OBJECTIVE: Reduction of body fat can be achieved by dietary programs and/or aerobic exercise training. More convenient methods to rid the body of excess fat are needed. However, it is unclear whether it is possible to more easily lose body weight at all. METHODS: DUhTP mice bred through phenotype selection for high treadmill performance and unselected controls were voluntarily physically active in a running wheel over a period of 3 weeks. Phenotypical data were collected, and subcutaneous fat was analyzed for expression of mitochondria-relevant proteins. RESULTS: Voluntary physical activity over 3 weeks exclusively in DUhTP mice severely reduced subcutaneous (-38%; p < 0.05) and epididymal (-32%; p < 0.05) fat. Following mild physical activity, subcutaneous fat derived from DUhTP mice showed increased levels of long chain acyl dehydrogenase (LCAD; +230%; p < 0.05) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α; p < 0.01). Mitochondrial transcription factor A (Tfam) expression was similar in both sedentary genotypes but physical activity increased Tfam levels exclusively in DUhTP (p < 0.05). CONCLUSION: Our findings indicate that the mitochondrial mass is highly active in DUhTP mice and responsive even to mild physical activity. While genetic predisposition could not prevent fat accretion in DUhTP mice, voluntary activity was sufficient to reduce excess body fat almost completely.
OBJECTIVE: Reduction of body fat can be achieved by dietary programs and/or aerobic exercise training. More convenient methods to rid the body of excess fat are needed. However, it is unclear whether it is possible to more easily lose body weight at all. METHODS:DUhTPmice bred through phenotype selection for high treadmill performance and unselected controls were voluntarily physically active in a running wheel over a period of 3 weeks. Phenotypical data were collected, and subcutaneous fat was analyzed for expression of mitochondria-relevant proteins. RESULTS: Voluntary physical activity over 3 weeks exclusively in DUhTPmice severely reduced subcutaneous (-38%; p < 0.05) and epididymal (-32%; p < 0.05) fat. Following mild physical activity, subcutaneous fat derived from DUhTPmice showed increased levels of long chain acyl dehydrogenase (LCAD; +230%; p < 0.05) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α; p < 0.01). Mitochondrial transcription factor A (Tfam) expression was similar in both sedentary genotypes but physical activity increased Tfam levels exclusively in DUhTP (p < 0.05). CONCLUSION: Our findings indicate that the mitochondrial mass is highly active in DUhTPmice and responsive even to mild physical activity. While genetic predisposition could not prevent fat accretion in DUhTPmice, voluntary activity was sufficient to reduce excess body fat almost completely.
Surplus energy is stored in the form of lipids in white adipose tissue (WAT). Hence WAT mass can be used as a marker of positive energy balance in a given organism [1]. Under conditions of negative energy balance, e.g. during physical exercise, elevated lipolytic activity in WAT results in an increase of non-esterified (‘free’ or unsaturated) fatty acids in the circulation, which serve as the main energy source of the muscle [2]. With increasing energy demands, for example during high-intensity physical exercise, fat and glycogen from the muscle get recruited for energy production [3,4]. Utilization of energy from fat stores can be augmented by distinct resistance exercise training protocols [5,6]. Lipolytic activity in WAT can be induced or blocked by growth hormone, cortisol, interleukin-6, β-adrenergic signaling or insulin [2,4]. Different pharmacological approaches have been tested concerning their potential to induce fat degradation, e.g., L-carnithin, polyphenols, and others [7].An increase of WAT mass was also observed in our mouse model, generated by long-term selection for high treadmill performance (DUhTPmice [8]). As shown previously, DUhTPmice have the same voluntary activity if running wheels (RWs) were included in their home cages [8]. Thus obesity in DUhTPmice seems not being related to altered physical activity. DUhTPmice are characterized by about fourfold increased endurance running capacity, increased hepatic lipogenesis, hyperlipidemia, and massive accumulation of body fat in external fat depots compared to unselected control mice [8]. Their fat depots contain high amounts of energy, exceeding the requirements of even ultra-long distance runs or extreme resistance training.While control of exercise-related energy metabolism has been intensively studied in muscle, adipose tissue has received only limited attention [9]. In rat muscles, endurance training leads to increases of tricarboxylic acid cycle activity, β-oxidation, and oxidative phosphorylation [10,11,12]. Specific enzyme activity providing β-oxidation, such as palmityl CoA dehydrogenase and carnithine palmitoyltransferase (CPT1), increases in response to exercise [12]. In women, prolonged physical activity resulted in an increase of medium and very long chain acyl CoA (MCAD) dehydrogenase in skeletal muscles [13]. However, glycerol release from muscle is small, compared to release from subcutaneous adipose tissue during moderate- and high-intensity exercise [14]. Both, physical activity and exercise can induce metabolic activity and mitochondrial biogenesis also in adipose tissues. Specifically, citrate synthase activity [15], mRNA expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1-α) as well as cytochrome c oxidase and mitochondrial content have been found to be regulated by exercise in adipose tissues [16,17]. Exercise-related induction of mitochondrial biogenesis and glucose uptake in subcutaneous fat tissues are dependent on endothelial nitric-oxide synthase (eNOS) as described previously [16].Key regulators of lipid oxidation (MCAD, CPT1) are increased in muscle through an increase in PGC1-α [18,19] as shown in muscles of exercising DUhTPmice [20]. PGC1-α is a known inducer of mitochondrial mass and increases the amounts of mitochondrial DNA (mtDNA) [19,21,22]. Furthermore, PGC1-α coordinately induces expression of the mitochondrial transcription factor (Tfam) enhancing the replication of mtDNA and transcription of mitochondria-encoded genes [23]. In response to exercise, expression of Tfam or of mitochondria- and nucleus-encoded mitochondrial proteins was increased in muscles and adipose tissue of rats, mice, and humans [15,24,25,26]. We thus hypothesized that energy metabolism in WAT is altered in DUhTPmice in a manner improving muscle supply with energy, in particular fatty acids. In order to test the hypothesis of an increased energy-metabolic activity in WAT of DUhTPmice, we studied expression of lipid metabolic key enzymes and mitochondrial biogenesis in the presence and absence of RWs. By means of long-term selection in DUhTPmice, we demonstrate that it is possible to metabolize excess body fat in a walk.
Material and Methods
Animals
All in vivo experiments were performed in accordance with national and international guidelines and were approved by our internal institutional review board. In this study, we used a mouse model that has been generated by selection over 90 generations for high treadmill performance (marathon mice: DUhTP) and random selection (control mice: DUC). Both mouse lines were bred from the identical base population [8] avoiding inbreeding. In the original base population, 4 different outbred (NMRI orig., Han:NMRI, CFW, CF1) and 4 different inbred mouse lines (CBA/Bln, AB/Bln, C57BL/Bln, XVII/Bln) were included. The animals were housed in Makrolon cages Type II (EBECO, Castrop-Rauxel, Germany) under controlled environmental conditions in a semi-barrier system. Mice received fresh tap water and fixed formula food ad libitum (Altromin® 1314, Altromin GmbH, Lage, Germany). Body composition was quantified by dual energy X-ray absorptiometry (Lunar PIXImus II, GE Medical Systems, Solingen, Germany).
Running Wheel Performance
Physical activity was assessed over a period of 3 weeks in 49- to 70-day-old male DUhTPmice and controls by including RWs (diameter = 33.4 cm; Tecniplast, Hohenpeißenberg, Germany) in their home cages. A control group of mice was kept in cages without RWs. Mice were fasted overnight, killed by decapitation (N = 10), and serum samples were collected. Tissues were weighted, snap-frozen in liquid nitrogen, and stored at −70 °C for subsequent analysis.
Analysis of Triglycerides and Cholesterol
Triglycerides (TG) and cholesterol were assayed in serum and liver samples by using commercial kits (triglycerides: No. LT-TR 0015, total cholesterol: No. LT-CH 0031; both Labor & Technik Eberhard Lehmann, Berlin, Germany) as described previously [8].
Quantitative Real Time-PCR (qPCR)
Expression of PGC1-α mRNA transcripts in subcutaneous fat samples (N = 7) was analyzed as described previously [20] and primers used are summarized in table 1. Different housekeeping genes (HKGs; Hprt1, Rplp2, and β-actin) were tested, identifying the HKGs with comparable Crossing point (Cp) values (CpRplp2: DUhTPmice = 24.45 ± 1.17; DUC mice = 25.80 ± 1.03) to normalize expression of PGC1-α. Mitochondrial DNA (mtDNA) was determined by comparison of gene expression levels of cytochrome B mtDNA and large ribosomal protein p0 (36B4).
