Ablation of intact hypothalamic and/or hindbrain TrkB signaling leads to perturbations in energy balance.

OBJECTIVE: Brain-derived neurotrophic factor (BDNF) and its receptor, tropomyosin receptor kinase B (TrkB), play a paramount role in the central regulation of energy balance. Despite the substantial body of genetic evidence implicating BDNF- or TrkB-deficiency in human obesity, the critical brain region(s) contributing to the endogenous role of BDNF/TrkB signaling in metabolic control remain unknown.
METHODS: We assessed the importance of intact hypothalamic or hindbrain TrkB signaling in central regulation of energy balance by generating Nkx2.1-Ntrk2-/- and Phox2b-Ntrk2+/- mice, respectively, and comparing metabolic parameters (body weight, adiposity, food intake, energy expenditure and glucose homeostasis) under high-fat diet or chow fed conditions.
RESULTS: Our data show that when fed a high-fat diet, male and female Nkx2.1-Ntrk2-/- mice have significantly increased body weight and adiposity that is likely driven by reduced locomotor activity and core body temperature. When maintained on a chow diet, female Nkx2.1-Ntrk2-/- mice exhibit an increased body weight and adiposity phenotype more robust than in males, which is accompanied by hyperphagia that precedes the onset of a body weight difference. In addition, under both diet conditions, Nkx2.1-Ntrk2-/- mice show increased blood glucose, serum insulin and leptin levels. Mice with complete hindbrain TrkB-deficiency (Phox2b-Ntrk2-/-) are perinatal lethal, potentially indicating a vital role for TrkB in visceral motor neurons that control cardiovascular, respiratory, and digestive functions during development. Phox2b-Ntrk2+/- heterozygous mice are similar in body weight, adiposity and glucose homeostasis parameters compared to wild type littermate controls when maintained on a high-fat or chow diet. Interestingly, despite the absence of a body weight difference, Phox2b-Ntrk2+/- heterozygous mice exhibit pronounced hyperphagia.
CONCLUSION: Taken together, our findings suggest that the hypothalamus is a key brain region involved in endogenous BDNF/TrkB signaling and central metabolic control and that endogenous hindbrain TrkB likely plays a role in modulating food intake and survival of mice. Our findings also show that female mice lacking TrkB in the hypothalamus have a more robust metabolic phenotype.

Introduction

The alarming increase of obesity worldwide has focused attention on the need for understanding the physiological mechanisms implicated in energy balance regulation [1]. In a recent human genome-wide association study, the role of the central nervous system in body mass regulation was strongly emphasized [2]. A substantial body of evidence has emerged demonstrating that brain-derived neurotrophic factor (BDNF) and its receptor, tropomyosin receptor kinase B (TrkB), play a paramount role in the central regulation of energy homeostasis [3], [4]. Mutations in either the human BDNF or NTRK2 genes are associated with obesity accompanied by hyperphagia [5], [6]. Similarly, mice with central BDNF-deficiency or TrkB deletion [7], [8], [9], [10], [11] display increased body weight and hyperphagia. The hypothalamus and the hindbrain are two major regions within the brain that are implicated in BDNF regulation of energy balance although both BDNF and TrkB are broadly distributed throughout the central nervous system [12], [13]. Notably, previous studies have shown that intraparenchymal BDNF administration into the ventromedial (VMH) and paraventricular (PVH) nucleus of the hypothalamus [14], [15], [16], [17], [18], [19], or dorsal vagal complex (DVC) and nucleus tractus solitarius (NTS) of the hindbrain [20], [21], [22], reduces food intake and increases energy expenditure in mice. Whether these two brain regions are critical sites contributing to the endogenous role of BDNF/TrkB signaling in central metabolic control, however, remains largely unknown. We hypothesize that intact endogenous TrkB signaling in the hypothalamus and/or the hindbrain is essential for central metabolic control. In this study, we show that deletion of TrkB in the hypothalamus results in increased body weight, adiposity and impaired glucose homeostasis while a reduction of TrkB in the hindbrain results in hyperphagia without affecting overall body weight.

Materials and methods

Animal care

All animal care protocols and procedures were approved by the University of Pennsylvania Institutional Care and Use Committee. Mice were maintained on a 12-h light/12-h dark cycle in a temperature controlled barrier facility, with ad libitum access to water and standard chow (Lab Diet 5010, calories provided by protein (28.7%), fat (12.7%), and carbohydrate (58.5%)) or custom high-fat diet (HFD) (Teklad TD93075, calories provided by protein (21.2%), fat (54.8%), and carbohydrate (24%)) upon weaning (3 weeks of age). Age-matched male and female littermates were used for all experiments.

Generation of Nkx2.1-Ntrk2−/− and Phox2b-Ntrk2−/− mice

Nkx2.1-Cre and Phox2b-Cre transgenic mice were obtained from The Jackson Laboratory (Stock #008661 and #016223 respectively, Bar Harbor, ME). Ntrk2fl/fl mice were obtained from Dr. Robert G. Kalb (Children's Hospital of Pennsylvania) and were originally generated in the lab of Dr. Rüdiger Klein (Max Planck Institute for Neurobiology) [23]. Genotyping primers for Nkx2.1-Cre, Phox2b-Cre and the floxed Ntrk2 allele were previously described [24], [25]. Initially, Nkx2.1-Cre and Phox2b-Cre mice were crossed with Ntrk2fl/fl mice to generate Nkx2.1-Cre+: TrkB+/fl and Phox2b-Cre+ : TrkB+/fl mice which were then crossed with Ntrk2fl/fl mice to generate Nkx2.1-Ntrk2−/−, Nkx2.1-Ntrk2+/−, Phox2b-Ntrk2−/−, Phox2b-Ntrk2+/− mice and wild type controls. Cre-: Ntrk2fl/fl, Cre-: Ntrk2+/fl, and Cre-only mice did not show differences in body weight and were combined to form the “wild type” control group. All mice were on a C57BL/6 background.

