Literature DB >> 26675943

Vitamin D/VDR signaling attenuates lipopolysaccharide‑induced acute lung injury by maintaining the integrity of the pulmonary epithelial barrier.

Yong-Yan Shi1, Tian-Jing Liu2, Jian-Hua Fu1, Wei Xu1, Lin-Lin Wu1, A-Na Hou1, Xin-Dong Xue1.   

Abstract

Vitamin D and its receptor have a protective effect on epithelial barriers in various tissues. Low levels of vitamin D are associated with numerous pulmonary diseases, including acute lung injury (ALI) and acute respiratory distress syndrome. The present study investigated whether the vitamin D/vitamin D receptor (VDR) pathway may ameliorate lipopolysaccharide (LPS)‑induced ALI through maintaining the integrity of the alveolar epithelial barrier. This was investigated by exposing wild‑type (WT) and VDR knockout C57BL/6J mice to LPS, then comparing the healthy and LPS‑treated mice lungs and bronchoalveolar lavage fluid (BALF). More specifically, lung histology, mRNA levels of proinflammatory cytokines and chemokines, and protein expression levels of tight junction proteins were determined. In addition, a vitamin D analog (paricalcitol) was administered to WT mice in order to investigate the effect of vitamin D on the alveolar epithelial barrier following exposure to LPS. VDR knockout mice exhibited severe lung injuries (P<0.001), increased alveolar permeability [demonstrated by a higher wet‑dry ratio of lung weight (P<0.05), greater expression levels of BALF protein (P<0.001) and fluorescein isothiocyanate‑conjugated 4 kDa dextran (P<0.001) leakage into the alveolar space], elevated proinflammatory cytokine and chemokine mRNA levels, as demonstrated by reverse transcription‑quantitative polymerase chain reaction (P<0.05), and decreased protein and mRNA expression levels of occludin (P<0.01) and zonula occludens‑1 (ZO‑1; P<0.01) compared with WT mice. Paricalcitol treatment partially inhibited these pathological changes in WT mice by maintaining the mRNA and protein expression levels of occludin (P<0.01) and ZO‑1 (P<0.05). A lack of VDRs in the pulmonary epithelial barrier appeared to compromise its defense, leading to more severe LPS‑induced lung injury. Furthermore, vitamin D treatment alleviated LPS‑induced lung injury and preserved alveolar barrier function. Therefore vitamin D treatment may present as a potential therapeutic strategy in ALI and acute respiratory distress syndrome.

Entities:  

Mesh:

Substances:

Year:  2015        PMID: 26675943      PMCID: PMC4732862          DOI: 10.3892/mmr.2015.4685

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Acute lung injury (ALI) and its more severe form, acute respiratory distress syndrome (ARDS), contribute to morbidity and mortality in critically ill patients, with rates of morbidity and mortality of 75/100,000 and 40–60%, respectively (1,2). In particular, gram-negative sepsis often leads to ALI/ARDS (3). ALI/ARDS are characterized by an extensive inflammatory process leading to diffuse alveolar damage, an influx of neutrophils, activation of proinflammatory cytokines and chemokines, macrophages and protein-rich exudate in the alveolar space due to the disruption of the alveolar epithelial barrier (1,2). The active form of vitamin D, termed calcitriol or 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3], binds to the vitamin D receptor (VDR), a member of the nuclear hormone receptor superfamily (4). In addition to regulating calcium, vitamin D acts as a regulator of multiple biological processes, including anti-inflammation, immunomodulation and barrier function maintenance (5). Furthermore, it has been suggested that the production of 1,25-(OH)2D3 is evidence of a local paracrine/autocrine action in various tissues (6), including pulmonary epithelial cells (7). There is growing evidence in support of associations between vitamin D deficiency, and impaired pulmonary function (8), an increased incidence of ALI/ARDS (9–12) and inflammatory diseases, including asthma (13), tuberculosis (14) and chronic obstructive pulmonary disease (COPD) (8,15). Previous studies have suggested that vitamin D deficiency is also common in critically ill patients (9,10), and is often associated with increased morbidity and mortality, including that caused by ALI/ARDS (9–12,16,17). However, the underlying mechanism of vitamin D/VDR signaling and sepsis-induced ALI/ARDS has yet to be investigated. Vitamin D/VDR signaling is important for the integrity of tissue barriers and anti-inflammatory functions (5,6). It has been demonstrated to regulate the components of tight junctions and maintain the integrity of epithelial barriers in multiple organs, including the skin (18), eyes (19) and large intestine (20). In lungs, the permeability of the alveolar epithelial barrier is largely regulated by the intercellular junctions that seal the paracellular space (21,22). Disruption of the epithelial barrier may increase alveolar permeability and result in paracellular movements of fluid from the interstitium to the pulmonary airspace, as well as infiltration of inflammatory cells. Subsequent pulmonary edema impairs blood-gas exchange, leading to ARDS. Preserving or restoring these barriers may provide a therapeutic strategy for preventing or treating ALI/ARDS (23,24). However, to the best of our knowledge, there has been no previous investigation regarding vitamin D/VDR signaling regulation of the alveolar epithelial barrier in the lungs. The aim of the present study was to investigate the effect of VDR knockout on lipopolysaccharide (LPS)-induced ALI and to assess the effect of vitamin D treatment on LPS-induced ALI in a mouse model. The results suggested that mice lacking VDR had a compromised alveolar epithelial barrier and aggravated ALI. Furthermore, it was identified that vitamin D treatment may sustain the integrity of the barrier and thus attenuate ALI.

