ren-Ai Xu; Ping Fang; Zhize Ye; Mingming Han; Jian-Ping Cai; Guo-Xin Hu
Journal:  Iran J Basic Med Sci       Date:  2022-05       Impact factor: 2.532

2.  Polymorphisms of drug-metabolizing enzyme CYP2E1 in Chinese Uygur population.

Authors:  Linhao Zhu; Yongjun He; Fanglin Niu; Mengdan Yan; Jing Li; Dongya Yuan; Tianbo Jin
Journal:  Medicine (Baltimore)       Date:  2018-02       Impact factor: 1.817

3.  A double-Flp-in method for stable overexpression of two genes.

Authors:  Ole Jensen; Salim Ansari; Lukas Gebauer; Simon F Müller; Kira A A T Lowjaga; Joachim Geyer; Mladen V Tzvetkov; Jürgen Brockmöller
Journal:  Sci Rep       Date:  2020-08-20       Impact factor: 4.379

4.  Genetic analysis of pharmacogenomic VIP variants in the Blang population from Yunnan Province of China.

Authors:  Chan Zhang; Weiwei Guo; Yujing Cheng; Qi Li; Xin Yang; Run Dai; Linhao Zhu; Wanlu Chen
Journal:  Mol Genet Genomic Med       Date:  2019-04-05       Impact factor: 2.183

5.  CYP2C19 Allele Frequencies in Over 2.2 Million Direct-to-Consumer Genetics Research Participants and the Potential Implication for Prescriptions in a Large Health System.

Authors:  Yelena Ionova; James Ashenhurst; Jianan Zhan; Hoang Nhan; Cindy Kosinski; Bani Tamraz; Alison Chubb
Journal:  Clin Transl Sci       Date:  2020-07-21       Impact factor: 4.689

6.  Genetic polymorphism analysis of cytochrome P4502E1 (CYP2E1) in a Chinese Tibetan population.

Authors:  Li Wang; Guoxia Ren; Jingjie Li; Linhao Zhu; Fanglin Niu; Mengdan Yan; Jing Li; Dongya Yuan; Tianbo Jin
Journal:  Medicine (Baltimore)       Date:  2017-11       Impact factor: 1.817

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.