Histological analysis

Mice of the indicated age were deeply anesthetized with sodium pentobarbital (100 mg/kg, i.p.) and perfused via transcardial perfusion with 1× Phosphate Buffered Saline (PBS) followed by ice-cold 4% Paraformaldehyde (PFA). Tissues were post-fixed overnight in 4% PFA. 25 μm thick sections through the NTS (bregma −6.95 to −8.15) were collected using a cryostat. Immunofluorescent staining of free-floating brain sections was adapted from a previous protocol [26]. Normal donkey serum (Jackson ImmunoResearch) was used as a blocking solution. Sections were incubated with rabbit polyclonal antibody raised against Phox2b (25276-1-AP, Proteintech), or goat polyclonal antibody against TrkB (C-14) (sc-11-G, Santa Cruz Biotechnology, Inc) as primary antibodies. Cy3-conjugated donkey-anti-rabbit IgG and Alexa-Fluor 488-conjugated donkey-anti-goat IgG (Jackson ImmunoResearch) were used as secondary antibodies. Sections were visualized at the Penn Vet Imaging Core using a Nikon E600 microscope at 20× magnification and Roper Scientific imaging software. Quantification was performed on five sections of unilateral region of interest containing the NTS along the anterior–posterior axis using the multi wavelength cell scoring application within the MetaMorph Image Analysis software.

Body composition and food intake

At weaning, mice were fed either a standard chow diet or HFD and body weights were assessed weekly. For food intake experiments, mice were singly housed and food intake was measured daily for a period of 5 days at the indicated age. Body length was measured as nose-rump length at the indicated age. Gonadal fat pads were dissected and weighed at the indicated age. Total fat and lean mass was measured using NMR (Echo Medical Systems) at the indicated age at the Penn IDOM Mouse Phenotyping, Physiology and Metabolism Core.

Energy expenditure measures

Feed efficiency was calculated as grams weight gained/grams food consumed over a period of 5 days. Energy expenditure and infrared locomotor activity monitoring (through beam breaks along the X axis) during a 24 h period were done using comprehensive laboratory animal monitoring system (CLAMS) at the indicated age at the Penn IDOM Mouse Phenotyping, Physiology and Metabolism Core. Core body temperature was measured rectally with a thermistor (MicroTherma 2T; ThermoWorks) during the light cycle at the indicated age. Serum T4 and T3 levels were measured using a solid phase competitive ELISA (IBL America) in the Penn IDOM Radioimmunoassay and Biomarkers Core. White and brown adipose tissue gene expression and brown adipose tissue protein levels were measured by real-time PCR and immunoblotting, respectively as described below.

Leptin sensitivity experiment

For in vivo leptin sensitivity measurements, recombinant mouse leptin 1 μg/g body weight/injection (A. F. Parlow; National Hormone and Peptide Program) or 0.9% saline was administered i.p. to male mice on a chow diet at 8 weeks of age. Mice were initially injected with saline i.p. every 12 h over the course of 48 h. Leptin was subsequently administered following the same paradigm for 3 days. Mice received both saline and leptin injections using a within subjects design. Body weight and food intake were monitored daily for the 5 experimental days and for 2 additional recovery days. Body weight and food intake measurements for the days before the start of leptin injections were averaged and used to calculate percent change from baseline.

HPA axis responsivity

HPA axis responsivitiy was performed in singly housed male mice at the indicated age. Plasma corticosterone was measured following an acute 15 min restraint in a 50 mL conical tube. Tail blood was collected in EDTA-serum tubes before and after the restraint (0 and 15 min, respectively) and 15 min and 75 min after the end of the restraint (30 and 90 min, respectively). Serum corticosterone levels were measured as described previously [27]

Glucose homeostasis and serum analysis

A glucose tolerance test (GTT) was performed in male mice at the indicated age as described previously [28]. Blood glucose was assayed in tail blood using a glucometer (Contour, Bayer). Random-fed or overnight fasted serum insulin and leptin levels were measured at the indicated age as described previously [27]. Liver triglyceride and cholesterol analyses were done at the Vanderbilt Hormone Assay and Analytical Services Core as described previously [29].

Real-time PCR

Total RNA was extracted using TRIzol (Invitrogen) and further purified with the RNeasy kit (Qiagen). cDNA was synthesized from total RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative real-time PCR (RT-PCR) was carried out using RT2 SYBR Green qPCR Master Mix (SABiosciences) and samples were run using the Eppendorf Mastercycler® ep RealPlex. The relative mRNA expression was calculated using the comparative threshold cycle method as previously described [27]. The housekeeping gene Hprt1 was used as an internal control. Primers used for real-time PCR were as follows (also see Appendix A):

Mc4r (PPM34139A, SABiosciences),

Pparg (PPM05108C, SABiosciences),

Actinb (PPM02945B, SABiosciences).

Immunoblotting

Brain tissues were dissected and immediately frozen in isopentane prior to use. NTS-enriched DVC were collected using a cryostat by targeted micropunches (bregma: − 7.76 mm, punch depth 1.0 mm) extending rostrally. Tissues were homogenized in RIPA buffer (10 mM Tris–HCl, pH 7.4, 150 mM sodium chloride, 0.1% SDS, 1% Triton X-100, 1% sodium deoxycholate, 5 mM EDTA, 1 mM sodium fluoride) with protease inhibitor cocktail (Roche, 1:100 dilution), and sodium orthovanadate (2 mM). Protein concentrations were determined using a BCA Protein Assay (Thermo Scientific). Immunoblotting was done as described previously [26]. Antibodies used for immunoblotting were the following: Trk (C-14) (sc-11, Santa Cruz Biotechnology, Inc), SH-PTP2 (C-18) (sc-280, Santa Cruz Biotechnology, Inc), Ucp1 (ab10983, Abcam), β-actin (4967, Cell Signaling). Blots were quantified using ImageJ software.

Statistical analysis

Results are expressed as mean ± SEM

Comparisons between groups were made by unpaired 2-tailed Student's t-test, 1-way ANOVA or 2-way ANOVA followed by Bonferroni posttest, as appropriate. A p-value of less than 0.05 was considered to be statistically significant.