Materials and methods

Ethics statement

All experimental procedures were reviewed and approved by the Institutional Ethics Committee of China Medical University (Shenyang, China).

Animals

VDR heterozygous (VDR+/−) mice with a C57BL/6J background (6 weeks old) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). VDR heterozygous males and females were bred to generate wild-type (WT; VDR+/+) and VDR knockout (KO; VDR−/−) mice for the experiment. All mice were kept in pathogen-free cages with a 12-h light/dark cycle, and fed a rescue diet high in calcium, phosphate and lactose (Envigo; Madison, WI, USA) to maintain a normal plasma calcium level in VDR KO mice (25).

Genotyping

Total DNA was harvested from the mouse tails and primers were provided by The Jackson Laboratory. Polymerase chain reaction (PCR) was performed as follows: Pre-denaturation at 94°C for 5 min; followed by 35 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 40 sec, 72°C for 10 min, and held at 4°C until electrophoresis. Agarose gel electrophoresis was performed with 2% agarose (in TAE buffer; Beyotime Institute of Biotechnology) at 100 V until the bands were clearly separated.

Treatment groups

Two mice (age, 8–12 weeks) per gender were selected for each treatment group. LPS [Lipopolysaccharides from Escherichia coli 0111:B4, dissolved in phosphate-buffered saline (PBS)] from Sigma-Aldrich (St. Louis, MO, USA) was injected once intratracheally (10 mg/kg) in WT and KO mice. The control group was comprised of KO and WT mice injected with the same volume of sterile PBS. Bronchoalveolar lavage fluid (BALF) was collected. Briefly, following anesthesia by intraperitoneal injection with a cocktail of xylazine (Rompun 2%; Bayer AG, Leverkusen, Germany) and ketamine (Ketavest; 100 mg/ml; Pfizer, Inc., New York, NY, USA), the trachea was exposed and the lungs were lavaged three times with 0.2 ml sterile saline per wash. The BALF was stored at 4°C and samples of lung tissue were harvested for RNA, protein and histological studies 12 h after treatment, and refrigerated at −80°C. WT mice were randomly divided into four treatment groups. Two vitamin D treatment groups (one PBS group and one LPS group) were treated with the vitamin D analog paricalcitol (Sigma-Aldrich) dissolved in propylene (glycol:ethanol, 90:10; 0.5 µg/kg body weight) through intra-peritoneal injection 30 min prior to LPS or PBS treatment. The two vehicle groups received the dissolvent only prior to LPS or PBS treatment.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from the lung tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). First-strand cDNAs were synthesized using a PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China) and PCR was performed with the 20-µl volume reaction mixture using a SYBR-Green PCR reagent kit (Clontech Laboratories, Inc., Mountainview, CA, USA) on a LightCycler 480 Real-Time PCR system (Roche Diagnostics, Basel, Switzerland). The cycling conditions were as follows: 50°C for 2 min and 95°C for 2 min, followed by 40 cycles of: 95°C for 15 sec, 55°C for 15 sec, 72°C for 1 min and 72°C for 1 min. Relative transcripts of mRNA were calculated using the quantification cycle (Cq) 2−ΔΔCq formula (26). β-2 micro-globulin served as an internal control. Sequences of the PCR primers are provided in Table I.
Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Primer nameForward (5′→3′)Reverse (5′→3′)
Mouse TNF-αATGAGCACAGAAAGCATGAAGTAGACAGAAGAGCGTGGT
Mouse IL-6CCTCTGGTCTTCTGGAGTACCACTCCTTCTGTGACTCCAGC
Mouse IL-1βAATGAAAGACGGCACACCCATGCTTGTGAGGTGCTGATGT
Mouse IFN-γTTCTTCAGCAACAGCAAGGCTCAGCAGCGACTCCTTTTCC
Mouse MCP-1GCTCAGCCAGATGCAGTTAATCTTGAGCTTGGTGACAAAAACT
Mouse MIP-2TGAACTGCGCTGTCAATGCGCTTCAGGGTCAAGGCAAAC
Mouse occludinCTACGGAGGTGGCTATGGAGAGCGCTGACTATGATCACGA
Mouse ZO-1ACGATCTCCTGACCAACGTTGCTTTGGGTGGATGATCGTC
Mouse B2MCGGCCTGTATGCTATCCAGAGGGTGAATTCAGTGTGAGCC