Table 1
Sequences of primer sets used for amplification of specific cDNA
Name
5′ → 3′
To detect
PGC1-α1-forw
ggacatgtgcagccaagactct
PGC-1a isoform 1, inducer of browning
PGC1-α1-rev
cacttcaatccacccagaaagct
hypoxanthine guanine phosphoribosyl transferase 1
Hprt1-forw
tcctcctcagaccgctttt
Hprt1-rev
cctggttcatcatcgctaatc
Rplp2-forw
cagtctagagctcctggaaggt
ribosomal protein, large P2
Rplp2-rev
tgtggaaaacagcaggttagc
CytB-forw
cttcgctttccacttcatcttacc
cytochrome B
CytB-rev
ttgggttgtttgatcctgtttcg
36B4-forw
aggatatgggattcggtctcttc
large ribosomal protein p0
36B4-rev
tcatcctcctgcttaagtgaacaaact
beta-actin-forw
tgacaggatgcagaaggaga
actin, beta, cytoplasmatic
beta-actin-rev
cgctcaggaggagcaatg
Immunoblotting
Western immunoblotting was performed as described previously [20]. Equal loading of the gels and proper transfer of the proteins to the membranes were verified by Coomassie blue staining. We analyzed the expression of PGC1-α, fatty acid synthase (FAS), long chain acyldehydrogenase (LCAD), Tfam, sirtuin 3 (SIRT3), and NADH-ubiquinone oxidoreductase alpha subunit 9 (NDUFA9) of complex I by using specific antibodies (table 2).
Table 2
Primary antibodies used for western immunoblotting
Name
Catalogue number
Company
PGC1-o
sc-13067
Santa Cruz Biotechnology
FAS
sc-20140
Santa Cruz Biotechnology
LCAD
sc-82466
Santa Cruz Biotechnology
Tfam
sc-23588
Santa Cruz Biotechnology
ND-1
sc-20493
Santa Cruz Biotechnology
NDUFA9
sc-58392
Santa Cruz Biotechnology
SIRT3
sc-99143
Santa Cruz Biotechnology
Mitochondrial Morphology in Adipose Tissue
Mitochondrial staining was performed on 5 µm thick frozen tissue sections using MitoTracker® Deep Red (Molecular Probes®; Invitrogen, Darmstadt, Germany) for 30 min at 37 °C. Tissues were fixed in ice-cold acetone (−20 °C) for 10 min [27]. All sections were counterstained with Dapi (Vector Laboratories, Burlingame, CA, USA), and mitochondrial morphology was observed using a confocal laser-scanning microscope Fluoview FV10i (Olympus, Hamburg, Germany).
Statistical Analysis
The data analysis was performed using SAS software (Version 9.4 for Windows, SAS Institute Inc., Cary, NC, USA). Descriptive statistics and tests for normality were calculated with the UNIVARIATE procedure of Base SAS software (Base SAS® 9.4 Procedures Guide, 2nd ed; SAS Institute Inc.). Data considered as approximately normal were analyzed by ANOVA using the GLIMMIX procedure of SAS/STAT software (SAS/STAT® 13.1 User's Guide; SAS Institute Inc.). The ANOVA model for the 70-day data contained the fixed factors line (levels: DUC, DUhTP), group (levels: control, RW), and the interaction line × group. The model for the variables rel_subcutaneous_fat, rel_epididymal_fat, rel_perinephric_fat, and rel_brown_fat included the fixed effects line (levels: DUC, DUhTP), group (levels: 49 days, 70 days, 70 days + RWs), and the interaction line × group. Homogeneity of covariance parameters across groups was tested for all ANOVA models. In addition, least-squares means (LSM) and their standard errors (SE) were computed for each fixed effect in the models, and all pairwise differences of LS means were tested by the Tukey-Kramer procedure. Effects and differences were considered significant if p < 0.05.