Results

Nkx2.1-Ntrk2−/− mice display increased body weight, adiposity and body length on HFD

In order to generate mice with TrkB-deficiency throughout the hypothalamus, Ntrk2fl/fl mice were crossed to a line of transgenic Nkx2.1-Cre mice which express Cre in the ventral forebrain, including the majority of the hypothalamus, but not in caudal brain regions such as the hindbrain [30]. In the Ntrk2fl/fl mice, the floxed exon is within the tyrosine kinase domain of the TrkB receptor resulting in deletion of the full length TrkB isoform when recombined [23]. As expected, Nkx2.1-Ntrk2−/− mice show significant reduction of total TrkB protein in the hypothalamus but not the rest of the brain (Figure 1A, B). Weekly body weights of male and female Nkx2.1-Ntrk2−/− mice were examined and compared with the Nkx2.1-Ntrk2+/− heterozygous mice and wild type control littermates upon weaning. When fed a HFD, both male (Figure 1C) and female (Figure 1D) Nkx2.1-Ntrk2−/− mice display significantly increased body weight compared to their wild type littermates, with the females showing a greater increase compared to controls. Nkx2.1-Ntrk2+/− heterozygous male mice are similar in body weight compared to the Nkx2.1-Ntrk2−/− male mice. To determine whether the increase in body weight reflects changes in adiposity, body composition was assessed by NMR in males and gonadal fat was weighed in females. Male Nkx2.1-Ntrk2−/− mice display significant increases in both fat mass (Figure 1E, F) and lean mass (Figure 1G). Female Nkx2.1-Ntrk2−/− mice also have significantly increased adiposity as measured by gonadal fat weight (Figure 1H). Consistent with the increased adiposity, Nkx2.1-Ntrk2−/− mice exhibit increased serum leptin levels under both fed and fasted conditions (Table 1). Both male (Figure 1I) and female (Figure 1J) Nkx2.1-Ntrk2−/− mice show concomitant increases in body length.

Figure 1

. (A) TrkB protein levels in the hypothalamus (top 2 blots) and brain (bottom 2 blots) of Nkx2.1-Ntrk2−/− (KO) mice compared with Nkx2.1-Ntrk2+/− (Het) and Cre-controls (WT). SHP2 protein levels are shown as a loading control. (B) Blots are quantified using ImageJ software, n = 4 for each genotype. (C) Body weights of male Nkx2.1-Ntrk2−/− (n = 11), Nkx2.1-Ntrk2+/− (n = 10) and wild type controls (n = 19) on HFD. (D) Body weights of female Nkx2.1-Ntrk2−/− (n = 13), Nkx2.1-Ntrk2+/− (n = 5) and wild type controls (n = 26) on HFD. (E) Fat mass and (F) % fat mass normalized to body weight as determined by NMR of male Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 6), and wild type controls (n = 6). (G) Lean mass as determined by NMR of male Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 6), and wild type controls (n = 6). (H) Gonadal fat weight of female Nkx2.1-Ntrk2−/− (n = 7), Nkx2.1-Ntrk2+/− (n = 5), and wild type controls (n = 6). (I) Body length for male Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 6), and wild type controls (n = 6). (J) Body length for female Nkx2.1-Ntrk2−/− (n = 7), Nkx2.1-Ntrk2+/− (n = 5), and wild type controls (n = 6). All values are mean ± SEM. Weight curves are analyzed by two-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Nkx2.1-Ntrk2−/− mice and wild type controls. Body composition and body length data are analyzed by one-way ANOVA followed by Bonferroni post-hoc pairwise comparison with the wild type controls. *p < 0.05, #p < 0.10 compared to wild type.

Table 1

Metabolic and neuroendocrine parameters of . Random fed or overnight fasted Nkx2.1-Ntrk2−/−, Nkx2.1-Ntrk2+/− and wild type male and female mice are used in this study. Blood glucose, serum insulin and serum leptin measurements are taken on weeks 13 for fed and 15 for fasted conditions. Serum T4 and T3 levels are measured on week 15. Blood glucose, serum insulin and serum leptin are analyzed by one-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Nkx2.1-Ntrk2−/− mice and wild type controls. Serum T4 and T3 levels are analyzed by unpaired two tailed Student's t-test. *p < 0.05 compared to wild type.

HFD
	Genotype	Control (WT)	Nkx2.1-Ntrk2+/− (Het)	Nkx2.1-Ntrk2−/− (KO)
Fed (wk 13)Males	Blood glucose (mg/dl)	125 ± 4	126 ± 9	145 ± 17
Serum insulin (ng/ml)	6.4 ± 0.9	9.5 ± 2.8	38.1 ± 14.0*
Serum leptin (ng/ml)	24.4 ± 2.1	35.8 ± 4.9*	37.6 ± 1.8*
Serum T4 (μg/dl)	2.51 ± 0.19	N.D.	2.81 ± 0.15
Serum T3 (ng/ml)	0.78 ± 0.07	N.D.	0.82 ± 0.06
Fasted (wk 15)Males	Blood glucose (mg/dl)	83 ± 7	71 ± 2	83 ± 7
Serum insulin (ng/ml)	1.6 ± 0.2	1.4 ± 0.1	1.8 ± 0.1
Serum leptin (ng/ml)	7.6 ± 1.9	17.3 ± 5.5	20.3 ± 3.5*
Fed (wk 13)Females	Blood glucose (mg/dl)	113 ± 7	115 ± 5	163 ± 16*
Serum insulin (ng/ml)	4.5 ± 1.2	8.2 ± 3.8	56.1 ± 10.7*
Serum leptin (ng/ml)	32.7 ± 3.4	44.1 ± 8.6	78.4 ± 12.5*
Serum T4 (μg/dl)	3.73 ± 0.22	N.D.	4.35 ± 0.23
Serum T3 (ng/ml)	0.85 ± 0.14	N.D.	0.98 ± 0.06
Fasted (wk 15)Females	Blood glucose (mg/dl)	71 ± 2	62 ± 3	99 ± 5*
Serum insulin (ng/ml)	1.0 ± 0.1	1.4 ± 0.1	2.0 ± 0.1*
Serum leptin (ng/ml)	15.3 ± 8.6	10.7 ± 3.2	46.2 ± 4.3*

Nkx2.1-Ntrk2−/− mice show no difference in food intake on HFD but display decreased activity and core temperature