TNF-α, tumor necrosis factor; IL-6, interleukin; IL-1β, interleukin β, IFN-γ, interferon; MCP-1, monocyte chemoattractant protein; MIP-2, macrophage inflammatory protein; ZO-1, zonula occludens-1; B2M, β2 microglobulin.

Western blot analysis

Following anesthesia, the chests of the mice were opened and the lung was harvested and homogenized in RIPA buffer (Beyotime Institute of Biotechnology, Haimen, China). The supernatant was used to measure protein concentration according to the BCA method (Biorad Laboratories, Inc., Hercules, CA, USA). SDS (3X) was subsequently added and the mixture was heated to 95°C for 5 mins. The proteins (50 µg per lane) were electrophoresed on 10% SDS-PAGE (80 V for 30 min in condensed gel and 120 V for 90 min in dissociated gel), separated by 10% SDS-PAGE gels and electroblotted onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA) at 90 V for 90 min. The density of the bands were quantitated using ImageJ software (version 1.47; National Institutes of Health, Bethesda, MD, USA) and normalized to that of β-actin. The following primary antibodies were used: Polyclonal, anti-rabbit VDR (cat. no. C20; 1:1,000 dilution; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), monoclonal, anti-mouse β-actin (cat. no. A5316; 1:10,000 dilution; Sigma-Aldrich), monoclonal, anti-mouse zonula occludens-1 (ZO-1; cat. no. 339100; 1:2,000 dilution; Cell Signaling Technology, Inc., Danvers MA, USA) and monoclonal, anti-mouse occludin (cat. no. 331500; 1:2,000 dilution; Cell Signaling Technology, Inc.). The PVDF membranes were incubated at room temperature for 1 h in 5% Tris-buffered saline and Tween-20 (TBST) with non-fat milk to block non-specific binding, then incubated overnight at 4°C with the primary antibodies. After washing three times in 0.1% TBST, the membranes were incubated at room temperature for 60 min with horseradish peroxidase-conjugated secondary antibodies (goat anti-rabbit and anti-mouse IgG-HRP; cat. nos. sc-2004 and sc-2005, respectively; 1:2,000 dilution; Santa Cruz Biotechnology, Inc.). The membrane was then washed three times in 0.1% TBST.

Histology and immunofluorescence

The mice lungs were harvested and the right lung was placed in 4% formalin overnight, dehydrated with graded alcohol, placed in xylene for 1 h and then embedded in paraffin at 60°C. Sections of the lung tissues (4 µm) were stained with hematoxylin and eosin (H&E; Beyotime Institute of Biotechnology) at room temperature. The lung morphology resulting from the different treatments was scored according to H&E stained slides using a novel acute lung injury scoring system (27). A total of five random fields were selected and the evaluation was completed by two pathologists blinded to the study design. To localize the expression of tight junction proteins, sections were incubated with the anti-ZO-1 (1:200 dilution) or anti-occludin (1:200 dilution) antibodies, and were subsequently conjugated with Alexa Fluor 555 or 488 secondary antibodies (Invitrogen; Thermo Fisher Scientific, Inc.). Antigens were visualized using a Leica DFC425 fluorescence microscope [Leica Microsystems (Schweiz) AG, Heerbrugg, Switzerland].

Assessment of lung injury

The wet-dry ratio of lung weight was measured, as previously described (21). Briefly, the left lung was excised and the wet weight was measured using a Genimi-20 Portable Milligram Scale (American Weigh Scales, Inc., Norcross, GA, USA), the lung was then dried in an oven at 85°C for 72 h and weighed dry. The wet-dry ratio was calculated as follows: Wet lung weight/dry lung weight. The BALF protein concentration was determined using a DC Protein Assay kit (Bio-Rad Laboratories, Inc.), according to the manufacturer's protocol. Myeloperoxidase (MPO) activity was analyzed using a Myeloperoxidase Activity Assay kit, according to the manufacturer's protocol (CytoStore, Inc., Alberta, Canada) and an M200 microplate system (Tecan Group Ltd., Männedorf, Switzerland) was used to measure the optical density. In addition, the BALF to serum fluorescence ratio of fluorescein isothiocyanate-conjugated 4 kDa dextran (FD4; Sigma-Aldrich) was calculated to evaluate the pulmonary permeability, as previously described (21).