Results
Physical Changes in DUhTP Mice in Response to Moderate Physical Activity
DUhTPmice accomplished 3,935 ± 1,719 revolutions per day (r/day) at an age of 70 days, which was comparable to control mice (3,913 ± 1,181 r/day). Table 3 shows the phenotypical alterations in our mouse lines in the presence and absence of RWs. Although body weights were different in both mouse lines, liver and muscle mass (M. quadriceps femoris) were similar in all experimental groups. In DUhTPmice serum, cholesterol concentrations were 1.3-fold (p < 0.05) higher compared with controls. In the liver of DUhTPmice levels of TG were 2.1-fold higher than in DUC mice (p < 0.01). In response to physical RW activity over a period of 3 weeks, exclusively DUhTPmice showed reduced concentrations of serum TG (p < 0.01) and lower levels of hepatic TG or hepatic cholesterol (p < 0.05). Liver TG and cholesterol were lower in DUhTPmice having access to RWs compared with DUC (p < 0.001). At an age of 49 days, DUhTPmice were characterized by increased amounts of fat present in different fat depots (subcutaneous, epididymal, perinephric, and brown fat mass) compared with DUC mice. Highest differences of relative fat mass were observed for the subcutaneous and perinephric fat (≈ 70% increase; fig. 1). The marked increases in fat mass were even more pronounced at an age of 70 days in DUhTPmice (subcutaneous fat: +100%, perinephric fat +91%; p < 0.005). Also for epididymal and brown fat tissues significant increases were present in 70-day-old DUhTP when compared to DUC mice (>30%; p < 0.05). Interestingly, voluntary physical activity in 70-day-old DUhTPmice significantly reduced absolute weights of all fat depots assessed compared with their sedentary 70-day-old littermates (table 2). If normalized for body mass, reductions were most obvious in perinephric fat (−56%; p < 0.0005; fig. 1) and subcutaneous fat (−38%; p < 0.0005) followed by epididymal and brown fat (−32% and −17%, respectively; p < 0.05). Voluntary physical activity also reduced fat mass in control DUC mice compared to sedentary littermates in the epididymal (−28%) and perinephric fat depots (−34%), while brown and subcutaneous fat depots remained unchanged. In subcutaneous and perinephric fat, we were able to observe age-related increases of fat accumulation between 49 days and 70 days of age (+29% and +80%, respectively; p < 0.05). Moreover, physical activity reduced fat masses in subcutaneous, epididymal and brown fat (−20%, −21% and −15% respectively; p < 0.05) in 70-day-old DUhTPmice not only when compared to sedentary littermates but also if compared to 49-day-old mice of the same line. Taken together, voluntary physical activity was able to eliminate the mouse line-specific accumulation of body fat in subcutaneous, epididymal, and perinephric tissues in DUhTPmice. Exclusively in subcutaneous fat, we were able to observe both a block of age-related fat increase as well as active degradation of existing body fat at an age of 49 days. We therefore focused on the control of energy metabolism in subcutaneous fat tissue in this subgroup.
Table 3
Phenotypical traits of male mice long-term selected for high treadmill performance (DUhTP) and unselected controls (DUC) at an age of 70 days
n
DUhTP
DUC
p value
co
RW
p value
co
RW
p value
DUhTP-co vs.DUC-co
DUhTP-RW vs.DUC-RW
Body mass, g
10