In order to determine the cause of the increased body weight and adiposity of the Nkx2.1-Ntrk2−/− mice on HFD, daily food intake was measured for a period of five days and the mice were also placed in CLAMS metabolic cages to directly measure energy expenditure and locomotor activity. These analyses were performed at 5–6 weeks of age prior to the onset of any body weight difference. Nkx2.1-Ntrk2−/− mice do not show changes in high-fat diet intake at this age compared to their wild type littermates (Figure 2A). Interestingly, Nkx2.1-Ntrk2−/− mice exhibit increased feed efficiency (Δbody weight/Δfood intake) suggesting that they have energy expenditure impairments (Figure 2B). While VO2, VCO2 and RER are similar in Nkx2.1-Ntrk2−/− and control mice (Figure 2E–G), Nkx2.1-Ntrk2−/− mice show reduced locomotor activity (Figure 2C) and reduced core temperature (Figure 2D). No difference in serum T4 or T3 levels is detected (Table 1). Baseline and stress-induced serum corticosterone levels are also similar (Supplemental 1A).

Figure 2

. (A) Cumulative food intake of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6) on HFD. (B) 5 day feed efficiency of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6). (C) Locomotor activity of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 5) mice and wild type controls (n = 5). (D) Core temperature of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6). (E) Oxygen consumption, (F) Carbon dioxide production, (G) Respiratory exchange ratio (RER) of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 5) mice and wild type controls (n = 5). All values are mean ± SEM. Cumulative food intake is analyzed by two-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Nkx2.1-Ntrk2−/− mice and wild type controls. Feed efficiency and energy expenditure measures are analyzed by unpaired two-tailed Student's t-test *p < 0.05 compared to wild type.

To assess whether there are changes in gene expression consistent with the metabolic impairments observed in Nkx2.1-Ntrk2−/− mice on HFD, anorexigenic Pomc and orexigenic Npy and Agrp neuropeptide mRNA levels were measured in the hypothalamus of Nkx2.1-Ntrk2−/− mice and wild type controls. Consistent with their obese phenotype, Pomc gene expression is significantly lower in Nkx2.1-Ntrk2−/− mice compared to controls. Npy and Agrp expression levels are not different between the genotypes (Figure 3A). No changes in LepR or Mc4R expression are detected between Nkx2.1-Ntrk2−/− mice and wild type controls (Figure 3A). A significant reduction in the expression of genes implicated in thermogenesis and brown adipose determination, including Ucp1, Cidea and Pgc1α, in WAT of Nkx2.1-Ntrk2−/− mice is consistent with impaired WAT browning (Figure 3B). Consistent with the elevated body weight and reduced core temperature, Ucp1 mRNA (data not shown) and Ucp1 protein (Figure 3C) are significantly lower in BAT of Nkx2.1-Ntrk2−/− mice. Nkx2.1-Ntrk2−/− mice also have significantly increased liver triglycerides (Figure 3D, E for males and females, respectively) while liver cholesterol levels are similar (1.6 ± 0.2 for wild type males, 1.7 ± 0.1 for Nkx2.1-Ntrk2−/− males; 2.0 ± 0.1 for wild type females, 2.5 ± 0.3 for Nkx2.1-Ntrk2−/− females).

Figure 3

. (A) Expression of Pomc, Agrp, Npy, LepR, Mc4R in the hypothalamus of female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 5). Hprt1 is used as a housekeeping gene. (B) Expression of Ucp1, Cidea, Elovl3, Pgc1a, Prdm16, Pparg in the WAT of female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6). Hprt1 is used as a housekeeping gene. (C) Ucp1 protein levels in the BAT of female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6). Beta-actin protein levels are used as loading control. (D) Liver triglyceride levels of male Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6). (E) Liver triglyceride levels of female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls All values are mean ± SEM. All measures are analyzed by unpaired two-tailed Student's t-test *p < 0.05.

Nkx2.1-Ntrk2−/− mice display increased body weight, adiposity and body length on chow diet

Weekly body weights of male and female Nkx2.1-Ntrk2−/− mice were examined and compared with the Nkx2.1-Ntrk2+/− heterozygous mice and wild type control littermates upon weaning. When maintained on a chow diet, male Nkx2.1-Ntrk2−/− mice are similar in body weight to their wild type littermates (Figure 4A) whereas female Nkx2.1-Ntrk2−/− mice show significantly increased body weight (Figure 4B). Despite the absence of a body weight phenotype, male Nkx2.1-Ntrk2−/− mice display a significant increase in fat mass (Figure 4C, D). Lean mass is similar between male Nkx2.1-Ntrk2−/− and control mice (Figure 4E). Female Nkx2.1-Ntrk2−/− mice also have significantly increased adiposity, as measured by gonadal fat weight (Figure 4F). Both male (Figure 4G) and female (Figure 4H) Nkx2.1-Ntrk2−/− mice display a slight increase in body length.

Figure 4

. (A) Body weights of male Nkx2.1-Ntrk2−/− (n = 10), Nkx2.1-Ntrk2+/− (n = 7) and wild type controls (n = 20) on chow. (B) Body weights of female Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 12) and wild type controls (n = 23) on chow. (C) Fat mass and (D) % fat mass normalized to body weight as determined by NMR of male Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 6), and wild type controls (n = 6). (E) Lean mass as determined by NMR of male Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 6), and wild type controls (n = 6). (F) Gonadal fat weight of female Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 8), and wild type controls (n = 10). (G) Body length for male Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 6), and wild type controls (n = 6). (H) Body length for female Nkx2.1-Ntrk2−/− (n = 6), Nkx2.1-Ntrk2+/− (n = 8), and wild type controls (n = 10). Weight curves are analyzed by two-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Nkx2.1-Ntrk2−/− mice and wild type controls. All values are mean ± SEM. Body composition and body length data are analyzed by one-way ANOVA followed by Bonferroni post-hoc pairwise comparison with the wild type controls. *p < 0.05 compared to wild type.