Statistical analysis

All continuous data are presented as the mean ± standard deviation. Statistical comparison of continuous variables between groups was performed using Student's t-test or one-way analysis of variance with GraphPad Prism (version 6.0; GraphPad Software, Inc., La Jolla, CA, USA) and Statistical Product and Service Solutions (version 17.0; SPSS, Inc., Chicago, IL, USA). P<0.05 indicated a statistically significant difference.

Results

VDR KO mice exhibit more severe LPS-induced ALI than VDR WT mice

VDR WT and KO mice were bred and genotyped according to the protocol of The Jackson Laboratories. Genotype and VDR expression were confirmed using the lung lysates (Fig. 1A and B). The lungs of VDR KO mice appeared more injured and congested following LPS treatment compared with VDR WT mice (Fig. 1C). VDR KO mice also exhibited more severe interstitial edema, alveolar wall thickening and inflammatory cells infiltration compared with WT mice (Fig. 1D). Furthermore, ALI scores of VDR KO mice were significantly higher than VDR WT mice following LPS treatment (P<0.001; Fig. 1E).
Figure 1

VDR KO mice exhibit more severe acute lung injury (ALI) than CDR WT mice after LPS treatment. (A) Mouse genotyping of VDR [WT(+), KO(−)]. (B) Western blotting of lung lysates from WT (VDR+/+), heterozygous (VDR+/−) and KO (VDR−/−) mice with anti-VDR antibody. Following exposure to LPS or PBS, the (C) morphology and (D) histology of lung tissue sections from WT and VDR KO mice were investigated. Hematoxylin and eosin stain; magnification, x200. (E) ALI scores according to microscopic examination for the two mouse models. Data are presented as mean ± standard deviation (n=5). #P>0.05, ***P<0.001. KO, knockout; WT, wild-type; VDR, vitamin D receptor; PBS, phosphate buffered saline; LPS, lipopolysaccharides.

In mice lacking VDR, pulmonary permeability was increased and MPO activity was higher. More specifically, a significantly higher wet-dry lung ratio was observed (P<0.05; Fig. 2A) in VDR KO mice subsequent to LPS exposure compared with WT mice, indicating that more fluid was retained in the VDR KO lung. VDR KO mice were also identified to have higher expression levels of BALF protein (Fig. 2B; P<0.001), and greater FD4 leakage from the lung interstitium or capillaries into the alveolar space (Fig. 2C; P<0.001) compared with VDR WT mice. Furthermore, exposure to LPS induced significantly higher MPO activity in the lungs of VDR KO mice compared with VDR WT mice (P<0.001; Fig. 2D).
Figure 2

VDR KO mice exhibit greater pulmonary edema than VDR WT mice. WT and KO mice were treated with PBS or LPS intratracheally. Lung samples were harvested and analyzed 12 h later. (A) Wet-dry ratio of lung weight, (B) BALF protein concentration, (C) BALF to serum FD4 ratio and (D) MPO activity of lung lysates of different mice. Data are presented as mean ± standard deviation. #P>0.05, *P<0.05, ***P<0.001. (n=5–6 per group). WT, wild-type; PBS, phosphate-buffered saline; KO, knockout; LPS, lipopolysaccharides; FD4, fluorescein isothiocyanate-conjugated 4 kDa dextran; MPO, myeloperoxidase.

VDR KO leads to severe lung inflammation

To further investigate the anti-inflammatory effect of VDR in lungs, the levels of proinflammatory cytokines and chemokines were determined. RT-qPCR indicated that the mRNA expression levels of proinflammatory cytokines and chemokines were significantly higher in VDR KO mice compared with VDR WT mice following LPS treatment (Fig. 3).
Figure 3

Quantified mRNA expression of proinflammatory cytokines and chemokines is higher in KO compared with WT mice following LPS or PBS treatment. Data are presented as mean value ± standard deviation. #P>0.05, *P<0.05, **P<0.01, ***P<0.001 (n=6). WT, wild-type; PBS, phosphate-buffered saline; KO, knockout; LPS, lipopolysaccharides; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; MCP-1, monocyte chemotactic protein-1; IFNγ, interferon γ; MIP-2, macrophage inflammatory protein-2; IL-1β, interleukin-1β.