32.18 ± 1.02
31.25 ± 0.87
0.4925
35.18 ± 0.67
34.65 ± 0.79
0.6125
0.0191
0.0066
Lean body mass, g
10
20.89 ± 0.59
20.49 ± 0.59
0.6314
23.56 ± 0.48
23.45 ± 0.54
0.8693
0.0012
0.0007
Body length, cm
10
10.04 1 0.12
9.93 1 0.11
0.4907
10.44 ± 0.10
10.42 1 0.09
0.8845
0.0135
0.0014
Musculus rectus femoris, g
10
0.37 ± 0.01
0.38 ± 0.01
0.2969
0.39 ± 0.01
0.36 ± 0.01
0.0795
0.1378
0.1767
Liver mass, g
10
1.81 ± 0.07
1.76 ± 0.08
0.6301
1.94± 0.06
1.82 ± 0.06
0.1513
0.1571
0.5192
Subcutaneous fat, g
10
0.36 ± 0.03
0.22 ± 0.03
0.0012
0.20 ± 0.01
0.18 ± 0.02
0.4910
0.00003
0.2448
Epidymal fat, g
10
0.33 ± 0.03
0.23 ± 0.03
0.0145
0.28 ± 0.03
0.20 ± 0.02
0.0183
0.2122
0.2718
Perinephric fat, g
10
0.16 ± 0.02
0.08 ± 0.01
0.0020
0.09 ± 0.01
0.06 ± 0.01
0.0086
0.0035
0.2327
Brown fat, g
10
0.09 ± 0.01
0.07 ± 0.00
0.0191
0.06 ± 0.00
0.06 ± 0.00
0.7512
0.0006
0.1189
Serum triglyceride, mg/ml
>7
1.37 ± 0.12
0.96 ± 0.08
0.0079
1.15 ± 0.12
0.90 ± 0.06
0.0694
0.1999
0.5438
Serum cholesterol, μg/ml
>7
1.97 ± 0.09
1.95 ± 0.07
0.8103
1.58 ± 0.04
1.63 ± 0.07
0.5841
0.0003
0.0039
Liver triglyceride, μg/mg
>7
13.09 ± 1.74
6.43 ± 0.33
0.0049
6.25 ± 0.32
7.10 ± 0.33
0.1003
0.0042
0.1840
Liver cholesterol, μg/mg
>7
3.72 ± 0.24
2.51 ± 0.22
0.0007
3.38 ± 0.18
3.61 ± 0.20
0.3937
0.2710
0.0007
Mice were kept in cages without (co) and with running wheels (RW). Physical activity was studied in RW for a period of 3 weeks in 7- to 10-week male mice of both lines. Total body lean mass was analyzed by dual energy X-ray absorptiometry. Vales are presented as mean ± SE. Significances like indicated.
Fig. 1
Weights of subcutaneous, epididymal, perinephric, and brown fat depots normalized to body weight in 7- and 10-week-old male DUhTP (grew bars) and DUC mice (black bars) (n = 10). At an age of 7 weeks mice were kept in cages with (striped bars) or without RWs (filled bars) for a period of 3 weeks. Values are means ± SE; *p < 0.05, **p < 0.005, ***p < 0.0005.
Expression of Fat-Producing and -Degrading Enzymes in Subcutaneous Fat
At an age of 70 days subcutaneous fat tissue from DUhTPmice was characterized by massive expression of FAS in both experimental groups (fig. 2, left panel). In sedentary mice, FAS expression in DUhTP animals was about eightfold (p < 0.005) higher compared to DUC mice, indicating higher lipid synthesis in subcutaneous fat. In the presence of RWs, the high level of FAS expression was maintained in DUhTPmice, and voluntary physical activity did not have any effect on FAS expression in both mouse lines. Furthermore, expression of the lipid-degrading enzyme LCAD was elevated in sedentary DUhTP versus DUC mice (threefold; p < 0.0005). Physical activity over a period of 3 weeks further increased LCAD expression (2.3-fold; p < 0.05) in subcutaneous fat tissue of DUhTP, but not of DUC mice (fig. 2, right panel).
Fig. 2
a Effect of voluntary physical activity in RWs on protein expression of FAS (left panel) and LCAD (right panel) in subcutaneous fat tissue of 10-week-old male DUhTP and DUC mice. b The analysis was performed by Western immunoblotting. Protein expression was quantified by densitometry and normalized for the Coomassie blue signal. Data are presented as means and SE and are expressed relative to the expression level of control mice from line DUC (lower panel). Significant differences are indicated: *p < 0.05, **p < 0.005.