Nkx2.1-Ntrk2−/− mice show increased food intake and leptin resistance

In order to determine the cause of the increased body weight and adiposity of the Nkx2.1-Ntrk2−/− mice on chow, daily food intake was measured for a period of five days prior to the onset of any body weight difference. In contrast to mice maintained on HFD, chow-fed Nkx2.1-Ntrk2−/− female mice display hyperphagia prior to a significant body weight difference (Figure 5A). Nkx2.1-Ntrk2−/− female mice also exhibit increased feed efficiency (Figure 5B), suggesting that both food intake and energy expenditure impairments likely play a role in the overall body weight phenotype. In response to exogenous leptin administration, Nkx2.1-Ntrk2−/− mice show resistance to leptin-induced suppression of food intake (Figure 5C) suggesting that intact hypothalamic TrkB signaling is required to convey leptin's effects on feeding. With this dose and injection paradigm, there is no significant reduction in body weight in either group (Figure 5D).

Figure 5

. (A) Cumulative food intake of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6) on chow. (B) 5 day feed efficiency of 5–6 week old, female Nkx2.1-Ntrk2−/− (n = 6) mice and wild type controls (n = 6). (C) Leptin-induced suppression of food intake in 8 week old male Nkx2.1-Ntrk2−/− (n = 5) mice and wild type controls (n = 5). Baseline body weight measurements for the days of saline injections were averaged and used to calculate percent change. Leptin bar refers to the measurement taken 72 h after the first leptin injection. Recovery bar refers to the measurement taken 48 h after the last leptin injection. (D) Leptin-induced reduction in body weight in 8 week old male Nkx2.1-Ntrk2−/− (n = 5) mice and wild type controls (n = 5). Baseline body weight measurements for the days of saline injections were averaged and used to calculate percent change. Leptin bar refers to the measurements 72 h after the first leptin injection. Recovery bar refers to the measurement taken 48 h after the last leptin injection. All values are mean ± SEM. Cumulative food intake is analyzed by two-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Nkx2.1-Ntrk2−/− mice and wild type controls. Feed efficiency, % change in food intake and body weight are analyzed by unpaired two-tailed Student's t-test *p < 0.05 compared to wild type (and saline control for C and D).

Nkx2.1-Ntrk2−/− mice show impaired glucose homeostasis

Given that obesity is often accompanied by glucose intolerance and insulin resistance, blood glucose and serum insulin levels were measured under random fed or overnight fasted conditions in male and female Nkx2.1-Ntrk2−/− mice and controls fed a chow diet or HFD. Overall, female Nkx2.1-Ntrk2−/− mice show a more severe hyperglycemic and hyperinsulinemic phenotype compared to male Nkx2.1-Ntrk2−/− mice and the phenotype is more robust on HFD compared to chow (Table 1, Table 2). Prior to the onset of major body weight differences, Nkx2.1-Ntrk2−/− mice have similar blood glucose and serum insulin levels (data not shown) to the controls. Male Nkx2.1-Ntrk2−/− mice which do not have a body weight phenotype on chow also do not display any impairment in glucose tolerance test (Table 2, Supplemental 1B). Taken together, these results suggest that the impairments in glucose metabolism that are detected in Nkx2.1-Ntrk2−/− mice on both diets are likely secondary to the body weight gain.

Table 2

Metabolic and neuroendocrine parameters of . Random fed or overnight fasted Nkx2.1-Ntrk2−/−, Nkx2.1-Ntrk2+/− and wild type male and female mice are used in this study. Blood glucose, serum insulin and serum leptin measurements are taken on weeks 13 for fed and 15 for fasted conditions. All measurements are analyzed by one-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Nkx2.1-Ntrk2−/− mice and wild type controls. *p < 0.05 compared to wild type.

Chow
	Genotype	Control (WT)	Nkx2.1-Ntrk2+/− (Het)	Nkx2.1-Ntrk2−/− (KO)
Fed (wk 13)Males	Blood glucose (mg/dl)	104 ± 5	101 ± 5	103 ± 4
Serum insulin (ng/ml)	1.7 ± 0.1	1.7 ± 0.2	1.9 ± 0.4
Serum leptin (ng/ml)	5.5 ± 0.5	4.7 ± 0.4	6.0 ± 0.9
Fasted (wk 15)Males	Blood glucose (mg/dl)	76 ± 9	71 ± 7	58 ± 4
Serum insulin (ng/ml)	1.1 ± 0.1	1.1 ± 0.1	1.1 ± 0.1
Serum leptin (ng/ml)	2.2 ± 0.2	2.0 ± 0.2	2.2 ± 0.2
Fed (wk 13)Females	Blood glucose (mg/dl)	110 ± 6	114 ± 4	129 ± 3*
Serum insulin (ng/ml)	1.4 ± 0.1	1.6 ± 0.1	2.6 ± 0.4*
Serum leptin (ng/ml)	4.9 ± 0.6	4.8 ± 0.4	20.5 ± 4.6*
Fasted (wk 15)Females	Blood glucose (mg/dl)	73 ± 9	65 ± 4	56 ± 4
Serum insulin (ng/ml)	1.2 ± 0.1	1.3 ± 0.1	1.4 ± 0.1
Serum leptin (ng/ml)	3.2 ± 0.1	3.6 ± 0.4	6.7 ± 1.3*

Phox2b-Ntrk2−/− mice are perinatal lethal

In order to assess the importance of endogenous hindbrain TrkB receptors to overall energy balance, mice with hindbrain TrkB-deficiency were generated by crossing Ntrk2fl/fl mice to a line of transgenic Phox2b-Cre mice which express Cre in the NTS and DVC of the hindbrain but not in the hypothalamus [31]. Notably, despite being born in expected Mendelian ratios (data not shown), Phox2b-Ntrk2−/− mice die within 2–3 weeks of postnatal life. Phox2b-Ntrk2−/− mice are noticeably smaller (Figure 6A) and weigh significantly less (8.85 g ± 0.14 for wild type (n = 24); 5.02 g ± 0.14 for Phox2b-Ntrk2−/− (n = 13), measured at P18) than their wild type control littermates. Immunohistochemistry studies show significant overlap of Phox2b+ and TrkB + cells in the NTS of wild type mice (62.9% ± 9.7 of Phox2b + cells are also TrkB+), and confirm that the Phox2b-Ntrk2−/− mice lack TrkB expression in Phox2b + neurons (Figure 6B). Phox2b mRNA levels in the NTS are similar between Phox2b-Ntrk2−/− and wild type controls (data not shown). Phox2b-Ntrk2+/− heterozygous mice have an approximately 40% reduction in TrkB protein within the NTS compared to wild type controls as assessed by immunoblotting of NTS-enriched tissue punches (Figure 6C, D).