VDR KO decreases the expression of pulmonary epithelial tight junction proteins, occludin and ZO-1

Following exposure to LPS, mRNA (Fig. 4A) and protein (Fig. 4B) expression levels of occludin and ZO-1 were significantly lower in VDR KO mice compared with VDR WT mice (P<0.01). Furthermore, LPS treatment resulted in lower levels of expression of occludin (Fig. 4C) and ZO-1 (Fig. 4D) in the alveolar epithelial cells of all mice treated with LPS, with VDR KO mice demonstrating a more severely disrupted expression pattern than VDR WT mice. Therefore, the lack of VDR may compromise the function of the pulmonary barrier by decreasing the expression of occludin and ZO-1.
Figure 4

KO mice exhibit reduced occludin and ZO-1 expression following LPS treatment. (A) Quantification of occludin and ZO-1 mRNA expression in WT and KO mice following LPS or PBS treatment. (B) Western blots and quantification of ZO-1 and occludin protein levels in lung lysates. (C) Occludin (red, occludin and Alexa Fluor 488; blue, DAPI) and (D) ZO-1 (blue, DAPI; green, ZO-1 and Alexa Fluor 488) immunofluorescence staining. Data are presented as the mean ± standard deviation #P>0.05, **P<0.01, ***P<0.001 (n=5–6 per group). WT, wild-type; PBS, phosphate-buffered saline; KO, knockout; LPS, lipopolysaccharides; ZO-1, zonula occludens-1.

Vitamin D analog treatment alleviates LPS-induced ALI by preserving occludin and ZO-1 expression

Histological examination of LPS-exposed vehicle mice revealed a considerable infiltration of inflammatory cells and thickening of the alveolar wall. However, in mice treated with vitamin D analog prior to LPS exposure, pulmonary inflammation and the thickening of the alveolar wall was less apparent (Fig. 5A). This was accompanied by a significantly decreased ALI score in the vitamin D pretreated mice compared with the vehicle treated mice (P<0.001; Fig. 5B). MPO activity was also significantly lower in VD mice (P<0.05; Fig. 5C). The induction of proinflammatory cytokine and chemokine expression was significantly suppressed by vitamin D treatment (Fig. 6A and B). Furthermore, animals pretreated with vitamin D experienced significantly less severe pulmonary edema (P<0.05; Fig. 6C) and lower levels of BALF protein debris entering the alveolar space (P<0.01; Fig. 6D) compared with VE mice. Vitamin D pretreated mice exhibited significantly higher mRNA (Fig. 7A) and protein (Fig. 7B) expression levels of occludin and ZO-1 compared with vehicle treated mice. This may be due to VDR decreasing the permeability of the pulmonary epithelial barrier, thus limiting the pathological changes that occur during ALI.
Figure 5

VD attenuates LPS-induced acute lung injury (ALI). (A) Representative hematoxylin and eosin staining of lung sections (magnification, x200). (B) ALI score and (C) MPO activity in wild-type and knockout mice treated with VD or VE. Data are represented as mean ± standard deviation. #P>0.05, *P<0.05, ***P<0.001 (n=5–6 per group). PBS, phosphate-buffered saline; LPS, lipopolysaccharides; VE, vehicle; VD, vitamin D (paricalcitol); MPO, myeloperoxidase; OD, optical density.

Figure 6

Vitamin D treatment inhibits lung inflammation and alleviated pulmonary edema. (A) Reverse transcription-polymerase chain reaction quantitation of proinflammatory cytokines and chemokines. (B) Wet-dry ratio of lung weight. (C) BALF protein concentration. Data are presented as mean value ± standard deviation. #P>0.05, *P<0.05, **P<0.01, ***P<0.001, (n=4–6 per group). VE, vehicle; VD, vitamine D (paricalcitol); PBS, phosphate-buffered saline; LPS, lipopolysaccharides; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; MCP-1, monocyte chemotactic protein-1; IFN γ, interferon γ; MIP-2, macrophage inflammatory protein-2; IL-1β, interleukin-1β; BALF, bronchoalveolar lavage fluid.

Figure 7

Vitamin D treatment preserves occludin and ZO-1 expression. (A) Reverse transcription-polymerase chain reaction quantitation of occludin and ZO-1 mRNA levels. (B) Western blot and quantification of ZO-1 and occludin protein levels in lung lysates. Data are presented as the mean ± standard deviation. #P>0.05, *P<0.05, **P<0.01, ***P<0.001 (n=5–6 per group). VE, vehicle; VD, vitamin D (paricalcitol); LPS, lipopolysaccharides; ZO-1, zonula occludens-1.