Mitochondrial Biogenesis in Subcutaneous Fat
The more than twofold increase of LCAD expression in subcutaneous fat in response to physical activity led us to investigate PGC1-α-mediated mitochondrial biogenesis in our system. PGC1-α mRNA expression was significantly increased in DUhTPmice (5.6-fold; p < 0.0005) compared to controls. Physical activity as a trend increased mRNA expression of PGC1-α in subcutaneous fat of both mouse lines (12% or 77%). The transcription data was confirmed via immunoblot by higher expression of the PGC1-α isoform 1 in sedentary DUhTPmice (2.1-fold; p < 0.05; fig. 3b). Interestingly, physical activity significantly increased protein levels of PGC1-α (+157%; p < 0.0005) in DUhTP, but not in DUC mice. To further address PGC1-α-mediated induction of mitochondrial biogenesis, we investigated protein expression of Tfam, mitochondria-encoded subunit ND-1 of respiratory chain complex I, NDUFA9 as well as mitochondrial SIRT3 (fig. 4). In total subcutaneous fat tissue extracts, two isoforms of Tfam (fig. 4a) were detected (mitochondrial Tfam: ∼29 kDa; nuclear Tfam: ∼25 kDa; Uni-Prot P40630). DUhTPmice as a trend showed increased levels of mitochondrial Tfam (+41%), whereas protein levels of nuclear Tfam were similar in both mouse lines. Mitochondrial and nuclear Tfam was significantly elevated in response to physical activity in DUhTPmice only (+40% and +75%, respectively; p < 0.05). Tfam-related expression of ND-1 in mitochondria (fig. 4a) was also significantly increased in DUhTP compared with control mice (+76%; p < 0.05). In the presence of RWs, protein expression of ND-1 was elevated as a trend by 31% (DUhTP) and 25% (DUC). In sedentary DUhTPmice, protein levels of complex I subunit NDUFA-9 and SIRT3 (fig. 4b) were increased if compared to DUC mice. In mitochondria, physical activity significantly increased protein levels exclusively in DUhTPmice (NDUFA9: 1.5-fold, p < 0.05; SIRT3: about 2.3-fold, p < 0.05). Furthermore, in subcutaneous fat of DUhTPmice, a 16-fold increase of mtDNA content was observed when compared to DUC mice (p < 0.0001; fig. 4c). Physical activity over a period of 3 weeks further increased mtDNA content in DUhTP and DUC mice (7.8-fold and 7.7-fold, respectively; p < 0.05). Interestingly, in contrast to subcutaneous fat of controls, that of DUhTPmice has less clustering of mitochondria around the nucleus and mitochondrial fragmentation (fig. 4c). In response to RW activity more mitochondrial mass is detectable in subcutaneous fat of both genotypes. In controls, formation of elongated mitochondria appears in combination with mitochondrial clustering in the cell because of alterations in mitochondrial fission. Only in DUhTPmice a homogenous mitochondrial network structure was found across the cell.
Fig. 3
Effect of voluntary physical activity in RWs on relative mRNA (a) and protein (b) levels of PGC-1a in subcutaneous adipose tissue from DUhTP and DUC. Analysis of mRNA expression was performed by qPCR and normalized to expression of HKG Rplp2. c Protein analysis was performed by Western immunoblotting. Protein expression was quantified by densitometry and normalized for the Coomassie blue signal. All data are expressed relative to the expression level of sedentary unselected controls (DUC) with no access to RW (lower panel). Values are means ± SE; *p < 0.05, **p < 0.005, ***p < 0.0005.
Fig. 4
Effect of voluntary physical activity in RWs on the expression of mitochondrial transcription factor A (Tfam) and mitochondria-encoded complex I subunit ND-1 (a) and mitochondrial proteins complex I subunit NDUFA9 and SIRT3 (b) as well as mtDNA content and mitochondrial biogenesis (c) in subcutaneous fat tissue of 10-week male DUhTP and DUC. Mitochondrial staining was achieved using Mitotracker Deep Red in fixed tissues as described in ‘Material and Methods’. The analysis was performed by Western immunoblotting. Protein expression was quantified by densitometry and normalized for the Coomassie blue signal. Data are expressed relative to the expression level of the sedentary unselected controls (DUC). Vales are presented as mean ± SE. Significances are indicated; *p < 0.05, §p < 0.01, **p < 0.005, ***p < 0.0005.