Figure 6

. (A) Representative image of Phox2b-Ntrk2−/− mice and wild type control littermates at P18. (B) Representative immunofluorescence of Phox2b+ and TrkB+ cells in the NTS of control (top) and Phox2b-Ntrk2−/− (bottom) mice. White arrows indicate representative cells that are Phox2b+ and TrkB+. (C) TrkB protein levels in the NTS-enriched lysates (top 2 blots) and the hypothalamus (bottom 2 blots) of Phox2b-Ntrk2+/− (Het) and Cre-controls (WT). SHP2 protein levels are shown as a loading control. (D) Blots are quantified using ImageJ software, n = 7 for each genotype. (E) Body weights of female Phox2b-Ntrk2+/− (n = 9) mice and wild type controls (n = 17) on HFD. (F) Gonadal fat weight of female Phox2b-Ntrk2+/− (n = 9) mice and wild type controls (n = 11). (G) Body length for female Phox2b-Ntrk2+/− (n = 9) mice and wild type controls (n = 11). All values are mean ± SEM. Weight curves are analyzed by two-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Phox2b-Ntrk2+/− mice and wild type controls. Body composition and body length data are analyzed by unpaired two-tailed Student's t-test. *p < 0.05 compared to wild type.

Phox2b-Ntrk2+/− mice are hyperphagic in the absence of a body weight phenotype

Phox2b-Ntrk2+/− mice and wild type controls were weaned onto either HFD or chow diet. When maintained on HFD, Phox2b-Ntrk2+/− female and male mice are similar in body weight compared to their wild type littermates (Figure 6E for females, Supplemental 2A for males). Adiposity is also similar, as measured by gonadal fat weight (Figure 6F for females, Supplemental 2B for males), as is body length (Figure 6G for females, Supplemental 2C for males). Interestingly, despite the absence of a body weight difference, cumulative and average daily food intake measurements suggest that Phox2b-Ntrk2+/− mice are hyperphagic (Figure 7A, B). Phox2b-Ntrk2+/− mice are similar to their wild type littermates in body temperature (Figure 7C) and BAT Ucp1 gene expression (Figure 7D). On chow diet, there are no differences in body weight (Supplemental 3A, B for males and females, respectively), adiposity (Supplemental 3C, D for males and females, respectively) or body length (Supplemental 3E, F for males and females, respectively). Phox2b-Ntrk2+/− mice still display increased food intake, albeit to a lesser extent than on HFD (Supplemental 3G, H for cumulative and average daily food intake, respectively). Blood glucose and serum insulin levels are normal in Phox2b-Ntrk2+/− mice on either diet, with the exception of increased fasted blood glucose on chow-fed Ntrk2+/− male mice (Table 3).

Figure 7

. Cumulative (A) and average daily (B) food intake of 12–13 week old, female Phox2b-Ntrk2+/− (n = 9) mice and wild type controls (n = 10) on HFD. (C) Core temperature of 13–14 week old, female Phox2b-Ntrk2+/− (n = 5) mice and wild type controls (n = 7). (D) Ucp1 gene expression in the BAT of female Phox2b-Ntrk2+/− (n = 9) mice and wild type controls (n = 9). Hprt1 gene is used as a housekeeping gene. All values are mean ± SEM. Cumulative food intake is analyzed by two-way ANOVA followed by Bonferroni post-hoc pairwise comparison between Phox2b-Ntrk2+/− mice and wild type controls. Average daily food intake and energy expenditure measures are analyzed by unpaired two tailed Student's t-test *p < 0.05 compared to wild type.

Table 3

Metabolic and neuroendocrine parameters of . Random fed or overnight fasted Phox2b-Ntrk2+/− and wild type male and female mice are used in this study. Blood glucose and serum insulin measurements are taken on weeks 13 for fed and 15 for fasted conditions. All measurements are analyzed by unpaired two-tailed Student's t-test. *p < 0.05 compared to wild type.

HFD
		Control (WT)	Phox2b-Ntrk2+/− (Het)
Fed (wk 13)Males	Blood glucose (mg/dl)	124 ± 4	119 ± 12
Serum insulin (ng/ml)	3.4 ± 0.4	3.4 ± 0.5
Fasted (wk 15)Males	Blood glucose (mg/dl)	73 ± 2	74 ± 11
Serum insulin (ng/ml)	2.2 ± 0.1	2.1 ± 0.1
Fed (wk 13)Females	Blood glucose (mg/dl)	132 ± 7	130 ± 19
Serum insulin (ng/ml)	2.4 ± 0.1	2.5 ± 0.3
Fasted (wk 15)Females	Blood glucose (mg/dl)	71 ± 6	76 ± 16
Serum insulin (ng/ml)	1.8 ± 0.1	1.9 ± 0.1
Chow
Fed (wk 13)Males	Blood glucose (mg/dl)	114 ± 8	108 ± 4
Serum insulin (ng/ml)	1.5 ± 0.1	1.9 ± 0.2
Fasted (wk 15)Males	Blood glucose (mg/dl)	55 ± 2	75 ± 4*
Serum insulin (ng/ml)	1.0 ± 0.1	1.1 ± 0.1
Fed (wk 13)Females	Blood glucose (mg/dl)	104 ± 5	119 ± 5
Serum insulin (ng/ml)	1.5 ± 0.1	1.6 ± 0.2
Fasted (wk 15)Females	Blood glucose (mg/dl)	71 ± 3	68 ± 4
Serum insulin (ng/mlss)	0.9 ± 0.1	0.8 ± 0.1

Discussion

BDNF and TrkB are known to play a major role in the central regulation of energy homeostasis and are also implicated in human obesity. Despite compelling evidence from rodent models to date emphasizing the role of BDNF/TrkB signaling in central metabolic control, the requirement of endogenous regional TrkB signaling is still not established. In this study, we have generated two mouse models of TrkB-deficiency to assess the role of intact endogenous hypothalamic (Nkx2.1-Ntrk2−/−) or hindbrain (Phox2b-Ntrk2−/−) TrkB signaling in energy balance regulation. Our data clearly demonstrate that Nkx2.1-Ntrk2−/− mice display significantly increased body weight and adiposity while Phox2b-Ntrk2+/− mice are hyperphagic without alterations in body weight or adiposity.