Discussion

Vitamin D deficiency impairs lung function and has been associated with a number of lung diseases, including COPD, asthma, tuberculosis, ALI and its severe form, ARDS (8–17); however the underlying mechanisms of these associations remain unclear. The present study demonstrated that VDR null mice exhibit more severe LPS-induced ALI, primarily due to deterioration of the alveolar epithelial tight junctions through a decrease in occludin and ZO-1 expression. By contrast, vitamin D treatment alleviated lung injury through maintenance of the pulmonary barrier. To the best of our knowledge, this was the first study to investigate the protective function of the vitamin D/VDR signaling pathway on the pulmonary epithelial barrier. ARDS remains a major cause of morbidity and mortality in critically ill patients (1–3). It is characterized by the disruption of the endothelial and epithelial barriers of alveoli, leading to increased barrier permeability (1,2). The alveolar epithelial barrier consists of a monolayer of epithelial cells with intercellular junctions that seal the paracellular space and regulate barrier permeability (21,22). Preserving or restoring the barrier function of alveolar epithelial cells may be a novel treatment for sepsis-induced ARDS. Tight junction complexes are composed of integral membrane proteins, cytoplasmic plaque proteins and cytoskeletal proteins (28). Among these, occludin and ZO-1 are key components that regulate paracellular permeability. They are indispensible in alveolar epithelial barrier function and fluid clearance (21). Reduced or dysmorphic expression of occludin and ZO-1 may compromise the alveolar barrier function and result in increased alveolar permeability, thus impairing blood-gas exchange. In a previous study, hyperoxia was identified to disrupt the pulmonary epithelial barrier in newborn rats by decreasing occludin and ZO-1 levels (21). Therefore, disruption of the alveolar epithelial barrier is a critical factor in the pathogenesis of lung injuries and subsequent pathological changes; however, the molecular mechanisms that influence components of the tight junction remain poorly understood. The active form of vitamin D is 1,25-(OH)2D3, and is important in maintaining the structure and function of epithelial barriers in multiple tissues (18–20). The administration of 1,25-(OH)2D3 as part of a therapeutic regimen may revert proteinuria and inhibit glomerular podocytes injury, partially through improving the barrier function in the kidneys (29). VDR null mice are more susceptible to colonic injury induced by dextran sulfate sodium compared with WT mice, as the lack of VDR compromises the intestinal epithelial barrier structure (20). Thus, the vitamin D/VDR signaling pathway may be a target in the treatment of various inflammatory diseases through preserving or restoring epithelial barrier function. In the present study, VDR KO mice exhibited more severe ALI induced by LPS compared with WT mice. Furthermore, occludin and ZO-1 levels in VDR KO mice were lower compared with WT mice. This led to greater infiltration of inflammatory cells, release of proinflammatory cytokines and chemokines, and fluid retention. However, vitamin D treatment may partly reverse this pathological process. The present study indicates that vitamin D/VDR signaling may inhibit endotoxin-induced ALI through maintaining the integrity of pulmonary epithelial barrier. Neutrophil recruitment is important in the progression of ALI and ARDS (30). The infiltration of neutrophils may be evaluated through MPO activity. In the present study, VDR KO mice exposed to LPS exhibited higher MPO activity in the lung lysates compared with WT mice. When vitamin D pretreatment was applied, lower MPO activity was observed. In agreement with these results, a previous study used a hamster model of ALI to identify that 1,25-(OH)2D3 inhibits neutrophil recruitment by 40%, due to its inhibitory effect on interleukin-8 (IL-8) (30). The alveolar barrier limits neutrophil infiltration, thus the inhibitory effect of neutrophil recruitment by vitamin D/VDR signaling may be partly due to the maintenance of the integrity of the alveolar barrier. Furthermore, lung epithelial cells had been identified to express high baseline levels of 1α-hydroxylase, which activates vitamin D, and low levels of inactivating 24-hydroxylase (7). Active vitamin D generated by lung epithelial cells is important for innate immune functions (7). During sepsis, pro-inflammatory cytokines and chemokines are produced by activated alveolar macrophages in the air space. Tumor necrosis factor-α (TNF-α), IL-6 and IL-1β proteins are also important as they mediate, amplify and promote the process of lung inflammation (1). These cascades of immune responses result in various stages of alveolar epithelial injury (1). Furthermore, 1,25-(OH)2D3 may ameliorate seawater-aspiration induced ALI through the inhibition of nuclear factor-κB and the RhoA/Rho kinase signaling pathways (31). In addition, it may also alleviate lung damage secondary to ischemia reperfusion injury (32). The present study identified that LPS treatment increased the expression levels of the following cytokines and chemokines in WT mice: TNF-α, IL-6, IL-1β, interferon-γ, monocyte chemoattractant protein-1 and macrophage inflammatory protein-2. This effect was even more apparent in VDR KO mice, thus confirming that the VDR KO lung was markedly more inflamed than the WT lung. By contrast, vitamin D treatment substantially inhibited the build-up of chemokines and attenuated LPS-induced lung injury. Furthermore, the present study determined that active vitamin D was capable of triggering an anti-inflammatory defense and preserving the structural barrier in the lungs. In conclusion, the current study highlights that lack of VDR may compromise the pulmonary epithelial barrier defense, leading to a more severe LPS-induced lung injury. Furthermore, vitamin D treatment may preserve the alveolar barrier function and therefore alleviate LPS-induced lung injury. These observations provide further insight into the pathogenesis of ALI/ARDS and emphasize that vitamin D may be a novel treatment for ALI/ARDS.
  32 in total