Discussion
We have previously described a novel genetic mouse model (DUhTP) established by long-term selection for high treadmill performance that is characterized by genetically fixed elevated running capacity, increased hepatic lipogenesis, and peripheral obesity compared to control mice (DUC) [8]. We now examined energy metabolism and mitochondrial biogenesis in our mouse model with and without voluntary physical activity. As expected and observed in other studies in mice [28,29] or humans [24], voluntary physical activity efficiently blocked the accumulation of body fat in peripheral fat depots from both genetic groups if compared to sedentary controls. In addition, prominent reductions of existing fat mass were found in perinephric and subcutaneous fat tissues exclusively in DUhTPmice in response to mild physical exercise over a period of 3 weeks. This was surprising, because the extent of voluntary physical activity in the RWs is similar in DUhTPmice and controls as described before [8]. In particular, physical activity is thought to exert beneficial effects on health through induction of lipolytic activity within adipose tissues [30]. In Osborne-Mendel rats, Zachwieja and colleagues [31] detected reduced fat masses in inguinal, epididymal, retroperitoneal, and perirenal fat pads in response to exercise for 7 weeks. Vieira et al. [32] could demonstrate a negative effect of physical activity (40 min/day over 12 weeks) on epididymalfat mass and hepatic TG levels. In DUhTPmice, we detected reduced hepatic cholesterol and TG content and serum TG levels by voluntary physical activity. While other studies have applied specific exercise training protocols over a period of 6–12 weeks [32], in our experiment merely 3 weeks of voluntary physical activity were sufficient to reduce hepatic TG and cholesterol in DUhTPmice. In addition, the previous study was focused on the analysis of endpoints in divergently selected rats, whereas we have studied control of fat metabolism in different age groups in the presence or absence of RWs in DUhTPmice.Expression of FAS and LCAD was higher in subcutaneous fat from DUhTPmice than in that of control mice, and expression of LCAD was further increased by physical activity in DUhTPmice. Also in human muscles, gene expression of LCAD increased after 8 h in response to 30 min single bout of exercise [25], and in muscle of rats, already in 1971, Mole and colleagues [12] could detect a twofold increased oxidation of long-chain fatty acids like oleate or linoleate in response to exercise on a treadmill over 12 weeks. In our model increased expression of LCAD in response to physical activity might correlate with increased β-oxidation in mitochondria on the one hand and a reduction of fat mass on the other. Thus we may assume a higher mitochondrial mass established by increased mitochondrial biogenesis in DUhTP in response to RW activity. In fact very recent work provided evidence for exercise-induced mitochondrial biogenesis in subcutaneous fat in mice [16]. Exercise-induced mitochondrial biogenesis in adipose tissues so far has been considered only by a comparably small number of studies. In muscle or adipose tissues, higher concentrations of PGC1-α, a potent effector of mitochondrial biogenesis, were found in response to exercise training [15,16,22]. In murine preadipocytes, PGC1-α and PPARα induce gene expression of LCAD involved in mitochondrial fatty acid oxidation [33]. PGC1-α stimulates mitochondrial biogenesis in terms of higher mtDNA content and modulates regulators of mitochondrial replication and transcription in myotubes [22]. PGC1-α controls mitochondria- and nucleus-encoded genes involved in mitochondrial respiration and oxidative phosphorylation in cardiac myocytes and muscle cells [22,34]. Most interestingly DUhTPmice synthesize severalfold higher levels of PGC1-α in their subcutaneous fat, if compared to controls. Expression of PGC1-α was further increased by physical activity only in DUhTPmice. Surprisingly, in contrast to muscle [20,35] or heart [35] only one form of PGC1-α (90 kDa) was observed in subcutaneous fat corresponding to PGC1-α isoform 1.Transcription of mitochondrial-encoded genes is mediated by Tfam in HeLa cells and Tfam expression again is induced in nucleus by PGC1-α via NRF-1, which identifies the latter two as bi-genomic coordinators of respiratory subunit expression [36]. Tfam is imported into mitochondrial subcompartments inducing transcription of 13 mtDNA-encoded protein subunits, which are essential components of the mitochondrial electron transport chain [37]. In sedentary DUhTP and control mice, mitochondrial or nuclear Tfam protein levels were on a comparable level. Nevertheless, voluntary