Both male and female Nkx2.1-Ntrk2−/− mice show significantly increased body weight when maintained on HFD although the females have a more severe metabolic phenotype compared to males. Furthermore, only females display significantly increased body weight when maintained on regular rodent chow diet. These findings are consistent with previous studies showing that female mice with BDNF- or TrkB-deficiency exhibit a more robust metabolic phenotype than males [9], [11]. These sex-specific differences suggest sexual dimorphism of the hypothalamic TrkB signaling pathway, which has been previously shown in other brain regions [32], [33]. For example, there is an estrogen response element within the BDNF gene [34] and estrogen signaling has been reported to induce BDNF expression in the hippocampus [35]. In a reciprocal manner, TrkB signaling has been reported to potentiate estrogen-initiated signaling in the human neuronal SH-SY5Y cells [36]. Both BDNF and estrogen influence synaptic plasticity by promoting dendritic spine growth [37] and there is overlap between estrogen receptor-expressing cells and cells that express BDNF and TrkB in the brain [35]. The more severe metabolic phenotype in female Nkx2.1-Ntrk2−/− mice could be due to TrkB-deficiency within the VMH where estrogen receptor alpha, BDNF and TrkB are all highly expressed; if TrkB signaling is absent, estrogen signaling may be blunted leading to increased weight gain. Furthermore, using a BDNF-mimetic to target muscular TrkB receptors results in improvements in energy expenditure and overall reduction in body weight only in female mice, suggesting there may be interactions between sex hormones and BDNF/TrkB pathways in peripheral tissues in addition to brain [38]. Although we did not find differences in estrogen receptor alpha gene expression in the whole hypothalamus of Nkx2.1-Ntrk2−/− mice and wild type controls (data not shown), further investigation is required to study the interaction between estrogen and BDNF/TrkB signaling within specific nuclei of the hypothalamus.

In addition to the sex-specific differences, there are differences in various parameters of the metabolic phenotype of Nkx2.1-Ntrk2−/− mice depending on the diet. Somewhat surprisingly, under HFD-fed conditions Nkx2.1-Ntrk2−/− mice do not show any differences in food intake while chow-fed Nkx2.1-Ntrk2−/− mice exhibit hyperphagia. It is possible that the HFD-fed mice reach a “ceiling effect” in HFD consumption due to the high palatability of this diet. Alternatively, very high levels of circulating leptin in HFD-fed Nkx2.1-Ntrk2−/− mice might counteract the hyperphagia by suppressing food intake. On HFD, the overall body weight phenotype appears to be primarily driven by decreased energy expenditure, specifically reduced locomotor activity and decreased core temperature. Direct administration of BDNF into the VMH or PVH results in increased spontaneous physical activity [17], [39] and BDNF delivered to PVH results in increased BAT Ucp1 gene expression through sympathetic innervation [15]. Thus, the observed reduction in activity and core temperature is consistent with deletion of TrkB in these two brain regions. There are no differences in measures of indirect calorimetry at week 5–6 but this does not rule out the possibility of Nkx2.1-Ntrk2−/− mice developing reduced basal metabolic rate at a later time point, which will require further study. A previous paper which examined mice with central TrkB-deficiency using the Rgs9-Cre which deletes in the arcuate nucleus, dorsomedial nucleus of the hypothalamus, and lateral hypothalamus [11] reported similar increases in body weight and adiposity. However, Rgs9-Ntrk2−/− mice do not show reduced locomotor activity while Nkx2.1-Ntrk2−/− mice do. Additionally Rgs9-Ntrk2−/− mice, unlike Nkx2.1-Ntrk2−/−, show increased VO2 production and VCO2 consumption. One explanation for this discrepancy between the two lines could be that with the Rgs9-Cre line, the PVH and VMH are not targeted efficiently and there is additional deletion in the striatum, cortex and hippocampus [11]. Chow-fed male Rgs9-Ntrk2−/− mice have significantly increased body weight compared to the controls and Nkx2.1-Ntrk2−/− do not. This difference is likely due to the variation in caloric makeup of the chow diet as the diet used in that study has an intermediate fat percentage (21.6% fat by calories) between the chow diet (12.7% fat by calories) and HFD (54.8% fat by calories) used in this study.

In the current study, we find that Nkx2.1-Ntrk2−/− mice exhibit increased linear growth, similar to previously described mouse models of BDNF-deficiency and TrkB hypomorphic mice [7], [8], [9], implicating the BDNF/TrkB signaling pathway in growth regulation. The melanocortin pathway also plays an important role in somatic growth [30], [40], [41], although we did not detect any differences in Mc4r gene expression in the hypothalamus of Nkx2.1-Ntrk2−/− mice compared to controls. Nevertheless, it is possible that TrkB-deficiency results in impaired melanocortin signaling and increased linear growth indirectly via this pathway.

The increased body weight phenotype in Nkx2.1-Ntrk2−/− mice is accompanied by glucose homeostasis impairments as these mice are hyperglycemic and hyperinsulinemic. Notably, at an earlier time point (8–10 weeks of age) there are no significant differences in fed or fasted blood glucose and serum insulin levels (data not shown), suggesting that this phenotype may most likely be secondary to increased body weight. Consistently, Nkx2.1-Ntrk2−/− male mice on chow diet which do not have a body weight phenotype also do not display impairments in glucose homeostasis, as measured by fed and fasted blood glucose, serum insulin levels and glucose tolerance test. The increased fed (but not fasted) blood glucose levels in chow-fed Nkx2.1-Ntrk2−/− female mice could be due to hyperphagia.