Review 1.  The tight junction: a multifunctional complex.

Authors:  Eveline E Schneeberger; Robert D Lynch
Journal:  Am J Physiol Cell Physiol       Date:  2004-06       Impact factor: 4.249

2.  Vitamin D deficiency in critically ill patients.

Authors:  Paul Lee; John A Eisman; Jacqueline R Center
Journal:  N Engl J Med       Date:  2009-04-30       Impact factor: 91.245

3.  Transgenic Expression of Vitamin D Receptor in Gut Epithelial Cells Ameliorates Spontaneous Colitis Caused by Interleukin-10 Deficiency.

Authors:  Maya Aharoni Golan; Weicheng Liu; Yongyan Shi; Li Chen; Jiaolong Wang; Tianjing Liu; Yan Chun Li
Journal:  Dig Dis Sci       Date:  2015-04-18       Impact factor: 3.199

4.  Pretreatment of vitamin D3 ameliorates lung and muscle injury induced by reperfusion of bilateral femoral vessels in a rat model.

Authors:  Pin-Keng Shih; Yi-Ching Chen; Ya-Chun Huang; Yu-Tang Chang; Jian-Xun Chen; Chih-Mei Cheng
Journal:  J Surg Res       Date:  2010-03-31       Impact factor: 2.192

Review 5.  Future research directions in acute lung injury: summary of a National Heart, Lung, and Blood Institute working group.

Authors:  Michael A Matthay; Guy A Zimmerman; Charles Esmon; Jahar Bhattacharya; Barry Coller; Claire M Doerschuk; Joanna Floros; Michael A Gimbrone; Eric Hoffman; Rolf D Hubmayr; Mark Leppert; Sadis Matalon; Robert Munford; Polly Parsons; Arthur S Slutsky; Kevin J Tracey; Peter Ward; Dorothy B Gail; Andrea L Harabin
Journal:  Am J Respir Crit Care Med       Date:  2003-04-01       Impact factor: 21.405

6.  Influence of vitamin D deficiency and vitamin D receptor polymorphisms on tuberculosis among Gujarati Asians in west London: a case-control study.

Authors:  R J Wilkinson; M Llewelyn; Z Toossi; P Patel; G Pasvol; A Lalvani; D Wright; M Latif; R N Davidson
Journal:  Lancet       Date:  2000-02-19       Impact factor: 79.321

Review 7.  The alveolar-epithelial barrier: a target for potential therapy.

Authors:  G R Scott Budinger; Jacob I Sznajder
Journal:  Clin Chest Med       Date:  2006-12       Impact factor: 2.878

8.  Novel role of the vitamin D receptor in maintaining the integrity of the intestinal mucosal barrier.

Authors:  Juan Kong; Zhongyi Zhang; Mark W Musch; Gang Ning; Jun Sun; John Hart; Marc Bissonnette; Yan Chun Li
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2007-10-25       Impact factor: 4.052

9.  Hyperoxia disrupts pulmonary epithelial barrier in newborn rats via the deterioration of occludin and ZO-1.

Authors:  Kai You; Xuewen Xu; Jianhua Fu; Shuyan Xu; Xiaohong Yue; Zhiling Yu; Xindong Xue
Journal:  Respir Res       Date:  2012-05-04

10.  Vitamin D status and its association with season, hospital and sepsis mortality in critical illness.

Authors:  Karin Amrein; Paul Zajic; Christian Schnedl; Andreas Waltensdorfer; Sonja Fruhwald; Alexander Holl; Tadeja Purkart; Gerit Wünsch; Thomas Valentin; Andrea Grisold; Tatjana Stojakovic; Steven Amrein; Thomas R Pieber; Harald Dobnig
Journal:  Crit Care       Date:  2014-03-24       Impact factor: 9.097

View more
  43 in total

1.  Vitamin D Receptor Deletion Leads to the Destruction of Tight and Adherens Junctions in Lungs.

Authors:  Honglei Chen; Rong Lu; Yong-Guo Zhang; Jun Sun
Journal:  Tissue Barriers       Date:  2018-11-08

Review 2.  Ancient Nuclear Receptor VDR With New Functions: Microbiome and Inflammation.