physical activity significantly increased levels of both mitochondrial and nuclear Tfam in DUhTP, but not in DUC mice. In epididymal and retroperitoneal fat patches of male Wistar rats [15] or in subcutaneous fat of mice [16], an increase in mitochondrial biogenesis accompanied by higher PGC1-α and Tfam mRNA levels was found after 4 or 6 weeks of exercise swim training. Directly after an acute 2-hour bout of swimming only PGC1-α gene expression was increased in WAT, whereas mRNA concentration of Tfam was unchanged [15]. PGC1-α has been shown to induce expression of proteins encoded by the mitochondria such as ND-1 to ND-4 and ND-6 as markers of mitochondrial biogenesis and compounds of the respiratory chain in human and murine muscles, in the hippocampus and Corpus striatum regions of rat brain, and in rat kidneys [24,25]. Both in the presence and absence of RWs, protein expression of ND-1 was higher in DUhTPmice than in controls. In response to physical activity, ND-1 expression increased slightly in both genotypes but the increase did not reach statistical significance.In addition, nucleus-encoded mitochondrial proteins SIRT3 and NDUFA9 were examined to support the hypothesis of elevated mitochondrial biogenesis in DUhTPmice. Both proteins are expressed in a PGC1-α-dependent and Tfam-independent fashion [38]. In fact, in subcutaneous fat of sedentary DUhTPmice, higher protein levels of SIRT3 and NDUFA9 were detected when compared to controls. Again only in DUhTPmice voluntary activity further increased expression of SIRT3 and NDUFA9. It is known that PGC1-α induces gene expression of SIRT3 [38] while inhibition of SIRT3 expression blocked PGC1-α-mediated mitochondrial biogenesis [38], potentially since SIRT3 is required for the activation of NDUFA9 by deacetylation [39]. In addition, an increased content of mitochondrial DNA was found in DUhTPmice. In response to RW activity, mtDNA levels were elevated in DUhTP and DUC mice. In subcutaneous fat of DUhTPmice, physical activity coincides with the presence of a homogenous mitochondrial network distributed across the cell, maintaining cellular function and respiratory capacity. These dynamic networks continuously undergo fusion and fission events that allow damaged mitochondria to recover its activity and maintain metabolic functions, whereas dysfunctional mitochondria get removed from the network by autophagy. The correct balance between fusion and fission of mitochondria is required for normal tubular morphology. An imbalance of this process results in fragmentation, elongation, or clustering of mitochondria [40] and a lack of mitophagy [41]. Future studies are designed also to address CO2 consumption and body temperature in our mouse model.
Conclusions
To summarize, we provide direct evidence that subcutaneous fat from DUhTPmice is characterized by elevated expression of LCAD, PGC1-α, ND-1, NDUFA9, SIRT3 and increased mtDNA, which per se are not sufficient to induce subcutaneous fat mobilization. By contrast, in DUhTPmice even voluntary physical activity on RWs is sufficient to induce efficient lipolytic activity, which is reflected by a substantial loss of fat mass in different depots. Moderate physical activity further increased levels of LCAD, PGC1-α, Tfam, NDUFA9, and SIRT3 as well as mitochondrial biogenesis in subcutaneous fat from DUhTPmice, but not from controls. We hypothesize that during long-term selection DUhTPmice have acquired a set of energy-metabolic adaptations in order to fuel the high energy demands during physical activity. These adaptations confer the capacities to burn down existing fat mass even during comparably mild voluntary physical activity.
Authors: Jorge L Ruas; James P White; Rajesh R Rao; Sandra Kleiner; Kevin T Brannan; Brooke C Harrison; Nicholas P Greene; Jun Wu; Jennifer L Estall; Brian A Irving; Ian R Lanza; Kyle A Rasbach; Mitsuharu Okutsu; K Sreekumaran Nair; Zhen Yan; Leslie A Leinwand; Bruce M Spiegelman Journal: Cell Date: 2012-12-07 Impact factor: 41.582
Authors: Lindsey N Sutherland; Marc R Bomhof; Lauren C Capozzi; Susan A U Basaraba; David C Wright Journal: J Physiol Date: 2009-02-16 Impact factor: 5.182
Authors: Julia Brenmoehl; Elke Albrecht; Katrin Komolka; Lisa Schering; Martina Langhammer; Andreas Hoeflich; Steffen Maak Journal: Int J Biol Sci Date: 2014-03-11 Impact factor: 6.580
Authors: Julia Brenmoehl; Daniela Ohde; Christina Walz; Martina Langhammer; Julia Schultz; Andreas Hoeflich Journal: Cells Date: 2020-12-16 Impact factor: 6.600
Authors: Julia Brenmoehl; Christina Walz; Marion Spitschak; Elisa Wirthgen; Michael Walz; Martina Langhammer; Armin Tuchscherer; Ronald Naumann; Andreas Hoeflich Journal: J Comp Physiol B Date: 2017-12-06 Impact factor: 2.200