Brain-derived neurotrophic factor (BDNF) is a key neurotrophic factor that is implicated in neural circuit development and plasticity through enhancing axonal arborization and neurite outgrowth [42], [43]. BDNF has also been shown to influence neurohormone synthesis, differentiation and release in the hypothalamus [44]. Nissl staining of the Nkx2.1-Ntrk2−/− hypothalamus does not reveal a major difference in the overall hypothalamic architecture (data not shown) suggesting that the metabolic phenotype of the Nkx2.1-Ntrk2−/− mice is not a result of gross neuroanatomical abnormalities due to embryonic deletion of TrkB (starting at E10) in the hypothalamus. However, given that BDNF has potent neurotrophic effects, we cannot rule out the possibility that TrkB-deficiency within the hypothalamus results in altered neuronal connectivity. In fact, a recent study reported that BDNF-deficient mice exhibit impairments in NPY projections from the arcuate nucleus of the hypothalamus to the PVH as well as impaired POMC projections to the dorsomedial nucleus of the hypothalamus [45]. In the future, it will be very informative to perform neuronal tracing experiments in mouse models of TrkB-deficiency restricted to distinct subpopulations of neurochemically identified neurons to test whether absence of TrkB in these neuronal populations result in impairments in intrahypothalamic projections similar to BDNF-deficient mice.

Studies show that Nkx2.1 is broadly expressed in the hypothalamus. Within the arcuate nucleus, cells that express Nkx2.1 give rise to a subset of GABAergic, NPY, POMC and dopaminergic neurons or glia (tanycytes) [46]. Interestingly, a recent study has shown that in the arcuate nucleus, most of the TrkB+ neurons do not express Pomc or Npy, suggesting that they represent a distinct set of previously uncharacterized neurons [45]. In the future, it will be very informative to identify the neurochemical characteristics of the TrkB-expressing neurons in the hypothalamus to further elucidate their role in the hypothalamic circuitry controlling energy balance.

Previous studies have shown that hypothalamic BDNF expression is regulated by MC4R signaling, that BDNF acts downstream of MC4R signaling to regulate food intake and body weight, and that BDNF is required for leptin to activate hypothalamic neurons and to inhibit food intake [9], [10]. Our data show that although there are no changes in the expression of LepR and Mc4R genes in the whole hypothalamus, Nkx2.1-Ntrk2−/− mice are resistant to acute leptin-induced suppression of food intake. Thus, these findings support the notion that BDNF/TrkB signaling is an important effector in conveying leptin's effects on feeding.

Phox2b-Ntrk2−/− mice are perinatal lethal within second to third postnatal week of life despite being born in appropriate Mendelian ratios. We speculate that this is due to the vital role of TrkB signaling in the development of visceral motor neurons in the brainstem that are implicated in cardiovascular, respiratory and digestive functions [47], [48]. In the future, it will be crucial to use an inducible Cre line to overcome the lethal phenotype and to study the role of endogenous hindbrain TrkB in central metabolic control.

Consistent with the notion that hindbrain TrkB signaling is important to food intake regulation [22], Phox2b-Ntrk2+/− mice exhibit hyperphagia in the absence of a body weight phenotype. Whether these animals have increased energy expenditure to counteract the increased food intake similar to mice with hindbrain LepR deletion [31] needs further investigation. Hyperphagia observed in both HFD and to a lesser extent chow diet-fed Phox2b-Ntrk2+/− mice could be due to local action of BDNF/TrkB signaling in the NTS and DVC or through alterations in the forebrain-hindbrain wiring, likely through the PVH [49] or through projections to the mesolimbic reward centers involved in hedonic feeding [50]. Phox2b is expressed in enteric neuronal precursors that migrate from the vagal neural axis in a rostrocaudal manner to innervate the stomach and the intestine, and differentiate into enteric neurons [51], [52]. In Phox2b−/− mice, enteric neuronal precursors fail to migrate from foregut to midgut and hindgut due to increased apoptosis [47]. Notably, both BDNF and TrkB are expressed in the enteric nervous system innervating the gut. BDNF enhances enteric nervous system signaling by promoting neural activity and synaptic transmission and subsequently increasing gastrointestinal motility [53]. Furthermore, Ntrk2−/− mice show deterioration of the normal architecture of the enteric nervous system [54]. Both BDNF and TrkB expression are altered in intestinal pathologies such as Hirschprung disease and infantile hypertrophic pyloric stenosis [55], [56]. Thus, it is feasible that impairments resulting from a lack of TrkB in the enteric nervous system of Phox2b-Ntrk2+/− mice could lead to a deficiency in intestinal nutrient absorption and subsequent hyperphagia in the absence of body weight differences.

Taken together, our study establishes the importance of the hypothalamus as a key brain region in endogenous BDNF/TrkB signaling and central metabolic control and emphasizes that endogenous hindbrain BDNF/TrkB signaling has a modulatory role in food intake.

Disclosure statement

The authors have nothing to disclose.

Gene	Forward primer	Reverse primer
Pomc	5′ GACACGTGGAGATGCCGAG 3′	5′ CAGCGAGAGGTCGAGTTTGC 3′
Agrp	5′ GCGGAGGTGCTAGATCCACA 3′	5′ AGGACTCGTGCAGCCTTACAC 3′
Npy	5′ CTCCGCTCTGCGACACTACA 3′	5′ AATCAGTGTCTCAGGGCTGGA 3′
Leprb	5′ CAAACCCCAAGAATTGTTCCTGG 3′	5′ TCAGGCTCCAGAAGAAGAGGACC 3′
Hprt1	5′ GCGTCGTGATTAGCGATGATGAAC 3′	5′ CCTCCCATCTCTCCTTCATGCATCT 3′
Ucp1	5′ GGCATTCAGAGGCAAATCAGCT 3′	5′ CAATGAACACTGCCACACCTC 3′
Cidea	5′ ATCACAACTGGCCTGGTTACG 3′	5′ TACTACCCGGTGTCCATTTCT 3′
Elovl3	5′ GGACCTGATGCAACCCTATGA 3′	5′ TCCGCGTTCTCATGTAGGTCT 3′
Ppargc1a	5′ CCCTGCCATTGTTAAGACC 3′	5′ TGCTGCTGTTCCTGTTTTC 3′
Prdm16	5′ CAGCACGGTGAAGCCATTC 3′	5′ GCGTGCATCCGCTTGTG 3′