Authors:  Danika Bakke; Jun Sun
Journal:  Inflamm Bowel Dis       Date:  2018-05-18       Impact factor: 5.325

3.  Vitamin D Receptor Gene Single Nucleotide Polymorphisms and Association With Vitamin D Levels and Endoscopic Disease Activity in Inflammatory Bowel Disease Patients: A Pilot Study.

Authors:  Anusha Shirwaikar Thomas; Zachary K Criss; Noah F Shroyer; Bincy P Abraham
Journal:  Inflamm Bowel Dis       Date:  2021-07-27       Impact factor: 5.325

4.  Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions.

Authors:  Milos Mihajlovic; Michele Fedecostante; Miriam J Oost; Sonja K P Steenhuis; Eef G W M Lentjes; Inge Maitimu-Smeele; Manoe J Janssen; Luuk B Hilbrands; Rosalinde Masereeuw
Journal:  Int J Mol Sci       Date:  2017-11-26       Impact factor: 5.923

5.  Vitamin D3 induces vitamin D receptor and HDAC11 binding to relieve the promoter of the tight junction proteins.

Authors:  Feng-Hua Liu; Shan-Shan Li; Xiao-Xi Li; Shuai Wang; Mao-Gang Li; Li Guan; Tian-Gang Luan; Zhi-Gang Liu; Zhan-Ju Liu; Ping-Chang Yang
Journal:  Oncotarget       Date:  2017-05-08

6.  Vitamin D Levels in COVID-19 Outpatients from Western Mexico: Clinical Correlation and Effect of Its Supplementation.

Authors:  Gabriela Athziri Sánchez-Zuno; Guillermo González-Estevez; Mónica Guadalupe Matuz-Flores; Gabriela Macedo-Ojeda; Jorge Hernández-Bello; Jesús Carlos Mora-Mora; Edsaúl Emilio Pérez-Guerrero; Mariel García-Chagollán; Natali Vega-Magaña; Francisco Javier Turrubiates-Hernández; Andrea Carolina Machado-Sulbaran; José Francisco Muñoz-Valle
Journal:  J Clin Med       Date:  2021-05-28       Impact factor: 4.241

7.  Calcifediol Treatment and Hospital Mortality Due to COVID-19: A Cohort Study.

Authors:  Juan F Alcala-Diaz; Laura Limia-Perez; Ricardo Gomez-Huelgas; Maria D Martin-Escalante; Begoña Cortes-Rodriguez; Jose L Zambrana-Garcia; Marta Entrenas-Castillo; Ana I Perez-Caballero; Maria D López-Carmona; Javier Garcia-Alegria; Aquiles Lozano Rodríguez-Mancheño; Maria Del Sol Arenas-de Larriva; Luis M Pérez-Belmonte; Irwin Jungreis; Roger Bouillon; Jose Manual Quesada-Gomez; Jose Lopez-Miranda
Journal:  Nutrients       Date:  2021-05-21       Impact factor: 5.717

Review 8.  Vitamin D Axis in Inflammatory Bowel Diseases: Role, Current Uses and Future Perspectives.

Authors:  Rita Del Pinto; Claudio Ferri; Fabio Cominelli
Journal:  Int J Mol Sci       Date:  2017-11-07       Impact factor: 5.923

9.  LPS-induced Vitamin D Receptor Decrease in Oral Keratinocytes Is Associated With Oral Lichen Planus.

Authors:  Bin Zhao; Ran Li; Fang Yang; Feiyan Yu; Na Xu; Fang Zhang; Xuejun Ge; Jie Du
Journal:  Sci Rep       Date:  2018-01-15       Impact factor: 4.379

10.  Vitamin D3 decreases TNF-α-induced inflammation in lung epithelial cells through a reduction in mitochondrial fission and mitophagy.

Authors:  Yu-Chen Chen; Hsin-Ching Sung; Tzu-Yi Chuang; Tsai-Chun Lai; Tzu-Lin Lee; Chiang-Wen Lee; I-Ta Lee; Yuh-Lien Chen
Journal:  Cell Biol Toxicol       Date:  2021-07-13       Impact factor: 6.691

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.